https://launchpad.net/ubuntu/+source/bowtie/1.3.0+dfsg1-1/+build/20202088 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux bos02-arm64-053 4.15.0-121-generic #123-Ubuntu SMP Mon Oct 5 16:19:23 UTC 2020 aarch64 Buildd toolchain package versions: launchpad-buildd_193~468~ubuntu18.04.1 python3-lpbuildd_193~468~ubuntu18.04.1 sbuild_0.75.0-1ubuntu1 bzr-builder_0.7.3+bzr174~ppa13~ubuntu16.04.1 bzr_2.7.0+bzr6622-10 git-build-recipe_0.3.6~git201906051340.ff11471~ubuntu18.04.1 git_1:2.17.1-1ubuntu0.7 dpkg-dev_1.19.0.5ubuntu2.3 python-debian_0.1.32 python3-debian_0.1.32. Syncing the system clock with the buildd NTP service... 28 Oct 21:34:58 ntpdate[1665]: adjust time server 10.211.37.1 offset 0.001099 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=hirsute --arch=arm64 PACKAGEBUILD-20202088 --image-type chroot /home/buildd/filecache-default/d1fb963478283f19fe8f83381d93195a7691df38 Creating target for build PACKAGEBUILD-20202088 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=hirsute --arch=arm64 PACKAGEBUILD-20202088 Starting target for build PACKAGEBUILD-20202088 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=hirsute --arch=arm64 PACKAGEBUILD-20202088 'deb http://ftpmaster.internal/ubuntu hirsute main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-security main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-updates main universe' 'deb http://ftpmaster.internal/ubuntu hirsute-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-20202088 RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=hirsute --arch=arm64 PACKAGEBUILD-20202088 Updating target for build PACKAGEBUILD-20202088 Get:1 http://ftpmaster.internal/ubuntu hirsute InRelease [267 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute-security InRelease [88.4 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute-updates InRelease [88.4 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-proposed InRelease [114 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute/main arm64 Packages [1350 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute/main Translation-en [508 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/universe arm64 Packages [12.4 MB] Get:8 http://ftpmaster.internal/ubuntu hirsute/universe Translation-en [5261 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 Packages [156 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-proposed/main Translation-en [76.6 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute-proposed/universe arm64 Packages [315 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute-proposed/universe Translation-en [188 kB] Fetched 20.8 MB in 7s (2887 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages will be upgraded: apt base-files base-passwd binutils binutils-aarch64-linux-gnu binutils-common cpp-10 g++-10 gcc-10 gcc-10-base libapparmor1 libapt-pkg6.0 libasan6 libatomic1 libaudit-common libaudit1 libbinutils libcap2 libcc1-0 libcrypt-dev libcrypt1 libctf-nobfd0 libctf0 libdebconfclient0 libgcc-10-dev libgcc-s1 libgomp1 libitm1 liblsan0 libmpc3 libncurses6 libncursesw6 libnpth0 libseccomp2 libselinux1 libsemanage-common libsemanage1 libstdc++-10-dev libstdc++6 libtinfo6 libtirpc-common libtirpc-dev libtirpc3 libtsan0 libubsan1 ncurses-base ncurses-bin sysvinit-utils tzdata 49 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 158 MB of archives. After this operation, 569 MB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libcrypt-dev arm64 1:4.4.17-1ubuntu1 [109 kB] Get:2 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libcrypt1 arm64 1:4.4.17-1ubuntu1 [80.8 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute/main arm64 base-files arm64 11ubuntu16 [60.4 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libncursesw6 arm64 6.2+20200918-1 [120 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libncurses6 arm64 6.2+20200918-1 [92.4 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libtinfo6 arm64 6.2+20200918-1 [81.9 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 ncurses-bin arm64 6.2+20200918-1 [168 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libdebconfclient0 arm64 0.254ubuntu1 [6124 B] Get:9 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 base-passwd arm64 3.5.48 [46.6 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 ncurses-base all 6.2+20200918-1 [18.7 kB] Get:11 http://ftpmaster.internal/ubuntu hirsute/main arm64 sysvinit-utils arm64 2.96-5ubuntu1 [20.4 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute/main arm64 libcc1-0 arm64 10.2.0-15ubuntu1 [37.2 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute/main arm64 gcc-10-base arm64 10.2.0-15ubuntu1 [19.5 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute/main arm64 libgcc-s1 arm64 10.2.0-15ubuntu1 [34.6 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute/main arm64 libgomp1 arm64 10.2.0-15ubuntu1 [93.7 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute/main arm64 libitm1 arm64 10.2.0-15ubuntu1 [24.1 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute/main arm64 libatomic1 arm64 10.2.0-15ubuntu1 [9844 B] Get:18 http://ftpmaster.internal/ubuntu hirsute/main arm64 libasan6 arm64 10.2.0-15ubuntu1 [317 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute/main arm64 liblsan0 arm64 10.2.0-15ubuntu1 [130 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute/main arm64 libtsan0 arm64 10.2.0-15ubuntu1 [302 kB] Get:21 http://ftpmaster.internal/ubuntu hirsute/main arm64 libubsan1 arm64 10.2.0-15ubuntu1 [126 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute/main arm64 g++-10 arm64 10.2.0-15ubuntu1 [49.4 MB] Get:23 http://ftpmaster.internal/ubuntu hirsute/main arm64 libstdc++-10-dev arm64 10.2.0-15ubuntu1 [1694 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute/main arm64 libgcc-10-dev arm64 10.2.0-15ubuntu1 [909 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute/main arm64 gcc-10 arm64 10.2.0-15ubuntu1 [52.3 MB] Get:26 http://ftpmaster.internal/ubuntu hirsute/main arm64 cpp-10 arm64 10.2.0-15ubuntu1 [46.0 MB] Get:27 http://ftpmaster.internal/ubuntu hirsute/main arm64 libstdc++6 arm64 10.2.0-15ubuntu1 [462 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libmpc3 arm64 1.2.0-1 [42.3 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libctf-nobfd0 arm64 2.35.1-2ubuntu1 [44.9 kB] Get:30 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libctf0 arm64 2.35.1-2ubuntu1 [43.9 kB] Get:31 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libbinutils arm64 2.35.1-2ubuntu1 [483 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 binutils-common arm64 2.35.1-2ubuntu1 [212 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 binutils arm64 2.35.1-2ubuntu1 [3372 B] Get:34 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 binutils-aarch64-linux-gnu arm64 2.35.1-2ubuntu1 [2027 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libapt-pkg6.0 arm64 2.1.11 [764 kB] Get:36 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libseccomp2 arm64 2.4.3-1ubuntu5 [42.7 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 apt arm64 2.1.11 [1247 kB] Get:38 http://ftpmaster.internal/ubuntu hirsute/main arm64 libaudit-common all 1:2.8.5-3ubuntu2 [4092 B] Get:39 http://ftpmaster.internal/ubuntu hirsute/main arm64 libaudit1 arm64 1:2.8.5-3ubuntu2 [38.2 kB] Get:40 http://ftpmaster.internal/ubuntu hirsute/main arm64 libselinux1 arm64 3.1-2build1 [65.5 kB] Get:41 http://ftpmaster.internal/ubuntu hirsute/main arm64 libsemanage-common all 3.1-1build1 [10.1 kB] Get:42 http://ftpmaster.internal/ubuntu hirsute/main arm64 libsemanage1 arm64 3.1-1build1 [80.8 kB] Get:43 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libtirpc-common all 1.2.6-3 [7444 B] Get:44 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libtirpc-dev arm64 1.2.6-3 [185 kB] Get:45 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libtirpc3 arm64 1.2.6-3 [73.4 kB] Get:46 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libapparmor1 arm64 3.0.0-0ubuntu2 [35.2 kB] Get:47 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libcap2 arm64 1:2.44-1 [16.7 kB] Get:48 http://ftpmaster.internal/ubuntu hirsute/main arm64 tzdata all 2020d-1ubuntu1 [293 kB] Get:49 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libnpth0 arm64 1.6-3 [7824 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 158 MB in 7s (22.9 MB/s) (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../libcrypt-dev_1%3a4.4.17-1ubuntu1_arm64.deb ... Unpacking libcrypt-dev:arm64 (1:4.4.17-1ubuntu1) over (1:4.4.16-1ubuntu1) ... Preparing to unpack .../libcrypt1_1%3a4.4.17-1ubuntu1_arm64.deb ... Unpacking libcrypt1:arm64 (1:4.4.17-1ubuntu1) over (1:4.4.16-1ubuntu1) ... Setting up libcrypt1:arm64 (1:4.4.17-1ubuntu1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../base-files_11ubuntu16_arm64.deb ... Unpacking base-files (11ubuntu16) over (11ubuntu14) ... Setting up base-files (11ubuntu16) ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../libncursesw6_6.2+20200918-1_arm64.deb ... Unpacking libncursesw6:arm64 (6.2+20200918-1) over (6.2-1) ... Preparing to unpack .../libncurses6_6.2+20200918-1_arm64.deb ... Unpacking libncurses6:arm64 (6.2+20200918-1) over (6.2-1) ... Preparing to unpack .../libtinfo6_6.2+20200918-1_arm64.deb ... Unpacking libtinfo6:arm64 (6.2+20200918-1) over (6.2-1) ... Setting up libtinfo6:arm64 (6.2+20200918-1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../ncurses-bin_6.2+20200918-1_arm64.deb ... Unpacking ncurses-bin (6.2+20200918-1) over (6.2-1) ... Setting up ncurses-bin (6.2+20200918-1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../libdebconfclient0_0.254ubuntu1_arm64.deb ... Unpacking libdebconfclient0:arm64 (0.254ubuntu1) over (0.252ubuntu1) ... Setting up libdebconfclient0:arm64 (0.254ubuntu1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../base-passwd_3.5.48_arm64.deb ... Unpacking base-passwd (3.5.48) over (3.5.47) ... Setting up base-passwd (3.5.48) ... Changing home-directory of irc from /var/run/ircd to /run/ircd 1 changes have been made, rewriting files Writing passwd-file to /etc/passwd Writing shadow-file to /etc/shadow Writing group-file to /etc/group (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../ncurses-base_6.2+20200918-1_all.deb ... Unpacking ncurses-base (6.2+20200918-1) over (6.2-1) ... Setting up ncurses-base (6.2+20200918-1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../sysvinit-utils_2.96-5ubuntu1_arm64.deb ... Unpacking sysvinit-utils (2.96-5ubuntu1) over (2.96-3ubuntu1) ... Setting up sysvinit-utils (2.96-5ubuntu1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../libcc1-0_10.2.0-15ubuntu1_arm64.deb ... Unpacking libcc1-0:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../gcc-10-base_10.2.0-15ubuntu1_arm64.deb ... Unpacking gcc-10-base:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Setting up gcc-10-base:arm64 (10.2.0-15ubuntu1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../libgcc-s1_10.2.0-15ubuntu1_arm64.deb ... Unpacking libgcc-s1:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Setting up libgcc-s1:arm64 (10.2.0-15ubuntu1) ... (Reading database ... 12970 files and directories currently installed.) Preparing to unpack .../00-libgomp1_10.2.0-15ubuntu1_arm64.deb ... Unpacking libgomp1:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../01-libitm1_10.2.0-15ubuntu1_arm64.deb ... Unpacking libitm1:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../02-libatomic1_10.2.0-15ubuntu1_arm64.deb ... Unpacking libatomic1:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../03-libasan6_10.2.0-15ubuntu1_arm64.deb ... Unpacking libasan6:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../04-liblsan0_10.2.0-15ubuntu1_arm64.deb ... Unpacking liblsan0:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../05-libtsan0_10.2.0-15ubuntu1_arm64.deb ... Unpacking libtsan0:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../06-libubsan1_10.2.0-15ubuntu1_arm64.deb ... Unpacking libubsan1:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../07-g++-10_10.2.0-15ubuntu1_arm64.deb ... Unpacking g++-10 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../08-libstdc++-10-dev_10.2.0-15ubuntu1_arm64.deb ... Unpacking libstdc++-10-dev:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../09-libgcc-10-dev_10.2.0-15ubuntu1_arm64.deb ... Unpacking libgcc-10-dev:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../10-gcc-10_10.2.0-15ubuntu1_arm64.deb ... Unpacking gcc-10 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../11-cpp-10_10.2.0-15ubuntu1_arm64.deb ... Unpacking cpp-10 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Preparing to unpack .../12-libstdc++6_10.2.0-15ubuntu1_arm64.deb ... Unpacking libstdc++6:arm64 (10.2.0-15ubuntu1) over (10.2.0-13ubuntu1) ... Setting up libstdc++6:arm64 (10.2.0-15ubuntu1) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../0-libmpc3_1.2.0-1_arm64.deb ... Unpacking libmpc3:arm64 (1.2.0-1) over (1.2.0~rc1-1) ... Preparing to unpack .../1-libctf-nobfd0_2.35.1-2ubuntu1_arm64.deb ... Unpacking libctf-nobfd0:arm64 (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../2-libctf0_2.35.1-2ubuntu1_arm64.deb ... Unpacking libctf0:arm64 (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../3-libbinutils_2.35.1-2ubuntu1_arm64.deb ... Unpacking libbinutils:arm64 (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../4-binutils-common_2.35.1-2ubuntu1_arm64.deb ... Unpacking binutils-common:arm64 (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../5-binutils_2.35.1-2ubuntu1_arm64.deb ... Unpacking binutils (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../6-binutils-aarch64-linux-gnu_2.35.1-2ubuntu1_arm64.deb ... Unpacking binutils-aarch64-linux-gnu (2.35.1-2ubuntu1) over (2.35.1-1ubuntu1) ... Preparing to unpack .../7-libapt-pkg6.0_2.1.11_arm64.deb ... Unpacking libapt-pkg6.0:arm64 (2.1.11) over (2.1.10) ... Setting up libapt-pkg6.0:arm64 (2.1.11) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libseccomp2_2.4.3-1ubuntu5_arm64.deb ... Unpacking libseccomp2:arm64 (2.4.3-1ubuntu5) over (2.4.3-1ubuntu4) ... Setting up libseccomp2:arm64 (2.4.3-1ubuntu5) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../archives/apt_2.1.11_arm64.deb ... Unpacking apt (2.1.11) over (2.1.10) ... Setting up apt (2.1.11) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libaudit-common_1%3a2.8.5-3ubuntu2_all.deb ... Unpacking libaudit-common (1:2.8.5-3ubuntu2) over (1:2.8.5-3ubuntu1) ... Setting up libaudit-common (1:2.8.5-3ubuntu2) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a2.8.5-3ubuntu2_arm64.deb ... Unpacking libaudit1:arm64 (1:2.8.5-3ubuntu2) over (1:2.8.5-3ubuntu1) ... Setting up libaudit1:arm64 (1:2.8.5-3ubuntu2) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libselinux1_3.1-2build1_arm64.deb ... Unpacking libselinux1:arm64 (3.1-2build1) over (3.1-2) ... Setting up libselinux1:arm64 (3.1-2build1) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libsemanage-common_3.1-1build1_all.deb ... Unpacking libsemanage-common (3.1-1build1) over (3.1-1) ... Setting up libsemanage-common (3.1-1build1) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libsemanage1_3.1-1build1_arm64.deb ... Unpacking libsemanage1:arm64 (3.1-1build1) over (3.1-1) ... Setting up libsemanage1:arm64 (3.1-1build1) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libtirpc-common_1.2.6-3_all.deb ... Unpacking libtirpc-common (1.2.6-3) over (1.2.6-1build1) ... Setting up libtirpc-common (1.2.6-3) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libtirpc-dev_1.2.6-3_arm64.deb ... Unpacking libtirpc-dev:arm64 (1.2.6-3) over (1.2.6-1build1) ... Preparing to unpack .../libtirpc3_1.2.6-3_arm64.deb ... Unpacking libtirpc3:arm64 (1.2.6-3) over (1.2.6-1build1) ... Setting up libtirpc3:arm64 (1.2.6-3) ... (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../libapparmor1_3.0.0-0ubuntu2_arm64.deb ... Unpacking libapparmor1:arm64 (3.0.0-0ubuntu2) over (3.0.0-0ubuntu1) ... Preparing to unpack .../libcap2_1%3a2.44-1_arm64.deb ... Unpacking libcap2:arm64 (1:2.44-1) over (1:2.43-1) ... Preparing to unpack .../tzdata_2020d-1ubuntu1_all.deb ... Unpacking tzdata (2020d-1ubuntu1) over (2020b-1ubuntu1) ... Preparing to unpack .../libnpth0_1.6-3_arm64.deb ... Unpacking libnpth0:arm64 (1.6-3) over (1.6-2) ... Setting up libapparmor1:arm64 (3.0.0-0ubuntu2) ... Setting up binutils-common:arm64 (2.35.1-2ubuntu1) ... Setting up libctf-nobfd0:arm64 (2.35.1-2ubuntu1) ... Setting up libnpth0:arm64 (1.6-3) ... Setting up libgomp1:arm64 (10.2.0-15ubuntu1) ... Setting up libcap2:arm64 (1:2.44-1) ... Setting up libasan6:arm64 (10.2.0-15ubuntu1) ... Setting up tzdata (2020d-1ubuntu1) ... Current default time zone: 'Etc/UTC' Local time is now: Wed Oct 28 21:36:25 UTC 2020. Universal Time is now: Wed Oct 28 21:36:25 UTC 2020. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libtirpc-dev:arm64 (1.2.6-3) ... Setting up libncurses6:arm64 (6.2+20200918-1) ... Setting up libmpc3:arm64 (1.2.0-1) ... Setting up libatomic1:arm64 (10.2.0-15ubuntu1) ... Setting up libncursesw6:arm64 (6.2+20200918-1) ... Setting up libubsan1:arm64 (10.2.0-15ubuntu1) ... Setting up libcrypt-dev:arm64 (1:4.4.17-1ubuntu1) ... Setting up libbinutils:arm64 (2.35.1-2ubuntu1) ... Setting up libcc1-0:arm64 (10.2.0-15ubuntu1) ... Setting up liblsan0:arm64 (10.2.0-15ubuntu1) ... Setting up cpp-10 (10.2.0-15ubuntu1) ... Setting up libitm1:arm64 (10.2.0-15ubuntu1) ... Setting up libtsan0:arm64 (10.2.0-15ubuntu1) ... Setting up libctf0:arm64 (2.35.1-2ubuntu1) ... Setting up libgcc-10-dev:arm64 (10.2.0-15ubuntu1) ... Setting up binutils-aarch64-linux-gnu (2.35.1-2ubuntu1) ... Setting up binutils (2.35.1-2ubuntu1) ... Setting up gcc-10 (10.2.0-15ubuntu1) ... Setting up libstdc++-10-dev:arm64 (10.2.0-15ubuntu1) ... Setting up g++-10 (10.2.0-15ubuntu1) ... Processing triggers for libc-bin (2.32-0ubuntu3) ... RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-20202088 arm64 hirsute-proposed -c chroot:build-PACKAGEBUILD-20202088 --arch=arm64 --dist=hirsute-proposed --nolog bowtie_1.3.0+dfsg1-1.dsc Initiating build PACKAGEBUILD-20202088 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 4.15.0-121-generic #123-Ubuntu SMP Mon Oct 5 16:19:23 UTC 2020 aarch64 sbuild (Debian sbuild) 0.75.0 (21 Mar 2018) on bos02-arm64-053.buildd +==============================================================================+ | bowtie 1.3.0+dfsg1-1 (arm64) Wed, 28 Oct 2020 21:36:28 +0000 | +==============================================================================+ Package: bowtie Version: 1.3.0+dfsg1-1 Source Version: 1.3.0+dfsg1-1 Distribution: hirsute-proposed Machine Architecture: arm64 Host Architecture: arm64 Build Architecture: arm64 Build Type: any I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-20202088/chroot-autobuild' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- bowtie_1.3.0+dfsg1-1.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/bowtie-U8bnDR/bowtie-1.3.0+dfsg1' with '<>' I: NOTICE: Log filtering will replace 'build/bowtie-U8bnDR' with '<>' +------------------------------------------------------------------------------+ | Install build-essential | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<>/resolver-cxm5BJ/apt_archive/sbuild-build-depends-core-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 1 entries to output Packages file. Ign:1 copy:/<>/resolver-cxm5BJ/apt_archive ./ InRelease Get:2 copy:/<>/resolver-cxm5BJ/apt_archive ./ Release [957 B] Ign:3 copy:/<>/resolver-cxm5BJ/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-cxm5BJ/apt_archive ./ Sources [349 B] Get:5 copy:/<>/resolver-cxm5BJ/apt_archive ./ Packages [431 B] Fetched 1737 B in 0s (35.5 kB/s) Reading package lists... Reading package lists... Install core build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 852 B of archives. After this operation, 0 B of additional disk space will be used. Get:1 copy:/<>/resolver-cxm5BJ/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [852 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 852 B in 0s (54.3 kB/s) Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_arm64.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (arm64 included in any-amd64 alpha arm64 mips64el ppc64 ppc64el s390x sparc64 riscv64 all) +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl Filtered Build-Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl dpkg-deb: building package 'sbuild-build-depends-bowtie-dummy' in '/<>/resolver-cxm5BJ/apt_archive/sbuild-build-depends-bowtie-dummy.deb'. dpkg-scanpackages: warning: Packages in archive but missing from override file: dpkg-scanpackages: warning: sbuild-build-depends-bowtie-dummy sbuild-build-depends-core-dummy dpkg-scanpackages: info: Wrote 2 entries to output Packages file. Ign:1 copy:/<>/resolver-cxm5BJ/apt_archive ./ InRelease Get:2 copy:/<>/resolver-cxm5BJ/apt_archive ./ Release [963 B] Ign:3 copy:/<>/resolver-cxm5BJ/apt_archive ./ Release.gpg Get:4 copy:/<>/resolver-cxm5BJ/apt_archive ./ Sources [544 B] Get:5 copy:/<>/resolver-cxm5BJ/apt_archive ./ Packages [620 B] Fetched 2127 B in 0s (47.1 kB/s) Reading package lists... Reading package lists... Install bowtie build dependencies (apt-based resolver) ------------------------------------------------------ Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff-base help2man intltool-debian libarchive-zip-perl libclone-perl libconfig-general-perl libcroco3 libdebhelper-perl libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libicu67 liblocale-gettext-perl libmagic-mgc libmagic1 libpipeline1 libpython3-stdlib libpython3.8-minimal libpython3.8-stdlib libsigsegv2 libsub-override-perl libsys-info-base-perl libsys-info-driver-linux-perl libsys-info-perl libtbb-dev libtbb2 libtest-deep-perl libtool libuchardet0 libunix-processors-perl libxml2 m4 man-db mime-support po-debconf python3 python3-minimal python3.8 python3.8-minimal zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libtbb-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libmail-box-perl python3-doc python3-tk python3-venv python3.8-venv python3.8-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs libltdl-dev libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff-base help2man intltool-debian libarchive-zip-perl libclone-perl libconfig-general-perl libcroco3 libdebhelper-perl libelf1 libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libicu67 liblocale-gettext-perl libmagic-mgc libmagic1 libpipeline1 libpython3-stdlib libpython3.8-minimal libpython3.8-stdlib libsigsegv2 libsub-override-perl libsys-info-base-perl libsys-info-driver-linux-perl libsys-info-perl libtbb-dev libtbb2 libtest-deep-perl libtool libuchardet0 libunix-processors-perl libxml2 m4 man-db mime-support po-debconf python3 python3-minimal python3.8 python3.8-minimal sbuild-build-depends-bowtie-dummy zlib1g-dev 0 upgraded, 54 newly installed, 0 to remove and 0 not upgraded. Need to get 22.4 MB of archives. After this operation, 90.3 MB of additional disk space will be used. Get:1 copy:/<>/resolver-cxm5BJ/apt_archive ./ sbuild-build-depends-bowtie-dummy 0.invalid.0 [920 B] Get:2 http://ftpmaster.internal/ubuntu hirsute/main arm64 liblocale-gettext-perl arm64 1.07-4 [16.7 kB] Get:3 http://ftpmaster.internal/ubuntu hirsute/main arm64 libpython3.8-minimal arm64 3.8.6-1 [712 kB] Get:4 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libexpat1 arm64 2.2.10-1 [61.9 kB] Get:5 http://ftpmaster.internal/ubuntu hirsute/main arm64 python3.8-minimal arm64 3.8.6-1 [1752 kB] Get:6 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 python3-minimal arm64 3.8.6-1 [24.1 kB] Get:7 http://ftpmaster.internal/ubuntu hirsute/main arm64 mime-support all 3.64ubuntu1 [30.6 kB] Get:8 http://ftpmaster.internal/ubuntu hirsute/main arm64 libpython3.8-stdlib arm64 3.8.6-1 [1709 kB] Get:9 http://ftpmaster.internal/ubuntu hirsute/main arm64 python3.8 arm64 3.8.6-1 [376 kB] Get:10 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libpython3-stdlib arm64 3.8.6-1 [7416 B] Get:11 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 python3 arm64 3.8.6-1 [48.8 kB] Get:12 http://ftpmaster.internal/ubuntu hirsute/main arm64 bsdextrautils arm64 2.36-3ubuntu1 [74.2 kB] Get:13 http://ftpmaster.internal/ubuntu hirsute/main arm64 libuchardet0 arm64 0.0.7-1 [68.0 kB] Get:14 http://ftpmaster.internal/ubuntu hirsute/main arm64 groff-base arm64 1.22.4-5 [797 kB] Get:15 http://ftpmaster.internal/ubuntu hirsute/main arm64 libpipeline1 arm64 1.5.3-1 [26.1 kB] Get:16 http://ftpmaster.internal/ubuntu hirsute/main arm64 man-db arm64 2.9.3-2 [1100 kB] Get:17 http://ftpmaster.internal/ubuntu hirsute/main arm64 libmagic-mgc arm64 1:5.38-5 [218 kB] Get:18 http://ftpmaster.internal/ubuntu hirsute/main arm64 libmagic1 arm64 1:5.38-5 [71.6 kB] Get:19 http://ftpmaster.internal/ubuntu hirsute/main arm64 file arm64 1:5.38-5 [23.3 kB] Get:20 http://ftpmaster.internal/ubuntu hirsute/main arm64 libelf1 arm64 0.181-1 [43.4 kB] Get:21 http://ftpmaster.internal/ubuntu hirsute/main arm64 libglib2.0-0 arm64 2.66.1-2 [1214 kB] Get:22 http://ftpmaster.internal/ubuntu hirsute/main arm64 libicu67 arm64 67.1-4 [8461 kB] Get:23 http://ftpmaster.internal/ubuntu hirsute-proposed/main arm64 libxml2 arm64 2.9.10+dfsg-6.1 [558 kB] Get:24 http://ftpmaster.internal/ubuntu hirsute/main arm64 gettext-base arm64 0.19.8.1-10build1 [48.2 kB] Get:25 http://ftpmaster.internal/ubuntu hirsute/main arm64 libsigsegv2 arm64 2.12-2build1 [13.7 kB] Get:26 http://ftpmaster.internal/ubuntu hirsute/main arm64 m4 arm64 1.4.18-4 [194 kB] Get:27 http://ftpmaster.internal/ubuntu hirsute/main arm64 autoconf all 2.69-11.1 [321 kB] Get:28 http://ftpmaster.internal/ubuntu hirsute/main arm64 autotools-dev all 20180224.1 [39.6 kB] Get:29 http://ftpmaster.internal/ubuntu hirsute/main arm64 automake all 1:1.16.2-4ubuntu1 [548 kB] Get:30 http://ftpmaster.internal/ubuntu hirsute/main arm64 autopoint all 0.19.8.1-10build1 [412 kB] Get:31 http://ftpmaster.internal/ubuntu hirsute/main arm64 libtool all 2.4.6-14 [161 kB] Get:32 http://ftpmaster.internal/ubuntu hirsute/main arm64 dh-autoreconf all 19 [16.1 kB] Get:33 http://ftpmaster.internal/ubuntu hirsute/main arm64 libdebhelper-perl all 13.2.1ubuntu1 [63.6 kB] Get:34 http://ftpmaster.internal/ubuntu hirsute/main arm64 libarchive-zip-perl all 1.68-1 [90.2 kB] Get:35 http://ftpmaster.internal/ubuntu hirsute/main arm64 libsub-override-perl all 0.09-2 [9532 B] Get:36 http://ftpmaster.internal/ubuntu hirsute/main arm64 libfile-stripnondeterminism-perl all 1.9.0-1 [17.2 kB] Get:37 http://ftpmaster.internal/ubuntu hirsute/main arm64 dh-strip-nondeterminism all 1.9.0-1 [5192 B] Get:38 http://ftpmaster.internal/ubuntu hirsute/main arm64 dwz arm64 0.13-5 [134 kB] Get:39 http://ftpmaster.internal/ubuntu hirsute/main arm64 libcroco3 arm64 0.6.13-1 [77.1 kB] Get:40 http://ftpmaster.internal/ubuntu hirsute/main arm64 gettext arm64 0.19.8.1-10build1 [850 kB] Get:41 http://ftpmaster.internal/ubuntu hirsute/main arm64 intltool-debian all 0.35.0+20060710.5 [24.9 kB] Get:42 http://ftpmaster.internal/ubuntu hirsute/main arm64 po-debconf all 1.0.21 [233 kB] Get:43 http://ftpmaster.internal/ubuntu hirsute/main arm64 debhelper all 13.2.1ubuntu1 [879 kB] Get:44 http://ftpmaster.internal/ubuntu hirsute/universe arm64 help2man arm64 1.47.16 [173 kB] Get:45 http://ftpmaster.internal/ubuntu hirsute/main arm64 libclone-perl arm64 0.45-1 [10.4 kB] Get:46 http://ftpmaster.internal/ubuntu hirsute/main arm64 libconfig-general-perl all 2.63-1 [53.9 kB] Get:47 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libsys-info-base-perl all 0.7807-3 [27.7 kB] Get:48 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libunix-processors-perl arm64 2.046-2 [15.0 kB] Get:49 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libsys-info-driver-linux-perl all 0.7905-2 [23.2 kB] Get:50 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libsys-info-perl all 0.7811-2 [6500 B] Get:51 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libtest-deep-perl all 1.130-1 [41.5 kB] Get:52 http://ftpmaster.internal/ubuntu hirsute/main arm64 zlib1g-dev arm64 1:1.2.11.dfsg-2ubuntu4 [154 kB] Get:53 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libtbb2 arm64 2020.3-1 [94.6 kB] Get:54 http://ftpmaster.internal/ubuntu hirsute/universe arm64 libtbb-dev arm64 2020.3-1 [274 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 22.4 MB in 1s (20.6 MB/s) Selecting previously unselected package liblocale-gettext-perl. (Reading database ... 12968 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-4_arm64.deb ... Unpacking liblocale-gettext-perl (1.07-4) ... Selecting previously unselected package libpython3.8-minimal:arm64. Preparing to unpack .../libpython3.8-minimal_3.8.6-1_arm64.deb ... Unpacking libpython3.8-minimal:arm64 (3.8.6-1) ... Selecting previously unselected package libexpat1:arm64. Preparing to unpack .../libexpat1_2.2.10-1_arm64.deb ... Unpacking libexpat1:arm64 (2.2.10-1) ... Selecting previously unselected package python3.8-minimal. Preparing to unpack .../python3.8-minimal_3.8.6-1_arm64.deb ... Unpacking python3.8-minimal (3.8.6-1) ... Setting up libpython3.8-minimal:arm64 (3.8.6-1) ... Setting up libexpat1:arm64 (2.2.10-1) ... Setting up python3.8-minimal (3.8.6-1) ... Selecting previously unselected package python3-minimal. (Reading database ... 13273 files and directories currently installed.) Preparing to unpack .../python3-minimal_3.8.6-1_arm64.deb ... Unpacking python3-minimal (3.8.6-1) ... Selecting previously unselected package mime-support. Preparing to unpack .../mime-support_3.64ubuntu1_all.deb ... Unpacking mime-support (3.64ubuntu1) ... Selecting previously unselected package libpython3.8-stdlib:arm64. Preparing to unpack .../libpython3.8-stdlib_3.8.6-1_arm64.deb ... Unpacking libpython3.8-stdlib:arm64 (3.8.6-1) ... Selecting previously unselected package python3.8. Preparing to unpack .../python3.8_3.8.6-1_arm64.deb ... Unpacking python3.8 (3.8.6-1) ... Selecting previously unselected package libpython3-stdlib:arm64. Preparing to unpack .../libpython3-stdlib_3.8.6-1_arm64.deb ... Unpacking libpython3-stdlib:arm64 (3.8.6-1) ... Setting up python3-minimal (3.8.6-1) ... Selecting previously unselected package python3. (Reading database ... 13670 files and directories currently installed.) Preparing to unpack .../00-python3_3.8.6-1_arm64.deb ... Unpacking python3 (3.8.6-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../01-bsdextrautils_2.36-3ubuntu1_arm64.deb ... Unpacking bsdextrautils (2.36-3ubuntu1) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../02-libuchardet0_0.0.7-1_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../03-groff-base_1.22.4-5_arm64.deb ... Unpacking groff-base (1.22.4-5) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../04-libpipeline1_1.5.3-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../05-man-db_2.9.3-2_arm64.deb ... Unpacking man-db (2.9.3-2) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../06-libmagic-mgc_1%3a5.38-5_arm64.deb ... Unpacking libmagic-mgc (1:5.38-5) ... Selecting previously unselected package libmagic1:arm64. Preparing to unpack .../07-libmagic1_1%3a5.38-5_arm64.deb ... Unpacking libmagic1:arm64 (1:5.38-5) ... Selecting previously unselected package file. Preparing to unpack .../08-file_1%3a5.38-5_arm64.deb ... Unpacking file (1:5.38-5) ... Selecting previously unselected package libelf1:arm64. Preparing to unpack .../09-libelf1_0.181-1_arm64.deb ... Unpacking libelf1:arm64 (0.181-1) ... Selecting previously unselected package libglib2.0-0:arm64. Preparing to unpack .../10-libglib2.0-0_2.66.1-2_arm64.deb ... Unpacking libglib2.0-0:arm64 (2.66.1-2) ... Selecting previously unselected package libicu67:arm64. Preparing to unpack .../11-libicu67_67.1-4_arm64.deb ... Unpacking libicu67:arm64 (67.1-4) ... Selecting previously unselected package libxml2:arm64. Preparing to unpack .../12-libxml2_2.9.10+dfsg-6.1_arm64.deb ... Unpacking libxml2:arm64 (2.9.10+dfsg-6.1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../13-gettext-base_0.19.8.1-10build1_arm64.deb ... Unpacking gettext-base (0.19.8.1-10build1) ... Selecting previously unselected package libsigsegv2:arm64. Preparing to unpack .../14-libsigsegv2_2.12-2build1_arm64.deb ... Unpacking libsigsegv2:arm64 (2.12-2build1) ... Selecting previously unselected package m4. Preparing to unpack .../15-m4_1.4.18-4_arm64.deb ... Unpacking m4 (1.4.18-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../16-autoconf_2.69-11.1_all.deb ... Unpacking autoconf (2.69-11.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../17-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../18-automake_1%3a1.16.2-4ubuntu1_all.deb ... Unpacking automake (1:1.16.2-4ubuntu1) ... Selecting previously unselected package autopoint. Preparing to unpack .../19-autopoint_0.19.8.1-10build1_all.deb ... Unpacking autopoint (0.19.8.1-10build1) ... Selecting previously unselected package libtool. Preparing to unpack .../20-libtool_2.4.6-14_all.deb ... Unpacking libtool (2.4.6-14) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../21-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../22-libdebhelper-perl_13.2.1ubuntu1_all.deb ... Unpacking libdebhelper-perl (13.2.1ubuntu1) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../23-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../24-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../25-libfile-stripnondeterminism-perl_1.9.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.9.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../26-dh-strip-nondeterminism_1.9.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.9.0-1) ... Selecting previously unselected package dwz. Preparing to unpack .../27-dwz_0.13-5_arm64.deb ... Unpacking dwz (0.13-5) ... Selecting previously unselected package libcroco3:arm64. Preparing to unpack .../28-libcroco3_0.6.13-1_arm64.deb ... Unpacking libcroco3:arm64 (0.6.13-1) ... Selecting previously unselected package gettext. Preparing to unpack .../29-gettext_0.19.8.1-10build1_arm64.deb ... Unpacking gettext (0.19.8.1-10build1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../30-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../31-po-debconf_1.0.21_all.deb ... Unpacking po-debconf (1.0.21) ... Selecting previously unselected package debhelper. Preparing to unpack .../32-debhelper_13.2.1ubuntu1_all.deb ... Unpacking debhelper (13.2.1ubuntu1) ... Selecting previously unselected package help2man. Preparing to unpack .../33-help2man_1.47.16_arm64.deb ... Unpacking help2man (1.47.16) ... Selecting previously unselected package libclone-perl. Preparing to unpack .../34-libclone-perl_0.45-1_arm64.deb ... Unpacking libclone-perl (0.45-1) ... Selecting previously unselected package libconfig-general-perl. Preparing to unpack .../35-libconfig-general-perl_2.63-1_all.deb ... Unpacking libconfig-general-perl (2.63-1) ... Selecting previously unselected package libsys-info-base-perl. Preparing to unpack .../36-libsys-info-base-perl_0.7807-3_all.deb ... Unpacking libsys-info-base-perl (0.7807-3) ... Selecting previously unselected package libunix-processors-perl. Preparing to unpack .../37-libunix-processors-perl_2.046-2_arm64.deb ... Unpacking libunix-processors-perl (2.046-2) ... Selecting previously unselected package libsys-info-driver-linux-perl. Preparing to unpack .../38-libsys-info-driver-linux-perl_0.7905-2_all.deb ... Unpacking libsys-info-driver-linux-perl (0.7905-2) ... Selecting previously unselected package libsys-info-perl. Preparing to unpack .../39-libsys-info-perl_0.7811-2_all.deb ... Unpacking libsys-info-perl (0.7811-2) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../40-libtest-deep-perl_1.130-1_all.deb ... Unpacking libtest-deep-perl (1.130-1) ... Selecting previously unselected package zlib1g-dev:arm64. Preparing to unpack .../41-zlib1g-dev_1%3a1.2.11.dfsg-2ubuntu4_arm64.deb ... Unpacking zlib1g-dev:arm64 (1:1.2.11.dfsg-2ubuntu4) ... Selecting previously unselected package libtbb2:arm64. Preparing to unpack .../42-libtbb2_2020.3-1_arm64.deb ... Unpacking libtbb2:arm64 (2020.3-1) ... Selecting previously unselected package libtbb-dev:arm64. Preparing to unpack .../43-libtbb-dev_2020.3-1_arm64.deb ... Unpacking libtbb-dev:arm64 (2020.3-1) ... Selecting previously unselected package sbuild-build-depends-bowtie-dummy. Preparing to unpack .../44-sbuild-build-depends-bowtie-dummy_0.invalid.0_arm64.deb ... Unpacking sbuild-build-depends-bowtie-dummy (0.invalid.0) ... Setting up libpipeline1:arm64 (1.5.3-1) ... Setting up libconfig-general-perl (2.63-1) ... Setting up mime-support (3.64ubuntu1) ... Setting up bsdextrautils (2.36-3ubuntu1) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:arm64 (67.1-4) ... Setting up libtest-deep-perl (1.130-1) ... Setting up libmagic-mgc (1:5.38-5) ... Setting up libclone-perl (0.45-1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libglib2.0-0:arm64 (2.66.1-2) ... No schema files found: doing nothing. Setting up libdebhelper-perl (13.2.1ubuntu1) ... Setting up libtbb2:arm64 (2020.3-1) ... Setting up libmagic1:arm64 (1:5.38-5) ... Setting up gettext-base (0.19.8.1-10build1) ... Setting up file (1:5.38-5) ... Setting up autotools-dev (20180224.1) ... Setting up libsigsegv2:arm64 (2.12-2build1) ... Setting up libunix-processors-perl (2.046-2) ... Setting up autopoint (0.19.8.1-10build1) ... Setting up zlib1g-dev:arm64 (1:1.2.11.dfsg-2ubuntu4) ... Setting up libuchardet0:arm64 (0.0.7-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libtbb-dev:arm64 (2020.3-1) ... Setting up libpython3.8-stdlib:arm64 (3.8.6-1) ... Setting up python3.8 (3.8.6-1) ... Setting up libsys-info-base-perl (0.7807-3) ... Setting up libelf1:arm64 (0.181-1) ... Setting up libxml2:arm64 (2.9.10+dfsg-6.1) ... Setting up liblocale-gettext-perl (1.07-4) ... Setting up libpython3-stdlib:arm64 (3.8.6-1) ... Setting up libfile-stripnondeterminism-perl (1.9.0-1) ... Setting up libsys-info-driver-linux-perl (0.7905-2) ... Setting up libtool (2.4.6-14) ... Setting up m4 (1.4.18-4) ... Setting up python3 (3.8.6-1) ... Setting up help2man (1.47.16) ... Setting up libcroco3:arm64 (0.6.13-1) ... Setting up autoconf (2.69-11.1) ... Setting up dh-strip-nondeterminism (1.9.0-1) ... Setting up dwz (0.13-5) ... Setting up groff-base (1.22.4-5) ... Setting up automake (1:1.16.2-4ubuntu1) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libsys-info-perl (0.7811-2) ... Setting up gettext (0.19.8.1-10build1) ... Setting up man-db (2.9.3-2) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /lib/systemd/system/man-db.timer. Setting up intltool-debian (0.35.0+20060710.5) ... Setting up po-debconf (1.0.21) ... Setting up debhelper (13.2.1ubuntu1) ... Setting up dh-autoreconf (19) ... Setting up sbuild-build-depends-bowtie-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.32-0ubuntu3) ... +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 4.15.0-121-generic arm64 (aarch64) Toolchain package versions: binutils_2.35.1-2ubuntu1 dpkg-dev_1.20.5ubuntu2 g++-10_10.2.0-15ubuntu1 gcc-10_10.2.0-15ubuntu1 libc6-dev_2.32-0ubuntu3 libstdc++-10-dev_10.2.0-15ubuntu1 libstdc++6_10.2.0-15ubuntu1 linux-libc-dev_5.8.0-25.26 Package versions: adduser_3.118ubuntu2 advancecomp_2.1-2.1build1 apt_2.1.11 autoconf_2.69-11.1 automake_1:1.16.2-4ubuntu1 autopoint_0.19.8.1-10build1 autotools-dev_20180224.1 base-files_11ubuntu16 base-passwd_3.5.48 bash_5.0-6ubuntu2 binutils_2.35.1-2ubuntu1 binutils-aarch64-linux-gnu_2.35.1-2ubuntu1 binutils-common_2.35.1-2ubuntu1 bsdextrautils_2.36-3ubuntu1 bsdutils_1:2.36-3ubuntu1 build-essential_12.8ubuntu3 bzip2_1.0.8-4ubuntu2 ca-certificates_20200601 coreutils_8.32-3ubuntu1 cpp_4:10.2.0-1ubuntu1 cpp-10_10.2.0-15ubuntu1 dash_0.5.10.2-7 debconf_1.5.74 debhelper_13.2.1ubuntu1 debianutils_4.11.2 dh-autoreconf_19 dh-strip-nondeterminism_1.9.0-1 diffutils_1:3.7-3ubuntu1 dpkg_1.20.5ubuntu2 dpkg-dev_1.20.5ubuntu2 dwz_0.13-5 e2fsprogs_1.45.6-1ubuntu1 fakeroot_1.25.2-1 file_1:5.38-5 findutils_4.7.0-1ubuntu2 g++_4:10.2.0-1ubuntu1 g++-10_10.2.0-15ubuntu1 gcc_4:10.2.0-1ubuntu1 gcc-10_10.2.0-15ubuntu1 gcc-10-base_10.2.0-15ubuntu1 gettext_0.19.8.1-10build1 gettext-base_0.19.8.1-10build1 gpg_2.2.20-1ubuntu1 gpg-agent_2.2.20-1ubuntu1 gpgconf_2.2.20-1ubuntu1 gpgv_2.2.20-1ubuntu1 grep_3.4-1 groff-base_1.22.4-5 gzip_1.10-2ubuntu1 help2man_1.47.16 hostname_3.23 init_1.58 init-system-helpers_1.58 intltool-debian_0.35.0+20060710.5 libacl1_2.2.53-8 libapparmor1_3.0.0-0ubuntu2 libapt-pkg6.0_2.1.11 libarchive-zip-perl_1.68-1 libargon2-1_0~20171227-0.2build20.10.0 libasan6_10.2.0-15ubuntu1 libassuan0_2.5.3-7.1 libatomic1_10.2.0-15ubuntu1 libattr1_1:2.4.48-5 libaudit-common_1:2.8.5-3ubuntu2 libaudit1_1:2.8.5-3ubuntu2 libbinutils_2.35.1-2ubuntu1 libblkid1_2.36-3ubuntu1 libbz2-1.0_1.0.8-4ubuntu2 libc-bin_2.32-0ubuntu3 libc-dev-bin_2.32-0ubuntu3 libc6_2.32-0ubuntu3 libc6-dev_2.32-0ubuntu3 libcap-ng0_0.7.9-2.2 libcap2_1:2.44-1 libcc1-0_10.2.0-15ubuntu1 libclone-perl_0.45-1 libcom-err2_1.45.6-1ubuntu1 libconfig-general-perl_2.63-1 libcroco3_0.6.13-1 libcrypt-dev_1:4.4.17-1ubuntu1 libcrypt1_1:4.4.17-1ubuntu1 libcryptsetup12_2:2.3.3-1ubuntu6 libctf-nobfd0_2.35.1-2ubuntu1 libctf0_2.35.1-2ubuntu1 libdb5.3_5.3.28+dfsg1-0.6ubuntu3 libdebconfclient0_0.254ubuntu1 libdebhelper-perl_13.2.1ubuntu1 libdevmapper1.02.1_2:1.02.167-1ubuntu3 libdpkg-perl_1.20.5ubuntu2 libelf1_0.181-1 libexpat1_2.2.10-1 libext2fs2_1.45.6-1ubuntu1 libfakeroot_1.25.2-1 libffi8ubuntu1_3.4~20200819gead65ca871-0ubuntu3 libfile-stripnondeterminism-perl_1.9.0-1 libgcc-10-dev_10.2.0-15ubuntu1 libgcc-s1_10.2.0-15ubuntu1 libgcrypt20_1.8.5-5ubuntu2 libgdbm-compat4_1.18.1-5.1 libgdbm6_1.18.1-5.1 libglib2.0-0_2.66.1-2 libgmp10_2:6.2.0+dfsg-6ubuntu1 libgnutls30_3.6.15-4ubuntu2 libgomp1_10.2.0-15ubuntu1 libgpg-error0_1.38-2 libgssapi-krb5-2_1.17-10 libhogweed6_3.6-2 libicu67_67.1-4 libidn2-0_2.3.0-1 libip4tc2_1.8.5-3ubuntu1 libisl22_0.22.1-1 libitm1_10.2.0-15ubuntu1 libjson-c5_0.15-1 libk5crypto3_1.17-10 libkeyutils1_1.6.1-2ubuntu1 libkmod2_27+20200310-2ubuntu1 libkrb5-3_1.17-10 libkrb5support0_1.17-10 liblocale-gettext-perl_1.07-4 liblockfile-bin_1.16-1.1 liblockfile1_1.16-1.1 liblsan0_10.2.0-15ubuntu1 liblz4-1_1.9.2-2 liblzma5_5.2.4-1ubuntu1 libmagic-mgc_1:5.38-5 libmagic1_1:5.38-5 libmount1_2.36-3ubuntu1 libmpc3_1.2.0-1 libmpfr6_4.1.0-3 libncurses6_6.2+20200918-1 libncursesw6_6.2+20200918-1 libnettle8_3.6-2 libnpth0_1.6-3 libnsl-dev_1.3.0-0ubuntu3 libnsl2_1.3.0-0ubuntu3 libnss-nis_3.1-0ubuntu4 libnss-nisplus_1.3-0ubuntu4 libp11-kit0_0.23.21-2build1 libpam-modules_1.3.1-5ubuntu6 libpam-modules-bin_1.3.1-5ubuntu6 libpam-runtime_1.3.1-5ubuntu6 libpam0g_1.3.1-5ubuntu6 libpcre2-8-0_10.34-7 libpcre3_2:8.39-13 libperl5.30_5.30.3-4 libpipeline1_1.5.3-1 libpng16-16_1.6.37-3 libprocps8_2:3.3.16-5ubuntu2 libpython3-stdlib_3.8.6-1 libpython3.8-minimal_3.8.6-1 libpython3.8-stdlib_3.8.6-1 libreadline8_8.0-4 libseccomp2_2.4.3-1ubuntu5 libselinux1_3.1-2build1 libsemanage-common_3.1-1build1 libsemanage1_3.1-1build1 libsepol1_3.1-1 libsigsegv2_2.12-2build1 libsmartcols1_2.36-3ubuntu1 libsqlite3-0_3.33.0-1 libss2_1.45.6-1ubuntu1 libssl1.1_1.1.1f-1ubuntu4 libstdc++-10-dev_10.2.0-15ubuntu1 libstdc++6_10.2.0-15ubuntu1 libsub-override-perl_0.09-2 libsys-info-base-perl_0.7807-3 libsys-info-driver-linux-perl_0.7905-2 libsys-info-perl_0.7811-2 libsystemd0_246.6-1ubuntu1 libtasn1-6_4.16.0-2 libtbb-dev_2020.3-1 libtbb2_2020.3-1 libtest-deep-perl_1.130-1 libtinfo6_6.2+20200918-1 libtirpc-common_1.2.6-3 libtirpc-dev_1.2.6-3 libtirpc3_1.2.6-3 libtool_2.4.6-14 libtsan0_10.2.0-15ubuntu1 libubsan1_10.2.0-15ubuntu1 libuchardet0_0.0.7-1 libudev1_246.6-1ubuntu1 libunistring2_0.9.10-4 libunix-processors-perl_2.046-2 libuuid1_2.36-3ubuntu1 libxml2_2.9.10+dfsg-6.1 libzstd1_1.4.5+dfsg-4 linux-libc-dev_5.8.0-25.26 lockfile-progs_0.1.18 login_1:4.8.1-1ubuntu6 logsave_1.45.6-1ubuntu1 lsb-base_11.1.0ubuntu2 m4_1.4.18-4 make_4.3-4ubuntu1 man-db_2.9.3-2 mawk_1.3.4.20200120-2 mime-support_3.64ubuntu1 mount_2.36-3ubuntu1 ncurses-base_6.2+20200918-1 ncurses-bin_6.2+20200918-1 openssl_1.1.1f-1ubuntu4 optipng_0.7.7-1 passwd_1:4.8.1-1ubuntu6 patch_2.7.6-6 perl_5.30.3-4 perl-base_5.30.3-4 perl-modules-5.30_5.30.3-4 pinentry-curses_1.1.0-4build1 pkgbinarymangler_146 po-debconf_1.0.21 policyrcd-script-zg2_0.1-3 procps_2:3.3.16-5ubuntu2 python3_3.8.6-1 python3-minimal_3.8.6-1 python3.8_3.8.6-1 python3.8-minimal_3.8.6-1 readline-common_8.0-4 rpcsvc-proto_1.4.2-0ubuntu4 sbuild-build-depends-bowtie-dummy_0.invalid.0 sbuild-build-depends-core-dummy_0.invalid.0 sed_4.7-1ubuntu1 sensible-utils_0.0.13 systemd_246.6-1ubuntu1 systemd-sysv_246.6-1ubuntu1 systemd-timesyncd_246.6-1ubuntu1 sysvinit-utils_2.96-5ubuntu1 tar_1.30+dfsg-7 tzdata_2020d-1ubuntu1 ubuntu-keyring_2020.06.17.1 util-linux_2.36-3ubuntu1 xz-utils_5.2.4-1ubuntu1 zlib1g_1:1.2.11.dfsg-2ubuntu4 zlib1g-dev_1:1.2.11.dfsg-2ubuntu4 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- gpgv: Signature made Tue Oct 13 12:02:00 2020 UTC gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./bowtie_1.3.0+dfsg1-1.dsc dpkg-source: info: extracting bowtie in /<>/bowtie-1.3.0+dfsg1 dpkg-source: info: unpacking bowtie_1.3.0+dfsg1.orig.tar.xz dpkg-source: info: unpacking bowtie_1.3.0+dfsg1-1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying strip_html5shiv.patch dpkg-source: info: applying spelling.patch dpkg-source: info: applying no_hash_style_both_for_mips.patch dpkg-source: info: applying use-dpkg-buildflags.patch dpkg-source: info: applying reproducible.patch dpkg-source: info: applying build-as-Cpp03.patch dpkg-source: info: applying simple-test dpkg-source: info: applying popcnt_capability.patch Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-20202088 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-20202088 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-20202088 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.0+dfsg1-1 dpkg-buildpackage: info: source distribution unstable dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 debian/rules clean dh clean debian/rules override_dh_auto_clean make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' rm -f .bowtie* dh_auto_clean make -j4 clean make[2]: Entering directory '/<>/bowtie-1.3.0+dfsg1' rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \ bowtie_prof \ bowtie-build-s.exe bowtie-build-l.exe bowtie-align-s.exe bowtie-align-l.exe bowtie-inspect-s.exe bowtie-inspect-l.exe bowtie-build-s-debug.exe bowtie-build-l-debug.exe bowtie-align-s-debug.exe bowtie-align-l-debug.exe bowtie-inspect-s-debug.exe bowtie-inspect-l-debug.exe bowtie_prof.exe \ bowtie-src.zip bowtie-bin.zip rm -f *.core rm -f bowtie-align-s-master* bowtie-align-s-no-io* rm -rf .lib .include make[2]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' dh_clean debian/rules binary-arch dh binary-arch dh_update_autotools_config -a dh_autoreconf -a dh_auto_configure -a debian/rules override_dh_auto_build make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' /usr/bin/make allall make[2]: Entering directory '/<>/bowtie-1.3.0+dfsg1' g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function ‘void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]’: ds.h:497:3: warning: ‘tmp2’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp3’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: ‘tmp4’ may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/<>/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-Bsymbolic-functions -Wl,-z,relro -Wl,-z,now -lz -lpthread make[2]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' debian/rules override_dh_auto_test make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' unset LD_PRELOAD && make simple-test make[2]: Entering directory '/<>/bowtie-1.3.0+dfsg1' ./scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:19 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:12 %) Reported 3 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2@HD VN:1.0 SO:unsorted (100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1@HD VN:1.0 SO:unsorted (100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:19 0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%)@SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:19 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 @HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:19 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0@SQ SN:0 LN:19 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0@HD VN:1.0 SO:unsorted (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:16 %) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1@HD VN:1.0 SO:unsorted (@SQ SN:0 LN:16 100.00%) # reads that failed to align: 0 (0.00%) Reported 2@PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:16 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@SQ SN:0 LN:24 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:24 %) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments@PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:8 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:8 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:8 0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:8 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments@SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 @HD VN:1.0 SO:unsorted # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) @SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1@HD VN:1.0 SO:unsorted (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0@HD VN:1.0 SO:unsorted (0.00%) # reads that failed to align: 1 (100.00@SQ SN:0 LN:25 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1@HD VN:1.0 SO:unsorted (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: @HD VN:1.0 SO:unsorted 1 (100.00%) # reads that failed to align: 0@SQ SN:0 LN:16 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2@SQ SN:0 LN:16 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00@SQ SN:0 LN:24 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:8 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1@HD VN:1.0 SO:unsorted (100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:8 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:8 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:8 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:8 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:8 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:8 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/<>/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 PASSED make[2]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' ln -s debian/tests unset LD_PRELOAD && sh debian/tests/run-unit-test test_at_build_time Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example1 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments example2 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example3 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments example4 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example5 OK example7 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example8 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments rm -f tests examples[0-9].out make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' create-stamp debian/debhelper-build-stamp dh_testroot -a dh_prep -a dh_installdirs -a debian/rules override_dh_auto_install-arch make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' # remove strange byte-compyled Python code bowtie-buildc (no idea how and why it was created) find . -name bowtie-buildc -delete find . -name .cvsignore -delete make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' debian/rules override_dh_install make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' dh_install if [ -d debian/tmp/usr/local/bin ] ; then \ dh_install -a usr/local/bin usr ; \ fi make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' dh_installdocs -a dh_installchangelogs -a debian/rules override_dh_installman-arch make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' help2man --name="ultrafast memory-efficient short read aligner" --no-info \ /<>/bowtie-1.3.0+dfsg1/bowtie > /<>/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie.1 help2man --name="building a colorspace index for bowtie" --no-info \ /<>/bowtie-1.3.0+dfsg1/bowtie-build > /<>/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-build.1 help2man --name="extracts information from a bowtie index" --no-info \ /<>/bowtie-1.3.0+dfsg1/bowtie-inspect > /<>/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-inspect.1 make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' dh_lintian -a dh_perl -a dh_link -a dh_strip_nondeterminism -a debian/rules override_dh_compress make[1]: Entering directory '/<>/bowtie-1.3.0+dfsg1' dh_compress -X.ebwt make[1]: Leaving directory '/<>/bowtie-1.3.0+dfsg1' dh_fixperms -a dh_missing -a dh_dwz -a -a dh_strip -a -a dh_makeshlibs -a -a dh_shlibdeps -a -a dh_installdeb -a dh_gencontrol -a dh_md5sums -a dh_builddeb -a INFO: pkgstriptranslations version 146 INFO: pkgstriptranslations version 146 pkgstriptranslations: processing bowtie (in debian/bowtie); do_strip: , oemstrip: pkgstriptranslations: processing bowtie-dbgsym (in debian/.debhelper/bowtie/dbgsym-root); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/bowtie/DEBIAN/control, package bowtie, directory debian/bowtie pkgstripfiles: processing control file: debian/.debhelper/bowtie/dbgsym-root/DEBIAN/control, package bowtie-dbgsym, directory debian/.debhelper/bowtie/dbgsym-root dpkg-deb: building package 'bowtie-dbgsym' in 'debian/.debhelper/scratch-space/build-bowtie/bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb'. pkgstripfiles: Truncating usr/share/doc/bowtie/changelog.Debian.gz to topmost ten records pkgstripfiles: Running PNG optimization (using 4 cpus) for package bowtie ... pkgstripfiles: No PNG files. dpkg-deb: building package 'bowtie' in '../bowtie_1.3.0+dfsg1-1_arm64.deb'. Renaming bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb to bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb dpkg-genbuildinfo --build=any dpkg-genchanges --build=any -mLaunchpad Build Daemon >../bowtie_1.3.0+dfsg1-1_arm64.changes dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) -------------------------------------------------------------------------------- Build finished at 2020-10-28T22:00:32Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Post Build Chroot | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ bowtie_1.3.0+dfsg1-1_arm64.changes: ----------------------------------- Format: 1.8 Date: Tue, 13 Oct 2020 13:16:39 +0200 Source: bowtie Binary: bowtie Architecture: arm64 Version: 1.3.0+dfsg1-1 Distribution: hirsute-proposed Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Andreas Tille Description: bowtie - Ultrafast memory-efficient short read aligner Closes: 972004 Changes: bowtie (1.3.0+dfsg1-1) unstable; urgency=medium . [ Andreas Tille ] * Really fix arch all build . [ Étienne Mollier ] * Excluded third_party/ Closes: #972004 * Reviewed debian/patches/popcnt_capability.patch Checksums-Sha1: c748e23c7d250698ee48c6eefd2a145162d54b82 13399544 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb 8c3552b4cc977419e28369ed64e7d866c633f00a 6349 bowtie_1.3.0+dfsg1-1_arm64.buildinfo 485352460e29da16bf565c4e6b87c0a518eb566b 1256988 bowtie_1.3.0+dfsg1-1_arm64.deb Checksums-Sha256: d1ba2abea081ff60697259b960ad230dbc900400c80be1c09c3ee77d759d6ee3 13399544 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb 907d6c950cdaf298aacc3c8ab061349c83172bde060dd955e1a090211a45638c 6349 bowtie_1.3.0+dfsg1-1_arm64.buildinfo b975f5bbebccb3eaaa72dc0b63fcea78d80b242fac6736866fa9af084faad5fc 1256988 bowtie_1.3.0+dfsg1-1_arm64.deb Files: 546e965fc1ba2cf14616d6808f5a191b 13399544 debug optional bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb b3b21c2bc242c7ddfd9678e879fac69e 6349 science optional bowtie_1.3.0+dfsg1-1_arm64.buildinfo 714122701dcb1cab6e957a0a7da5e55c 1256988 science optional bowtie_1.3.0+dfsg1-1_arm64.deb +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: bowtie Binary: bowtie bowtie-dbgsym Architecture: arm64 Version: 1.3.0+dfsg1-1 Checksums-Md5: 546e965fc1ba2cf14616d6808f5a191b 13399544 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb 714122701dcb1cab6e957a0a7da5e55c 1256988 bowtie_1.3.0+dfsg1-1_arm64.deb Checksums-Sha1: c748e23c7d250698ee48c6eefd2a145162d54b82 13399544 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb 485352460e29da16bf565c4e6b87c0a518eb566b 1256988 bowtie_1.3.0+dfsg1-1_arm64.deb Checksums-Sha256: d1ba2abea081ff60697259b960ad230dbc900400c80be1c09c3ee77d759d6ee3 13399544 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.ddeb b975f5bbebccb3eaaa72dc0b63fcea78d80b242fac6736866fa9af084faad5fc 1256988 bowtie_1.3.0+dfsg1-1_arm64.deb Build-Origin: Ubuntu Build-Architecture: arm64 Build-Date: Wed, 28 Oct 2020 22:00:31 +0000 Build-Path: /<>/bowtie-1.3.0+dfsg1 Build-Tainted-By: usr-local-has-programs Installed-Build-Depends: autoconf (= 2.69-11.1), automake (= 1:1.16.2-4ubuntu1), autopoint (= 0.19.8.1-10build1), autotools-dev (= 20180224.1), base-files (= 11ubuntu16), base-passwd (= 3.5.48), bash (= 5.0-6ubuntu2), binutils (= 2.35.1-2ubuntu1), binutils-aarch64-linux-gnu (= 2.35.1-2ubuntu1), binutils-common (= 2.35.1-2ubuntu1), bsdextrautils (= 2.36-3ubuntu1), bsdutils (= 1:2.36-3ubuntu1), build-essential (= 12.8ubuntu3), bzip2 (= 1.0.8-4ubuntu2), coreutils (= 8.32-3ubuntu1), cpp (= 4:10.2.0-1ubuntu1), cpp-10 (= 10.2.0-15ubuntu1), dash (= 0.5.10.2-7), debconf (= 1.5.74), debhelper (= 13.2.1ubuntu1), debianutils (= 4.11.2), dh-autoreconf (= 19), dh-strip-nondeterminism (= 1.9.0-1), diffutils (= 1:3.7-3ubuntu1), dpkg (= 1.20.5ubuntu2), dpkg-dev (= 1.20.5ubuntu2), dwz (= 0.13-5), file (= 1:5.38-5), findutils (= 4.7.0-1ubuntu2), g++ (= 4:10.2.0-1ubuntu1), g++-10 (= 10.2.0-15ubuntu1), gcc (= 4:10.2.0-1ubuntu1), gcc-10 (= 10.2.0-15ubuntu1), gcc-10-base (= 10.2.0-15ubuntu1), gettext (= 0.19.8.1-10build1), gettext-base (= 0.19.8.1-10build1), grep (= 3.4-1), groff-base (= 1.22.4-5), gzip (= 1.10-2ubuntu1), help2man (= 1.47.16), hostname (= 3.23), init-system-helpers (= 1.58), intltool-debian (= 0.35.0+20060710.5), libacl1 (= 2.2.53-8), libarchive-zip-perl (= 1.68-1), libasan6 (= 10.2.0-15ubuntu1), libatomic1 (= 10.2.0-15ubuntu1), libattr1 (= 1:2.4.48-5), libaudit-common (= 1:2.8.5-3ubuntu2), libaudit1 (= 1:2.8.5-3ubuntu2), libbinutils (= 2.35.1-2ubuntu1), libblkid1 (= 2.36-3ubuntu1), libbz2-1.0 (= 1.0.8-4ubuntu2), libc-bin (= 2.32-0ubuntu3), libc-dev-bin (= 2.32-0ubuntu3), libc6 (= 2.32-0ubuntu3), libc6-dev (= 2.32-0ubuntu3), libcap-ng0 (= 0.7.9-2.2), libcc1-0 (= 10.2.0-15ubuntu1), libclone-perl (= 0.45-1), libcom-err2 (= 1.45.6-1ubuntu1), libconfig-general-perl (= 2.63-1), libcroco3 (= 0.6.13-1), libcrypt-dev (= 1:4.4.17-1ubuntu1), libcrypt1 (= 1:4.4.17-1ubuntu1), libctf-nobfd0 (= 2.35.1-2ubuntu1), libctf0 (= 2.35.1-2ubuntu1), libdb5.3 (= 5.3.28+dfsg1-0.6ubuntu3), libdebconfclient0 (= 0.254ubuntu1), libdebhelper-perl (= 13.2.1ubuntu1), libdpkg-perl (= 1.20.5ubuntu2), libelf1 (= 0.181-1), libexpat1 (= 2.2.10-1), libffi8ubuntu1 (= 3.4~20200819gead65ca871-0ubuntu3), libfile-stripnondeterminism-perl (= 1.9.0-1), libgcc-10-dev (= 10.2.0-15ubuntu1), libgcc-s1 (= 10.2.0-15ubuntu1), libgcrypt20 (= 1.8.5-5ubuntu2), libgdbm-compat4 (= 1.18.1-5.1), libgdbm6 (= 1.18.1-5.1), libglib2.0-0 (= 2.66.1-2), libgmp10 (= 2:6.2.0+dfsg-6ubuntu1), libgomp1 (= 10.2.0-15ubuntu1), libgpg-error0 (= 1.38-2), libgssapi-krb5-2 (= 1.17-10), libicu67 (= 67.1-4), libisl22 (= 0.22.1-1), libitm1 (= 10.2.0-15ubuntu1), libk5crypto3 (= 1.17-10), libkeyutils1 (= 1.6.1-2ubuntu1), libkrb5-3 (= 1.17-10), libkrb5support0 (= 1.17-10), liblocale-gettext-perl (= 1.07-4), liblsan0 (= 10.2.0-15ubuntu1), liblz4-1 (= 1.9.2-2), liblzma5 (= 5.2.4-1ubuntu1), libmagic-mgc (= 1:5.38-5), libmagic1 (= 1:5.38-5), libmount1 (= 2.36-3ubuntu1), libmpc3 (= 1.2.0-1), libmpfr6 (= 4.1.0-3), libncursesw6 (= 6.2+20200918-1), libnsl-dev (= 1.3.0-0ubuntu3), libnsl2 (= 1.3.0-0ubuntu3), libnss-nis (= 3.1-0ubuntu4), libnss-nisplus (= 1.3-0ubuntu4), libpam-modules (= 1.3.1-5ubuntu6), libpam-modules-bin (= 1.3.1-5ubuntu6), libpam-runtime (= 1.3.1-5ubuntu6), libpam0g (= 1.3.1-5ubuntu6), libpcre2-8-0 (= 10.34-7), libpcre3 (= 2:8.39-13), libperl5.30 (= 5.30.3-4), libpipeline1 (= 1.5.3-1), libpython3-stdlib (= 3.8.6-1), libpython3.8-minimal (= 3.8.6-1), libpython3.8-stdlib (= 3.8.6-1), libreadline8 (= 8.0-4), libseccomp2 (= 2.4.3-1ubuntu5), libselinux1 (= 3.1-2build1), libsigsegv2 (= 2.12-2build1), libsmartcols1 (= 2.36-3ubuntu1), libsqlite3-0 (= 3.33.0-1), libssl1.1 (= 1.1.1f-1ubuntu4), libstdc++-10-dev (= 10.2.0-15ubuntu1), libstdc++6 (= 10.2.0-15ubuntu1), libsub-override-perl (= 0.09-2), libsys-info-base-perl (= 0.7807-3), libsys-info-driver-linux-perl (= 0.7905-2), libsys-info-perl (= 0.7811-2), libsystemd0 (= 246.6-1ubuntu1), libtbb-dev (= 2020.3-1), libtbb2 (= 2020.3-1), libtest-deep-perl (= 1.130-1), libtinfo6 (= 6.2+20200918-1), libtirpc-common (= 1.2.6-3), libtirpc-dev (= 1.2.6-3), libtirpc3 (= 1.2.6-3), libtool (= 2.4.6-14), libtsan0 (= 10.2.0-15ubuntu1), libubsan1 (= 10.2.0-15ubuntu1), libuchardet0 (= 0.0.7-1), libudev1 (= 246.6-1ubuntu1), libunistring2 (= 0.9.10-4), libunix-processors-perl (= 2.046-2), libuuid1 (= 2.36-3ubuntu1), libxml2 (= 2.9.10+dfsg-6.1), libzstd1 (= 1.4.5+dfsg-4), linux-libc-dev (= 5.8.0-25.26), login (= 1:4.8.1-1ubuntu6), lsb-base (= 11.1.0ubuntu2), m4 (= 1.4.18-4), make (= 4.3-4ubuntu1), man-db (= 2.9.3-2), mawk (= 1.3.4.20200120-2), mime-support (= 3.64ubuntu1), ncurses-base (= 6.2+20200918-1), ncurses-bin (= 6.2+20200918-1), patch (= 2.7.6-6), perl (= 5.30.3-4), perl-base (= 5.30.3-4), perl-modules-5.30 (= 5.30.3-4), po-debconf (= 1.0.21), python3 (= 3.8.6-1), python3-minimal (= 3.8.6-1), python3.8 (= 3.8.6-1), python3.8-minimal (= 3.8.6-1), readline-common (= 8.0-4), rpcsvc-proto (= 1.4.2-0ubuntu4), sed (= 4.7-1ubuntu1), sensible-utils (= 0.0.13), sysvinit-utils (= 2.96-5ubuntu1), tar (= 1.30+dfsg-7), util-linux (= 2.36-3ubuntu1), xz-utils (= 5.2.4-1ubuntu1), zlib1g (= 1:1.2.11.dfsg-2ubuntu4), zlib1g-dev (= 1:1.2.11.dfsg-2ubuntu4) Environment: DEB_BUILD_OPTIONS="parallel=4" LANG="C.UTF-8" LC_ALL="C.UTF-8" SOURCE_DATE_EPOCH="1602587799" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ bowtie_1.3.0+dfsg1-1_arm64.deb ------------------------------ new Debian package, version 2.0. size 1256988 bytes: control archive=1928 bytes. 1125 bytes, 23 lines control 2653 bytes, 40 lines md5sums Package: bowtie Version: 1.3.0+dfsg1-1 Architecture: arm64 Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 6052 Depends: libc6 (>= 2.27), libgcc-s1 (>= 3.0), libstdc++6 (>= 9), zlib1g (>= 1:1.2.6), python3 Suggests: bowtie-examples Section: science Priority: optional Multi-Arch: foreign Homepage: http://bowtie-bio.sourceforge.net/ Description: Ultrafast memory-efficient short read aligner This package addresses the problem to interpret the results from the latest (2010) DNA sequencing technologies. Those will yield fairly short stretches and those cannot be interpreted directly. It is the challenge for tools like Bowtie to give a chromosomal location to the short stretches of DNA sequenced per run. . Bowtie aligns short DNA sequences (reads) to the human genome at a rate of over 25 million 35-bp reads per hour. Bowtie indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end). drwxr-xr-x root/root 0 2020-10-13 11:16 ./ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/bin/ -rwxr-xr-x root/root 2689 2020-07-23 02:52 ./usr/bin/bowtie -rwxr-xr-x root/root 528896 2020-10-13 11:16 ./usr/bin/bowtie-align-l -rwxr-xr-x root/root 1139200 2020-10-13 11:16 ./usr/bin/bowtie-align-l-debug -rwxr-xr-x root/root 532992 2020-10-13 11:16 ./usr/bin/bowtie-align-s -rwxr-xr-x root/root 1139200 2020-10-13 11:16 ./usr/bin/bowtie-align-s-debug -rwxr-xr-x root/root 2808 2020-07-23 02:52 ./usr/bin/bowtie-build -rwxr-xr-x root/root 258240 2020-10-13 11:16 ./usr/bin/bowtie-build-l -rwxr-xr-x root/root 565440 2020-10-13 11:16 ./usr/bin/bowtie-build-l-debug -rwxr-xr-x root/root 262336 2020-10-13 11:16 ./usr/bin/bowtie-build-s -rwxr-xr-x root/root 565440 2020-10-13 11:16 ./usr/bin/bowtie-build-s-debug -rwxr-xr-x root/root 2549 2020-07-23 02:52 ./usr/bin/bowtie-inspect -rwxr-xr-x root/root 251032 2020-10-13 11:16 ./usr/bin/bowtie-inspect-l -rwxr-xr-x root/root 251032 2020-10-13 11:16 ./usr/bin/bowtie-inspect-l-debug -rwxr-xr-x root/root 246936 2020-10-13 11:16 ./usr/bin/bowtie-inspect-s -rwxr-xr-x root/root 246936 2020-10-13 11:16 ./usr/bin/bowtie-inspect-s-debug drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/doc-base/ -rw-r--r-- root/root 1010 2020-10-13 11:16 ./usr/share/doc-base/bowtie drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/doc/ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/doc/bowtie/ -rw-r--r-- root/root 18882 2020-07-23 02:52 ./usr/share/doc/bowtie/MANUAL.gz -rw-r--r-- root/root 13694 2020-07-23 02:52 ./usr/share/doc/bowtie/NEWS.gz -rw-r--r-- root/root 1875 2020-10-13 11:16 ./usr/share/doc/bowtie/README.Debian.gz -rw-r--r-- root/root 344 2020-10-13 11:16 ./usr/share/doc/bowtie/README.test -rw-r--r-- root/root 2614 2020-07-23 02:52 ./usr/share/doc/bowtie/TUTORIAL.gz -rw-r--r-- root/root 1307 2020-10-13 11:16 ./usr/share/doc/bowtie/changelog.Debian.gz -rw-r--r-- root/root 10042 2020-10-13 11:16 ./usr/share/doc/bowtie/copyright -rw-r--r-- root/root 95154 2020-10-13 11:16 ./usr/share/doc/bowtie/manual.html -rw-r--r-- root/root 4182 2020-07-23 02:52 ./usr/share/doc/bowtie/style.css drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/ -rw-r--r-- root/root 255 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example1.out -rw-r--r-- root/root 151 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example2.out -rw-r--r-- root/root 255 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example3.out -rw-r--r-- root/root 53 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example4.out -rw-r--r-- root/root 255 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example5.out -rw-r--r-- root/root 572 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example5.out.diff -rw-r--r-- root/root 46 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example6.out -rw-r--r-- root/root 14 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example7.out -rw-r--r-- root/root 255 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example8.out -rw-r--r-- root/root 46 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/example9.out -rw-r--r-- root/root 2159 2020-10-13 11:16 ./usr/share/doc/bowtie/tests/run-unit-test drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/lintian/ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/lintian/overrides/ -rw-r--r-- root/root 692 2020-10-13 11:16 ./usr/share/lintian/overrides/bowtie drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/man/ drwxr-xr-x root/root 0 2020-10-13 11:16 ./usr/share/man/man1/ lrwxrwxrwx root/root 0 2020-10-13 11:16 ./usr/share/man/man1/bowtie-build-debug.1.gz -> bowtie-build.1.gz -rw-r--r-- root/root 1214 2020-10-13 11:16 ./usr/share/man/man1/bowtie-build.1.gz lrwxrwxrwx root/root 0 2020-10-13 11:16 ./usr/share/man/man1/bowtie-debug.1.gz -> bowtie.1.gz lrwxrwxrwx root/root 0 2020-10-13 11:16 ./usr/share/man/man1/bowtie-inspect-debug.1.gz -> bowtie-inspect.1.gz -rw-r--r-- root/root 972 2020-10-13 11:16 ./usr/share/man/man1/bowtie-inspect.1.gz -rw-r--r-- root/root 605 2020-10-13 11:16 ./usr/share/man/man1/bowtie.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: arm64 Build Type: any Build-Space: n/a Build-Time: 1381 Distribution: hirsute-proposed Host Architecture: arm64 Install-Time: 58 Job: bowtie_1.3.0+dfsg1-1.dsc Machine Architecture: arm64 Package: bowtie Package-Time: 1444 Source-Version: 1.3.0+dfsg1-1 Space: n/a Status: successful Version: 1.3.0+dfsg1-1 -------------------------------------------------------------------------------- Finished at 2020-10-28T22:00:32Z Build needed 00:24:04, no disk space RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=hirsute --arch=arm64 PACKAGEBUILD-20202088 Scanning for processes to kill in build PACKAGEBUILD-20202088