Rebuild with libmbedtls12/2.16.4 on focal

[Andrius Merkys]

ncbi-blast+ remote executions throw ugly 'Critical' warnings on focal amd64:

$ blastn -query test.fa -db nt -remote
Critical: [blastn] External MBEDTLS version mismatch: 2.16.2 headers vs. 2.16.3 runtime

[rest of the response trimmed]

where test.fa is any DNA FASTA file, for example:

>test
AAAAAAAAACCCCCCCAAAAAGGGGTTTTT

The execution and output of the aforementioned call seems otherwise normal despite the 'Critical' message.

From the buildlog on amd64 I see that ncbi-blast+ is built against libmbedtls12/2.16.2 while it is run with libmbedtls12/2.16.4. I believe rebuilding with libmbedtls12/2.16.4 would solve the issue.