RUN: /usr/share/launchpad-buildd/slavebin/slave-prep ['slave-prep'] Forking launchpad-buildd slave process... Kernel version: Linux fisher03 3.19.0-31-powerpc64-smp #36~14.04.1-Ubuntu SMP Thu Oct 8 10:49:59 UTC 2015 ppc64 Buildd toolchain package versions: launchpad-buildd_134 python-lpbuildd_134 sbuild_0.65.2-1ubuntu2~ubuntu14.04.1~ppa6 dpkg-dev_1.17.5ubuntu5.4 python-debian_0.1.27ubuntu1~ubuntu14.04.1~ppa1. Syncing the system clock with the buildd NTP service... 23 Oct 18:55:06 ntpdate[11883]: adjust time server 10.211.37.1 offset -0.000073 sec RUN: /usr/share/launchpad-buildd/slavebin/unpack-chroot ['unpack-chroot', 'PACKAGEBUILD-8175951', '/home/buildd/filecache-default/59b2027bd898a08257bdf6a14dda09a63b60b4fb'] Unpacking chroot for build PACKAGEBUILD-8175951 RUN: /usr/share/launchpad-buildd/slavebin/mount-chroot ['mount-chroot', 'PACKAGEBUILD-8175951'] Mounting chroot for build PACKAGEBUILD-8175951 RUN: /usr/share/launchpad-buildd/slavebin/override-sources-list ['override-sources-list', 'PACKAGEBUILD-8175951', 'deb http://ftpmaster.internal/ubuntu xenial main universe', 'deb http://ftpmaster.internal/ubuntu xenial-security main universe', 'deb http://ftpmaster.internal/ubuntu xenial-updates main universe', 'deb http://ftpmaster.internal/ubuntu xenial-proposed main universe'] Overriding sources.list in build-PACKAGEBUILD-8175951 RUN: /usr/share/launchpad-buildd/slavebin/update-debian-chroot ['update-debian-chroot', 'PACKAGEBUILD-8175951', 'powerpc'] Updating debian chroot for build PACKAGEBUILD-8175951 Get:1 http://ftpmaster.internal xenial InRelease [218 kB] Get:2 http://ftpmaster.internal xenial-security InRelease [64.4 kB] Get:3 http://ftpmaster.internal xenial-updates InRelease [64.4 kB] Get:4 http://ftpmaster.internal xenial-proposed InRelease [64.4 kB] Get:5 http://ftpmaster.internal xenial/main powerpc Packages [1376 kB] Get:6 http://ftpmaster.internal xenial/universe powerpc Packages [6575 kB] Get:7 http://ftpmaster.internal xenial/main Translation-en [839 kB] Get:8 http://ftpmaster.internal xenial/universe Translation-en [4583 kB] Get:9 http://ftpmaster.internal xenial-security/main powerpc Packages [28 B] Get:10 http://ftpmaster.internal xenial-security/universe powerpc Packages [28 B] Get:11 http://ftpmaster.internal xenial-security/main Translation-en [28 B] Get:12 http://ftpmaster.internal xenial-security/universe Translation-en [28 B] Get:13 http://ftpmaster.internal xenial-updates/main powerpc Packages [28 B] Get:14 http://ftpmaster.internal xenial-updates/universe powerpc Packages [28 B] Get:15 http://ftpmaster.internal xenial-updates/main Translation-en [28 B] Get:16 http://ftpmaster.internal xenial-updates/universe Translation-en [28 B] Get:17 http://ftpmaster.internal xenial-proposed/main powerpc Packages [76.3 kB] Get:18 http://ftpmaster.internal xenial-proposed/universe powerpc Packages [102 kB] Get:19 http://ftpmaster.internal xenial-proposed/main Translation-en [51.3 kB] Get:20 http://ftpmaster.internal xenial-proposed/universe Translation-en [72.1 kB] Fetched 14.1 MB in 7s (1846 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... The following packages will be upgraded: advancecomp base-files binutils cpp-5 dpkg dpkg-dev g++-5 gcc-5 gcc-5-base libasan2 libatomic1 libcc1-0 libdpkg-perl libgcc-5-dev libgcc1 libgomp1 libstdc++-5-dev libstdc++6 libubsan0 pkg-create-dbgsym 20 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 86.6 MB of archives. After this operation, 245 MB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu/ xenial/main base-files powerpc 9.4ubuntu2 [62.3 kB] Get:2 http://ftpmaster.internal/ubuntu/ xenial-proposed/main dpkg powerpc 1.18.3ubuntu1 [2049 kB] Get:3 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libubsan0 powerpc 5.2.1-22ubuntu5 [95.8 kB] Get:4 http://ftpmaster.internal/ubuntu/ xenial-proposed/main gcc-5-base powerpc 5.2.1-22ubuntu5 [16.6 kB] Get:5 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libstdc++6 powerpc 5.2.1-22ubuntu5 [401 kB] Get:6 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libgomp1 powerpc 5.2.1-22ubuntu5 [51.5 kB] Get:7 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libatomic1 powerpc 5.2.1-22ubuntu5 [7202 B] Get:8 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libasan2 powerpc 5.2.1-22ubuntu5 [232 kB] Get:9 http://ftpmaster.internal/ubuntu/ xenial-proposed/main cpp-5 powerpc 5.2.1-22ubuntu5 [23.0 MB] Get:10 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libcc1-0 powerpc 5.2.1-22ubuntu5 [30.2 kB] Get:11 http://ftpmaster.internal/ubuntu/ xenial-proposed/main binutils powerpc 2.25.51.20151022-0ubuntu1 [2286 kB] Get:12 http://ftpmaster.internal/ubuntu/ xenial-proposed/main g++-5 powerpc 5.2.1-22ubuntu5 [32.5 MB] Get:13 http://ftpmaster.internal/ubuntu/ xenial-proposed/main gcc-5 powerpc 5.2.1-22ubuntu5 [23.1 MB] Get:14 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libgcc-5-dev powerpc 5.2.1-22ubuntu5 [499 kB] Get:15 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libstdc++-5-dev powerpc 5.2.1-22ubuntu5 [1378 kB] Get:16 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libgcc1 powerpc 1:5.2.1-22ubuntu5 [27.0 kB] Get:17 http://ftpmaster.internal/ubuntu/ xenial-proposed/main libdpkg-perl all 1.18.3ubuntu1 [195 kB] Get:18 http://ftpmaster.internal/ubuntu/ xenial-proposed/main dpkg-dev all 1.18.3ubuntu1 [583 kB] Get:19 http://ftpmaster.internal/ubuntu/ xenial-proposed/main advancecomp powerpc 1.20-1 [143 kB] Get:20 http://ftpmaster.internal/ubuntu/ xenial/main pkg-create-dbgsym all 0.70 [9046 B] debconf: delaying package configuration, since apt-utils is not installed Fetched 86.6 MB in 22s (3796 kB/s) (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11511 files and directories currently installed.) Preparing to unpack .../base-files_9.4ubuntu2_powerpc.deb ... Unpacking base-files (9.4ubuntu2) over (7.2ubuntu11) ... Setting up base-files (9.4ubuntu2) ... Installing new version of config file /etc/debian_version ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... Updating /etc/profile to current default. Updating /etc/nsswitch.conf to current default. Updating /root/.profile to current default. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11513 files and directories currently installed.) Preparing to unpack .../dpkg_1.18.3ubuntu1_powerpc.deb ... Unpacking dpkg (1.18.3ubuntu1) over (1.18.2ubuntu5) ... Setting up dpkg (1.18.3ubuntu1) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11513 files and directories currently installed.) Preparing to unpack .../libubsan0_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libubsan0:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../gcc-5-base_5.2.1-22ubuntu5_powerpc.deb ... Unpacking gcc-5-base:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... Setting up gcc-5-base:powerpc (5.2.1-22ubuntu5) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11513 files and directories currently installed.) Preparing to unpack .../libstdc++6_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libstdc++6:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... Setting up libstdc++6:powerpc (5.2.1-22ubuntu5) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11513 files and directories currently installed.) Preparing to unpack .../libgomp1_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libgomp1:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libatomic1_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libatomic1:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libasan2_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libasan2:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../cpp-5_5.2.1-22ubuntu5_powerpc.deb ... Unpacking cpp-5 (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libcc1-0_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libcc1-0:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../binutils_2.25.51.20151022-0ubuntu1_powerpc.deb ... Unpacking binutils (2.25.51.20151022-0ubuntu1) over (2.25.1-6ubuntu1) ... Preparing to unpack .../g++-5_5.2.1-22ubuntu5_powerpc.deb ... Unpacking g++-5 (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../gcc-5_5.2.1-22ubuntu5_powerpc.deb ... Unpacking gcc-5 (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libgcc-5-dev_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libgcc-5-dev:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libstdc++-5-dev_5.2.1-22ubuntu5_powerpc.deb ... Unpacking libstdc++-5-dev:powerpc (5.2.1-22ubuntu5) over (5.2.1-22ubuntu2) ... Preparing to unpack .../libgcc1_1%3a5.2.1-22ubuntu5_powerpc.deb ... Unpacking libgcc1:powerpc (1:5.2.1-22ubuntu5) over (1:5.2.1-22ubuntu2) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... Setting up libgcc1:powerpc (1:5.2.1-22ubuntu5) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11509 files and directories currently installed.) Preparing to unpack .../libdpkg-perl_1.18.3ubuntu1_all.deb ... Unpacking libdpkg-perl (1.18.3ubuntu1) over (1.18.2ubuntu5) ... Preparing to unpack .../dpkg-dev_1.18.3ubuntu1_all.deb ... Unpacking dpkg-dev (1.18.3ubuntu1) over (1.18.2ubuntu5) ... Preparing to unpack .../advancecomp_1.20-1_powerpc.deb ... Unpacking advancecomp (1.20-1) over (1.19-1) ... Preparing to unpack .../pkg-create-dbgsym_0.70_all.deb ... Unpacking pkg-create-dbgsym (0.70) over (0.69) ... Setting up libubsan0:powerpc (5.2.1-22ubuntu5) ... Setting up libgomp1:powerpc (5.2.1-22ubuntu5) ... Setting up libatomic1:powerpc (5.2.1-22ubuntu5) ... Setting up libasan2:powerpc (5.2.1-22ubuntu5) ... Setting up cpp-5 (5.2.1-22ubuntu5) ... Setting up libcc1-0:powerpc (5.2.1-22ubuntu5) ... Setting up binutils (2.25.51.20151022-0ubuntu1) ... Setting up libgcc-5-dev:powerpc (5.2.1-22ubuntu5) ... Setting up gcc-5 (5.2.1-22ubuntu5) ... Setting up libstdc++-5-dev:powerpc (5.2.1-22ubuntu5) ... Setting up g++-5 (5.2.1-22ubuntu5) ... Setting up libdpkg-perl (1.18.3ubuntu1) ... Setting up dpkg-dev (1.18.3ubuntu1) ... Setting up advancecomp (1.20-1) ... Setting up pkg-create-dbgsym (0.70) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... RUN: /usr/share/launchpad-buildd/slavebin/sbuild-package ['sbuild-package', 'PACKAGEBUILD-8175951', 'powerpc', 'xenial-proposed', '-c', 'chroot:autobuild', '--arch=powerpc', '--dist=xenial-proposed', '--purge=never', '--nolog', 'bedtools_2.25.0-1.dsc'] Initiating build PACKAGEBUILD-8175951 with 8 jobs across 8 processor cores. Kernel reported to sbuild: 3.19.0-31-powerpc64-smp #36~14.04.1-Ubuntu SMP Thu Oct 8 10:49:59 UTC 2015 ppc sbuild (Debian sbuild) 0.65.2 (24 Mar 2015) on fisher03.buildd ╔══════════════════════════════════════════════════════════════════════════════╗ ║ bedtools 2.25.0-1 (powerpc) 23 Oct 2015 18:55 ║ ╚══════════════════════════════════════════════════════════════════════════════╝ Package: bedtools Version: 2.25.0-1 Source Version: 2.25.0-1 Distribution: xenial-proposed Machine Architecture: powerpc Host Architecture: powerpc Build Architecture: powerpc I: NOTICE: Log filtering will replace 'build/bedtools-KXuCHt/bedtools-2.25.0' with '«PKGBUILDDIR»' I: NOTICE: Log filtering will replace 'build/bedtools-KXuCHt' with '«BUILDDIR»' I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-8175951/chroot-autobuild' with '«CHROOT»' ┌──────────────────────────────────────────────────────────────────────────────┐ │ Fetch source files │ └──────────────────────────────────────────────────────────────────────────────┘ Local sources ───────────── bedtools_2.25.0-1.dsc exists in .; copying to chroot Check architectures ─────────────────── sh: 1: gcc: not found sbuild: warning: couldn't determine gcc system type, falling back to default (native compilation) Check dependencies ────────────────── Merged Build-Depends: build-essential, fakeroot Filtered Build-Depends: build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/«BUILDDIR»/resolver-zmODJv/apt_archive/sbuild-build-depends-core-dummy.deb'. Ign file: ./ InRelease Ign file: ./ Release.gpg Get:1 file: ./ Release [2119 B] Ign file: ./ Translation-en Reading package lists... Reading package lists... ┌──────────────────────────────────────────────────────────────────────────────┐ │ Install core build dependencies (apt-based resolver) │ └──────────────────────────────────────────────────────────────────────────────┘ Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following NEW packages will be installed: sbuild-build-depends-core-dummy 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 0 B/772 B of archives. After this operation, 0 B of additional disk space will be used. WARNING: The following packages cannot be authenticated! sbuild-build-depends-core-dummy debconf: delaying package configuration, since apt-utils is not installed Authentication warning overridden. Selecting previously unselected package sbuild-build-depends-core-dummy. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11509 files and directories currently installed.) Preparing to unpack .../sbuild-build-depends-core-dummy.deb ... Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ... Setting up sbuild-build-depends-core-dummy (0.invalid.0) ... Merged Build-Depends: base-files, base-passwd, bash, bsdutils, coreutils, dash, debianutils, diffutils, dpkg, e2fsprogs, findutils, grep, gzip, hostname, init, libc-bin, login, mount, ncurses-base, ncurses-bin, perl-base, sed, tar, util-linux, libc6-dev | libc-dev, gcc (>= 4:5.2), g++ (>= 4:5.2), make, dpkg-dev (>= 1.17.11), debhelper (>= 9), python, zlib1g-dev, samtools Filtered Build-Depends: base-files, base-passwd, bash, bsdutils, coreutils, dash, debianutils, diffutils, dpkg, e2fsprogs, findutils, grep, gzip, hostname, init, libc-bin, login, mount, ncurses-base, ncurses-bin, perl-base, sed, tar, util-linux, libc6-dev | libc-dev, gcc (>= 4:5.2), g++ (>= 4:5.2), make, dpkg-dev (>= 1.17.11), debhelper (>= 9), python, zlib1g-dev, samtools dpkg-deb: building package 'sbuild-build-depends-bedtools-dummy' in '/«BUILDDIR»/resolver-Jmv3XK/apt_archive/sbuild-build-depends-bedtools-dummy.deb'. Ign file: ./ InRelease Ign file: ./ Release.gpg Get:1 file: ./ Release [2119 B] Ign file: ./ Translation-en Reading package lists... Reading package lists... ┌──────────────────────────────────────────────────────────────────────────────┐ │ Install bedtools build dependencies (apt-based resolver) │ └──────────────────────────────────────────────────────────────────────────────┘ Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following extra packages will be installed: bsdmainutils debhelper file gettext gettext-base groff-base intltool-debian libasprintf0v5 libcroco3 libexpat1 libglib2.0-0 libicu55 libmagic1 libpipeline1 libpython-stdlib libpython2.7-minimal libpython2.7-stdlib libunistring0 libxml2 man-db mime-support po-debconf python python-minimal python2.7 python2.7-minimal samtools zlib1g-dev Suggested packages: wamerican wordlist whois vacation dh-make gettext-doc groff less www-browser libmail-box-perl python-doc python-tk python2.7-doc binfmt-support Recommended packages: curl wget lynx-cur libasprintf-dev libgettextpo-dev libglib2.0-data shared-mime-info xdg-user-dirs xml-core libmail-sendmail-perl The following NEW packages will be installed: bsdmainutils debhelper file gettext gettext-base groff-base intltool-debian libasprintf0v5 libcroco3 libexpat1 libglib2.0-0 libicu55 libmagic1 libpipeline1 libpython-stdlib libpython2.7-minimal libpython2.7-stdlib libunistring0 libxml2 man-db mime-support po-debconf python python-minimal python2.7 python2.7-minimal samtools sbuild-build-depends-bedtools-dummy zlib1g-dev 0 upgraded, 29 newly installed, 0 to remove and 0 not upgraded. Need to get 18.1 MB/18.1 MB of archives. After this operation, 76.6 MB of additional disk space will be used. WARNING: The following packages cannot be authenticated! sbuild-build-depends-bedtools-dummy Authentication warning overridden. Get:1 http://ftpmaster.internal/ubuntu/ xenial/main libasprintf0v5 powerpc 0.19.4-1ubuntu3 [6864 B] Get:2 http://ftpmaster.internal/ubuntu/ xenial/main groff-base powerpc 1.22.3-1 [1229 kB] Get:3 http://ftpmaster.internal/ubuntu/ xenial/main bsdmainutils powerpc 9.0.6ubuntu1 [172 kB] Get:4 http://ftpmaster.internal/ubuntu/ xenial/main libpipeline1 powerpc 1.4.1-1 [24.1 kB] Get:5 http://ftpmaster.internal/ubuntu/ xenial/main man-db powerpc 2.7.4-1 [837 kB] Get:6 http://ftpmaster.internal/ubuntu/ xenial/main libglib2.0-0 powerpc 2.46.1-1 [958 kB] Get:7 http://ftpmaster.internal/ubuntu/ xenial/main libicu55 powerpc 55.1-4ubuntu1 [7457 kB] Get:8 http://ftpmaster.internal/ubuntu/ xenial/main libxml2 powerpc 2.9.2+zdfsg1-4 [569 kB] Get:9 http://ftpmaster.internal/ubuntu/ xenial/main libcroco3 powerpc 0.6.8-3 [70.7 kB] Get:10 http://ftpmaster.internal/ubuntu/ xenial/main libunistring0 powerpc 0.9.3-5.2ubuntu1 [254 kB] Get:11 http://ftpmaster.internal/ubuntu/ xenial/main libpython2.7-minimal powerpc 2.7.10-4ubuntu1 [337 kB] Get:12 http://ftpmaster.internal/ubuntu/ xenial/main python2.7-minimal powerpc 2.7.10-4ubuntu1 [1231 kB] Get:13 http://ftpmaster.internal/ubuntu/ xenial/main python-minimal powerpc 2.7.9-1 [28.3 kB] Get:14 http://ftpmaster.internal/ubuntu/ xenial/main mime-support all 3.58ubuntu1 [31.6 kB] Get:15 http://ftpmaster.internal/ubuntu/ xenial/main libexpat1 powerpc 2.1.0-7 [63.8 kB] Get:16 http://ftpmaster.internal/ubuntu/ xenial/main libpython2.7-stdlib powerpc 2.7.10-4ubuntu1 [1730 kB] Get:17 http://ftpmaster.internal/ubuntu/ xenial/main python2.7 powerpc 2.7.10-4ubuntu1 [210 kB] Get:18 http://ftpmaster.internal/ubuntu/ xenial/main libpython-stdlib powerpc 2.7.9-1 [7780 B] Get:19 http://ftpmaster.internal/ubuntu/ xenial/main python powerpc 2.7.9-1 [137 kB] Get:20 http://ftpmaster.internal/ubuntu/ xenial/main libmagic1 powerpc 1:5.22+15-2ubuntu1 [209 kB] Get:21 http://ftpmaster.internal/ubuntu/ xenial/main file powerpc 1:5.22+15-2ubuntu1 [20.7 kB] Get:22 http://ftpmaster.internal/ubuntu/ xenial/main gettext-base powerpc 0.19.4-1ubuntu3 [45.3 kB] Get:23 http://ftpmaster.internal/ubuntu/ xenial/main gettext powerpc 0.19.4-1ubuntu3 [798 kB] Get:24 http://ftpmaster.internal/ubuntu/ xenial/main intltool-debian all 0.35.0+20060710.2 [24.5 kB] Get:25 http://ftpmaster.internal/ubuntu/ xenial/main po-debconf all 1.0.18 [234 kB] Get:26 http://ftpmaster.internal/ubuntu/ xenial-proposed/main debhelper all 9.20151005ubuntu1 [729 kB] Get:27 http://ftpmaster.internal/ubuntu/ xenial/universe samtools powerpc 0.1.19-1ubuntu1 [542 kB] Get:28 http://ftpmaster.internal/ubuntu/ xenial/main zlib1g-dev powerpc 1:1.2.8.dfsg-2ubuntu4 [163 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 18.1 MB in 14s (1218 kB/s) Selecting previously unselected package libasprintf0v5:powerpc. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 11509 files and directories currently installed.) Preparing to unpack .../libasprintf0v5_0.19.4-1ubuntu3_powerpc.deb ... Unpacking libasprintf0v5:powerpc (0.19.4-1ubuntu3) ... Selecting previously unselected package groff-base. Preparing to unpack .../groff-base_1.22.3-1_powerpc.deb ... Unpacking groff-base (1.22.3-1) ... Selecting previously unselected package bsdmainutils. Preparing to unpack .../bsdmainutils_9.0.6ubuntu1_powerpc.deb ... Unpacking bsdmainutils (9.0.6ubuntu1) ... Selecting previously unselected package libpipeline1:powerpc. Preparing to unpack .../libpipeline1_1.4.1-1_powerpc.deb ... Unpacking libpipeline1:powerpc (1.4.1-1) ... Selecting previously unselected package man-db. Preparing to unpack .../man-db_2.7.4-1_powerpc.deb ... Unpacking man-db (2.7.4-1) ... Selecting previously unselected package libglib2.0-0:powerpc. Preparing to unpack .../libglib2.0-0_2.46.1-1_powerpc.deb ... Unpacking libglib2.0-0:powerpc (2.46.1-1) ... Selecting previously unselected package libicu55:powerpc. Preparing to unpack .../libicu55_55.1-4ubuntu1_powerpc.deb ... Unpacking libicu55:powerpc (55.1-4ubuntu1) ... Selecting previously unselected package libxml2:powerpc. Preparing to unpack .../libxml2_2.9.2+zdfsg1-4_powerpc.deb ... Unpacking libxml2:powerpc (2.9.2+zdfsg1-4) ... Selecting previously unselected package libcroco3:powerpc. Preparing to unpack .../libcroco3_0.6.8-3_powerpc.deb ... Unpacking libcroco3:powerpc (0.6.8-3) ... Selecting previously unselected package libunistring0:powerpc. Preparing to unpack .../libunistring0_0.9.3-5.2ubuntu1_powerpc.deb ... Unpacking libunistring0:powerpc (0.9.3-5.2ubuntu1) ... Selecting previously unselected package libpython2.7-minimal:powerpc. Preparing to unpack .../libpython2.7-minimal_2.7.10-4ubuntu1_powerpc.deb ... Unpacking libpython2.7-minimal:powerpc (2.7.10-4ubuntu1) ... Selecting previously unselected package python2.7-minimal. Preparing to unpack .../python2.7-minimal_2.7.10-4ubuntu1_powerpc.deb ... Unpacking python2.7-minimal (2.7.10-4ubuntu1) ... Selecting previously unselected package python-minimal. Preparing to unpack .../python-minimal_2.7.9-1_powerpc.deb ... Unpacking python-minimal (2.7.9-1) ... Selecting previously unselected package mime-support. Preparing to unpack .../mime-support_3.58ubuntu1_all.deb ... Unpacking mime-support (3.58ubuntu1) ... Selecting previously unselected package libexpat1:powerpc. Preparing to unpack .../libexpat1_2.1.0-7_powerpc.deb ... Unpacking libexpat1:powerpc (2.1.0-7) ... Selecting previously unselected package libpython2.7-stdlib:powerpc. Preparing to unpack .../libpython2.7-stdlib_2.7.10-4ubuntu1_powerpc.deb ... Unpacking libpython2.7-stdlib:powerpc (2.7.10-4ubuntu1) ... Selecting previously unselected package python2.7. Preparing to unpack .../python2.7_2.7.10-4ubuntu1_powerpc.deb ... Unpacking python2.7 (2.7.10-4ubuntu1) ... Selecting previously unselected package libpython-stdlib:powerpc. Preparing to unpack .../libpython-stdlib_2.7.9-1_powerpc.deb ... Unpacking libpython-stdlib:powerpc (2.7.9-1) ... Setting up libpython2.7-minimal:powerpc (2.7.10-4ubuntu1) ... Setting up python2.7-minimal (2.7.10-4ubuntu1) ... Setting up python-minimal (2.7.9-1) ... Selecting previously unselected package python. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12862 files and directories currently installed.) Preparing to unpack .../python_2.7.9-1_powerpc.deb ... Unpacking python (2.7.9-1) ... Selecting previously unselected package libmagic1:powerpc. Preparing to unpack .../libmagic1_1%3a5.22+15-2ubuntu1_powerpc.deb ... Unpacking libmagic1:powerpc (1:5.22+15-2ubuntu1) ... Selecting previously unselected package file. Preparing to unpack .../file_1%3a5.22+15-2ubuntu1_powerpc.deb ... Unpacking file (1:5.22+15-2ubuntu1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../gettext-base_0.19.4-1ubuntu3_powerpc.deb ... Unpacking gettext-base (0.19.4-1ubuntu3) ... Selecting previously unselected package gettext. Preparing to unpack .../gettext_0.19.4-1ubuntu3_powerpc.deb ... Unpacking gettext (0.19.4-1ubuntu3) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../intltool-debian_0.35.0+20060710.2_all.deb ... Unpacking intltool-debian (0.35.0+20060710.2) ... Selecting previously unselected package po-debconf. Preparing to unpack .../po-debconf_1.0.18_all.deb ... Unpacking po-debconf (1.0.18) ... Selecting previously unselected package debhelper. Preparing to unpack .../debhelper_9.20151005ubuntu1_all.deb ... Unpacking debhelper (9.20151005ubuntu1) ... Selecting previously unselected package samtools. Preparing to unpack .../samtools_0.1.19-1ubuntu1_powerpc.deb ... Unpacking samtools (0.1.19-1ubuntu1) ... Selecting previously unselected package zlib1g-dev:powerpc. Preparing to unpack .../zlib1g-dev_1%3a1.2.8.dfsg-2ubuntu4_powerpc.deb ... Unpacking zlib1g-dev:powerpc (1:1.2.8.dfsg-2ubuntu4) ... Selecting previously unselected package sbuild-build-depends-bedtools-dummy. Preparing to unpack .../sbuild-build-depends-bedtools-dummy.deb ... Unpacking sbuild-build-depends-bedtools-dummy (0.invalid.0) ... Setting up libasprintf0v5:powerpc (0.19.4-1ubuntu3) ... Setting up groff-base (1.22.3-1) ... Setting up bsdmainutils (9.0.6ubuntu1) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up libpipeline1:powerpc (1.4.1-1) ... Setting up man-db (2.7.4-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libglib2.0-0:powerpc (2.46.1-1) ... No schema files found: doing nothing. Setting up libicu55:powerpc (55.1-4ubuntu1) ... Setting up libxml2:powerpc (2.9.2+zdfsg1-4) ... Setting up libcroco3:powerpc (0.6.8-3) ... Setting up libunistring0:powerpc (0.9.3-5.2ubuntu1) ... Setting up mime-support (3.58ubuntu1) ... Setting up libexpat1:powerpc (2.1.0-7) ... Setting up libpython2.7-stdlib:powerpc (2.7.10-4ubuntu1) ... Setting up python2.7 (2.7.10-4ubuntu1) ... Setting up libpython-stdlib:powerpc (2.7.9-1) ... Setting up python (2.7.9-1) ... Setting up libmagic1:powerpc (1:5.22+15-2ubuntu1) ... Setting up file (1:5.22+15-2ubuntu1) ... Setting up gettext-base (0.19.4-1ubuntu3) ... Setting up gettext (0.19.4-1ubuntu3) ... Setting up intltool-debian (0.35.0+20060710.2) ... Setting up po-debconf (1.0.18) ... Setting up debhelper (9.20151005ubuntu1) ... Setting up samtools (0.1.19-1ubuntu1) ... Setting up zlib1g-dev:powerpc (1:1.2.8.dfsg-2ubuntu4) ... Setting up sbuild-build-depends-bedtools-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.21-0ubuntu4) ... ┌──────────────────────────────────────────────────────────────────────────────┐ │ Build environment │ └──────────────────────────────────────────────────────────────────────────────┘ Kernel: Linux 3.19.0-31-powerpc64-smp powerpc (ppc) Toolchain package versions: binutils_2.25.51.20151022-0ubuntu1 dpkg-dev_1.18.3ubuntu1 g++-5_5.2.1-22ubuntu5 gcc-5_5.2.1-22ubuntu5 libc6-dev_2.21-0ubuntu4 libstdc++-5-dev_5.2.1-22ubuntu5 libstdc++6_5.2.1-22ubuntu5 linux-libc-dev_4.2.0-16.19 Package versions: adduser_3.113+nmu3ubuntu4 advancecomp_1.20-1 apt_1.0.10.2ubuntu1 apt-transport-https_1.0.10.2ubuntu1 base-files_9.4ubuntu2 base-passwd_3.5.38 bash_4.3-14ubuntu1 binutils_2.25.51.20151022-0ubuntu1 bsdmainutils_9.0.6ubuntu1 bsdutils_1:2.26.2-6ubuntu3 build-essential_12.1ubuntu2 bzip2_1.0.6-8 ca-certificates_20150426ubuntu1 coreutils_8.23-4ubuntu2 cpp_4:5.2.1-3ubuntu1 cpp-5_5.2.1-22ubuntu5 dash_0.5.7-4ubuntu2 debconf_1.5.57ubuntu1 debhelper_9.20151005ubuntu1 debianutils_4.5.1 diffutils_1:3.3-1 dmsetup_2:1.02.99-1ubuntu1 dpkg_1.18.3ubuntu1 dpkg-dev_1.18.3ubuntu1 e2fslibs_1.42.12-1ubuntu2 e2fsprogs_1.42.12-1ubuntu2 fakeroot_1.20.2-1ubuntu1 file_1:5.22+15-2ubuntu1 findutils_4.4.2-9build1 g++_4:5.2.1-3ubuntu1 g++-5_5.2.1-22ubuntu5 gcc_4:5.2.1-3ubuntu1 gcc-5_5.2.1-22ubuntu5 gcc-5-base_5.2.1-22ubuntu5 gettext_0.19.4-1ubuntu3 gettext-base_0.19.4-1ubuntu3 gnupg_1.4.18-7ubuntu1 gpgv_1.4.18-7ubuntu1 grep_2.21-2 groff-base_1.22.3-1 gzip_1.6-4ubuntu1 hostname_3.15ubuntu2 init_1.23ubuntu3 initscripts_2.88dsf-59.2ubuntu2 insserv_1.14.0-5ubuntu3 intltool-debian_0.35.0+20060710.2 libacl1_2.2.52-2 libapparmor1_2.10-0ubuntu6 libapt-pkg4.16_1.0.10.2ubuntu1 libasan2_5.2.1-22ubuntu5 libasn1-8-heimdal_1.6~rc2+dfsg-10ubuntu1 libasprintf0v5_0.19.4-1ubuntu3 libatomic1_5.2.1-22ubuntu5 libattr1_1:2.4.47-2 libaudit-common_1:2.4.2-1ubuntu1 libaudit1_1:2.4.2-1ubuntu1 libblkid1_2.26.2-6ubuntu3 libbz2-1.0_1.0.6-8 libc-bin_2.21-0ubuntu4 libc-dev-bin_2.21-0ubuntu4 libc6_2.21-0ubuntu4 libc6-dev_2.21-0ubuntu4 libcap2_1:2.24-9 libcap2-bin_1:2.24-9 libcc1-0_5.2.1-22ubuntu5 libcomerr2_1.42.12-1ubuntu2 libcroco3_0.6.8-3 libcryptsetup4_2:1.6.6-5ubuntu2 libcurl3-gnutls_7.43.0-1ubuntu2 libdb5.3_5.3.28-11 libdbus-1-3_1.10.0-1ubuntu1 libdebconfclient0_0.192ubuntu1 libdevmapper1.02.1_2:1.02.99-1ubuntu1 libdpkg-perl_1.18.3ubuntu1 libexpat1_2.1.0-7 libfakeroot_1.20.2-1ubuntu1 libfdisk1_2.26.2-6ubuntu3 libffi6_3.2.1-3 libgcc-5-dev_5.2.1-22ubuntu5 libgcc1_1:5.2.1-22ubuntu5 libgcrypt20_1.6.3-2ubuntu1 libgdbm3_1.8.3-13.1 libglib2.0-0_2.46.1-1 libgmp10_2:6.0.0+dfsg-7 libgnutls-deb0-28_3.3.15-5ubuntu2 libgomp1_5.2.1-22ubuntu5 libgpg-error0_1.19-2 libgssapi-krb5-2_1.13.2+dfsg-2 libgssapi3-heimdal_1.6~rc2+dfsg-10ubuntu1 libhcrypto4-heimdal_1.6~rc2+dfsg-10ubuntu1 libheimbase1-heimdal_1.6~rc2+dfsg-10ubuntu1 libheimntlm0-heimdal_1.6~rc2+dfsg-10ubuntu1 libhogweed4_3.1.1-4 libhx509-5-heimdal_1.6~rc2+dfsg-10ubuntu1 libicu55_55.1-4ubuntu1 libidn11_1.28-1ubuntu2 libisl13_0.14-2 libk5crypto3_1.13.2+dfsg-2 libkeyutils1_1.5.9-5ubuntu1 libkmod2_21-1ubuntu1 libkrb5-26-heimdal_1.6~rc2+dfsg-10ubuntu1 libkrb5-3_1.13.2+dfsg-2 libkrb5support0_1.13.2+dfsg-2 libldap-2.4-2_2.4.41+dfsg-1ubuntu2 liblockfile-bin_1.09-6ubuntu1 liblockfile1_1.09-6ubuntu1 liblzma5_5.1.1alpha+20120614-2ubuntu2 libmagic1_1:5.22+15-2ubuntu1 libmount1_2.26.2-6ubuntu3 libmpc3_1.0.3-1 libmpfr4_3.1.3-1 libncurses5_5.9+20150516-2ubuntu1 libncursesw5_5.9+20150516-2ubuntu1 libnettle6_3.1.1-4 libnih-dbus1_1.0.3-4ubuntu27 libnih1_1.0.3-4ubuntu27 libp11-kit0_0.23.1-3 libpam-modules_1.1.8-3.1ubuntu3 libpam-modules-bin_1.1.8-3.1ubuntu3 libpam-runtime_1.1.8-3.1ubuntu3 libpam0g_1.1.8-3.1ubuntu3 libpcre3_2:8.35-7.1ubuntu1 libpipeline1_1.4.1-1 libpng12-0_1.2.51-0ubuntu3 libprocps3_1:3.3.9-1ubuntu8 libpython-stdlib_2.7.9-1 libpython2.7-minimal_2.7.10-4ubuntu1 libpython2.7-stdlib_2.7.10-4ubuntu1 libreadline6_6.3-8ubuntu1 libroken18-heimdal_1.6~rc2+dfsg-10ubuntu1 librtmp1_2.4+20150115.gita107cef-1build1 libsasl2-2_2.1.26.dfsg1-14 libsasl2-modules-db_2.1.26.dfsg1-14 libseccomp2_2.2.3-2ubuntu1 libselinux1_2.3-2build1 libsemanage-common_2.3-1build2 libsemanage1_2.3-1build2 libsepol1_2.3-2 libslang2_2.3.0-2ubuntu1 libsmartcols1_2.26.2-6ubuntu3 libsqlite3-0_3.8.11.1-1 libss2_1.42.12-1ubuntu2 libssl1.0.0_1.0.2d-0ubuntu1 libstdc++-5-dev_5.2.1-22ubuntu5 libstdc++6_5.2.1-22ubuntu5 libsystemd0_225-1ubuntu9 libtasn1-6_4.5-2 libtinfo5_5.9+20150516-2ubuntu1 libubsan0_5.2.1-22ubuntu5 libudev1_225-1ubuntu9 libunistring0_0.9.3-5.2ubuntu1 libusb-0.1-4_2:0.1.12-27 libustr-1.0-1_1.0.4-5 libuuid1_2.26.2-6ubuntu3 libwind0-heimdal_1.6~rc2+dfsg-10ubuntu1 libxml2_2.9.2+zdfsg1-4 linux-libc-dev_4.2.0-16.19 lockfile-progs_0.1.17 login_1:4.1.5.1-1.1ubuntu7 lsb-base_4.1+Debian11ubuntu8 make_4.0-8.2 man-db_2.7.4-1 mawk_1.3.3-17ubuntu2 mime-support_3.58ubuntu1 mount_2.26.2-6ubuntu3 multiarch-support_2.21-0ubuntu4 ncurses-base_5.9+20150516-2ubuntu1 ncurses-bin_5.9+20150516-2ubuntu1 openssl_1.0.2d-0ubuntu1 optipng_0.7.5-1 passwd_1:4.1.5.1-1.1ubuntu7 patch_2.7.5-1 perl_5.20.2-6 perl-base_5.20.2-6 perl-modules_5.20.2-6 pkg-create-dbgsym_0.70 pkgbinarymangler_122 po-debconf_1.0.18 policyrcd-script-zg2_0.1-2 procps_1:3.3.9-1ubuntu8 python_2.7.9-1 python-minimal_2.7.9-1 python2.7_2.7.10-4ubuntu1 python2.7-minimal_2.7.10-4ubuntu1 readline-common_6.3-8ubuntu1 samtools_0.1.19-1ubuntu1 sbuild-build-depends-bedtools-dummy_0.invalid.0 sbuild-build-depends-core-dummy_0.invalid.0 sed_4.2.2-6.1 sensible-utils_0.0.9 systemd_225-1ubuntu9 systemd-sysv_225-1ubuntu9 sysv-rc_2.88dsf-59.2ubuntu2 sysvinit-utils_2.88dsf-59.2ubuntu2 tar_1.27.1-2 tzdata_2015g-1 ubuntu-keyring_2012.05.19 udev_225-1ubuntu9 util-linux_2.26.2-6ubuntu3 xz-utils_5.1.1alpha+20120614-2ubuntu2 zlib1g_1:1.2.8.dfsg-2ubuntu4 zlib1g-dev_1:1.2.8.dfsg-2ubuntu4 ┌──────────────────────────────────────────────────────────────────────────────┐ │ Build │ └──────────────────────────────────────────────────────────────────────────────┘ Unpack source ───────────── gpgv: Signature made Fri Sep 4 15:45:52 2015 UTC using RSA key ID 2295D502 gpgv: Can't check signature: public key not found dpkg-source: warning: failed to verify signature on ./bedtools_2.25.0-1.dsc dpkg-source: info: extracting bedtools in bedtools-2.25.0 dpkg-source: info: unpacking bedtools_2.25.0.orig.tar.gz dpkg-source: info: unpacking bedtools_2.25.0-1.debian.tar.xz dpkg-source: info: applying gzstream.h.patch dpkg-source: info: applying fix_test_script.patch Check disc space ──────────────── Sufficient free space for build User Environment ──────────────── DEB_BUILD_OPTIONS=parallel=8 HOME=/home/buildd LANG=C LOGNAME=buildd MAIL=/var/mail/buildd OLDPWD=/ PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/usr/local/games PWD=/«PKGBUILDDIR» SHELL=/bin/sh SUDO_COMMAND=/usr/sbin/chroot /«CHROOT» su buildd -s /bin/sh -c cd '/«PKGBUILDDIR»' && 'env' SUDO_GID=2501 SUDO_UID=2001 SUDO_USER=buildd TERM=unknown USER=buildd USERNAME=root dpkg-buildpackage ───────────────── dpkg-buildpackage: source package bedtools dpkg-buildpackage: source version 2.25.0-1 dpkg-buildpackage: source distribution unstable dpkg-source --before-build bedtools-2.25.0 dpkg-buildpackage: host architecture powerpc dpkg-source: info: using options from bedtools-2.25.0/debian/source/options: --single-debian-patch fakeroot debian/rules clean dh clean dh_testdir dh_auto_clean make -j1 clean make[1]: Entering directory '/«PKGBUILDDIR»' * Cleaning-up BamTools API * Cleaning up. make[1]: Leaving directory '/«PKGBUILDDIR»' dh_clean rm -f debian/bedtools.substvars rm -f debian/bedtools.*.debhelper rm -rf debian/bedtools/ rm -f debian/bedtools-test.substvars rm -f debian/bedtools-test.*.debhelper rm -rf debian/bedtools-test/ rm -rf debian/.debhelper/ rm -f debian/*.debhelper.log rm -f debian/files find . \( \( \ \( -path .\*/.git -o -path .\*/.svn -o -path .\*/.bzr -o -path .\*/.hg -o -path .\*/CVS \) -prune -o -type f -a \ \( -name '#*#' -o -name '.*~' -o -name '*~' -o -name DEADJOE \ -o -name '*.orig' -o -name '*.rej' -o -name '*.bak' \ -o -name '.*.orig' -o -name .*.rej -o -name '.SUMS' \ -o -name TAGS -o \( -path '*/.deps/*' -a -name '*.P' \) \ \) -exec rm -f {} + \) -o \ \( -type d -a -name autom4te.cache -prune -exec rm -rf {} + \) \) rm -f *-stamp debian/rules build-arch dh build-arch dh_testdir -a dh_auto_configure -a dh_auto_build -a make -j1 make[1]: Entering directory '/«PKGBUILDDIR»' Building BEDTools: ========================================================= DETECTED_VERSION = v2.25.0 CURRENT_VERSION = Updating version file. * Creating BamTools API - Building in src/utils/bedFile * compiling bedFile.cpp - Building in src/utils/BinTree * compiling BinTree.cpp - Building in src/utils/version * compiling version.cpp - Building in src/utils/bedGraphFile * compiling bedGraphFile.cpp - Building in src/utils/chromsweep * compiling chromsweep.cpp - Building in src/utils/Contexts * compiling ContextBase.cpp * compiling ContextIntersect.cpp * compiling ContextFisher.cpp * compiling ContextMap.cpp * compiling ContextSample.cpp * compiling ContextSpacing.cpp * compiling ContextMerge.cpp * compiling ContextJaccard.cpp * compiling ContextClosest.cpp * compiling ContextSubtract.cpp * compiling ContextCoverage.cpp * compiling ContextComplement.cpp * compiling ContextGroupBy.cpp - Building in src/utils/FileRecordTools * compiling FileRecordMgr.cpp * compiling FileRecordMergeMgr.cpp - Building in FileReaders * compiling FileReader.cpp * compiling SingleLineDelimTextFileReader.cpp * compiling BamFileReader.cpp * compiling BufferedStreamMgr.cpp * compiling InputStreamMgr.cpp - Building in Records * compiling Record.cpp * compiling EmptyRecord.cpp * compiling Bed3Interval.cpp * compiling Bed4Interval.cpp * compiling BedGraphInterval.cpp * compiling Bed5Interval.cpp * compiling Bed6Interval.cpp * compiling PlusFields.cpp * compiling BedPlusInterval.cpp * compiling Bed12Interval.cpp * compiling BamRecord.cpp * compiling GffRecord.cpp * compiling GffPlusRecord.cpp * compiling VcfRecord.cpp * compiling NoPosPlusRecord.cpp * compiling BlockMgr.cpp * compiling StrandQueue.cpp * compiling RecordMgr.cpp * compiling RecordList.cpp * compiling RecordKeyList.cpp * compiling RecordKeyVector.cpp - Building in src/utils/FileRecordTools/FileReaders make[2]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools/Records make[2]: Nothing to be done for 'all'. - Building in src/utils/general * compiling QuickString.cpp * compiling ParseTools.cpp ParseTools.cpp: In function 'int str2chrPos(const char*, size_t)': ParseTools.cpp:31:7: warning: unused variable 'hasExponent' [-Wunused-variable] bool hasExponent = false; ^ * compiling PushBackStreamBuf.cpp * compiling CompressionTools.cpp * compiling Tokenizer.cpp * compiling CommonHelp.cpp - Building in src/utils/gzstream g++ -Wall -O2 -D_FILE_OFFSET_BITS=64 -fPIC -Isrc/utils/bedFile -Isrc/utils/BinTree -Isrc/utils/version -Isrc/utils/bedGraphFile -Isrc/utils/chromsweep -Isrc/utils/Contexts -Isrc/utils/FileRecordTools -Isrc/utils/FileRecordTools/FileReaders -Isrc/utils/FileRecordTools/Records -Isrc/utils/general -Isrc/utils/gzstream -Isrc/utils/fileType -Isrc/utils/bedFilePE -Isrc/utils/KeyListOps -Isrc/utils/NewChromsweep -Isrc/utils/sequenceUtilities -Isrc/utils/tabFile -Isrc/utils/BamTools -Isrc/utils/BamTools/include -Isrc/utils/BamTools/src -Isrc/utils/BamTools-Ancillary -Isrc/utils/BlockedIntervals -Isrc/utils/Fasta -Isrc/utils/VectorOps -Isrc/utils/GenomeFile -Isrc/utils/RecordOutputMgr -Isrc/utils/ToolBase -Isrc/utils/driver -D_FORTIFY_SOURCE=2 -c -o ../../../obj//gzstream.o gzstream.C -I. - Building in src/utils/fileType * compiling fileType.cpp * compiling FileRecordTypeChecker.cpp - Building in src/utils/bedFilePE * compiling bedFilePE.cpp - Building in src/utils/KeyListOps * compiling KeyListOps.cpp * compiling KeyListOpsMethods.cpp - Building in src/utils/NewChromsweep * compiling NewChromsweep.cpp * compiling CloseSweep.cpp - Building in src/utils/sequenceUtilities * compiling sequenceUtils.cpp - Building in src/utils/tabFile * compiling tabFile.cpp - Building in src/utils/BamTools * compiling BamAlignment.cpp * compiling BamMultiReader.cpp * compiling BamReader.cpp * compiling BamWriter.cpp * compiling SamHeader.cpp * compiling SamProgram.cpp * compiling SamProgramChain.cpp * compiling SamReadGroup.cpp * compiling SamReadGroupDictionary.cpp * compiling SamSequence.cpp * compiling SamSequenceDictionary.cpp * compiling BamHeader_p.cpp * compiling BamMultiReader_p.cpp * compiling BamRandomAccessController_p.cpp * compiling BamReader_p.cpp * compiling BamWriter_p.cpp * compiling BamIndexFactory_p.cpp * compiling BamStandardIndex_p.cpp * compiling BamToolsIndex_p.cpp * compiling BamDeviceFactory_p.cpp * compiling BamFile_p.cpp * compiling BamFtp_p.cpp * compiling BamHttp_p.cpp * compiling BamPipe_p.cpp * compiling BgzfStream_p.cpp * compiling ByteArray_p.cpp * compiling HostAddress_p.cpp * compiling HostInfo_p.cpp * compiling HttpHeader_p.cpp * compiling ILocalIODevice_p.cpp * compiling RollingBuffer_p.cpp * compiling TcpSocketEngine_p.cpp * compiling TcpSocketEngine_unix_p.cpp * compiling TcpSocket_p.cpp * compiling SamFormatParser_p.cpp * compiling SamFormatPrinter_p.cpp * compiling SamHeaderValidator_p.cpp * compiling BamException_p.cpp * linking lib/libbamtools.a ar cr lib/libbamtools.a src/api/BamAlignment.o src/api/BamMultiReader.o src/api/BamReader.o src/api/BamWriter.o src/api/SamHeader.o src/api/SamProgram.o src/api/SamProgramChain.o src/api/SamReadGroup.o src/api/SamReadGroupDictionary.o src/api/SamSequence.o src/api/SamSequenceDictionary.o src/api/internal/bam/BamHeader_p.o src/api/internal/bam/BamMultiReader_p.o src/api/internal/bam/BamRandomAccessController_p.o src/api/internal/bam/BamReader_p.o src/api/internal/bam/BamWriter_p.o src/api/internal/index/BamIndexFactory_p.o src/api/internal/index/BamStandardIndex_p.o src/api/internal/index/BamToolsIndex_p.o src/api/internal/io/BamDeviceFactory_p.o src/api/internal/io/BamFile_p.o src/api/internal/io/BamFtp_p.o src/api/internal/io/BamHttp_p.o src/api/internal/io/BamPipe_p.o src/api/internal/io/BgzfStream_p.o src/api/internal/io/ByteArray_p.o src/api/internal/io/HostAddress_p.o src/api/internal/io/HostInfo_p.o src/api/internal/io/HttpHeader_p.o src/api/internal/io/ILocalIODevice_p.o src/api/internal/io/RollingBuffer_p.o src/api/internal/io/TcpSocketEngine_p.o src/api/internal/io/TcpSocketEngine_unix_p.o src/api/internal/io/TcpSocket_p.o src/api/internal/sam/SamFormatParser_p.o src/api/internal/sam/SamFormatPrinter_p.o src/api/internal/sam/SamHeaderValidator_p.o src/api/internal/utils/BamException_p.o ranlib lib/libbamtools.a - Building in src/utils/BamTools-Ancillary * compiling BamAncillary.cpp * compiling BamAncillary.cpp - Building in src/utils/BlockedIntervals * compiling BlockedIntervals.cpp - Building in src/utils/Fasta * compiling Fasta.cpp Fasta.cpp: In member function 'std::__cxx11::string FastaReference::getSequence(std::__cxx11::string)': Fasta.cpp:290:47: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fread(seq, sizeof(char), seqlen, file); ^ Fasta.cpp: In member function 'std::__cxx11::string FastaReference::getSubSequence(std::__cxx11::string, int, int)': Fasta.cpp:332:55: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fread(seq, sizeof(char), (off_t) seqlen, file); ^ * compiling split.cpp - Building in src/utils/VectorOps * compiling VectorOps.cpp - Building in src/utils/GenomeFile * compiling GenomeFile.cpp GenomeFile.cpp: In member function 'void GenomeFile::loadGenomeFileIntoMap()': GenomeFile.cpp:60:26: warning: variable 'c2' set but not used [-Wunused-but-set-variable] long c2; ^ * compiling NewGenomeFile.cpp - Building in src/utils/RecordOutputMgr * compiling RecordOutputMgr.cpp - Building in src/utils/ToolBase * compiling ToolBase.cpp - Building in src/utils/driver * compiling BedtoolsDriver.cpp - Building in src/annotateBed * compiling annotateMain.cpp annotateMain.cpp: In function 'int annotate_main(int, char**)': annotateMain.cpp:39:10: warning: variable 'haveTitles' set but not used [-Wunused-but-set-variable] bool haveTitles = false; ^ * compiling annotateBed.cpp - Building in src/bamToBed * compiling bamToBed.cpp bamToBed.cpp: In function 'int bamtobed_main(int, char**)': bamToBed.cpp:88:10: warning: variable 'useAlignmentScore' set but not used [-Wunused-but-set-variable] bool useAlignmentScore = false; ^ - Building in src/bamToFastq * compiling bamToFastqMain.cpp bamToFastqMain.cpp: In function 'int bamtofastq_main(int, char**)': bamToFastqMain.cpp:38:10: warning: variable 'haveFastq2' set but not used [-Wunused-but-set-variable] bool haveFastq2 = false; ^ * compiling bamToFastq.cpp - Building in src/bedToBam * compiling bedToBam.cpp bedToBam.cpp: In function 'int bedtobam_main(int, char**)': bedToBam.cpp:60:10: warning: variable 'haveMapQual' set but not used [-Wunused-but-set-variable] bool haveMapQual = false; ^ - Building in src/bedpeToBam * compiling bedpeToBam.cpp bedpeToBam.cpp: In function 'int bedpetobam_main(int, char**)': bedpeToBam.cpp:61:10: warning: variable 'haveMapQual' set but not used [-Wunused-but-set-variable] bool haveMapQual = false; ^ - Building in src/bedToIgv * compiling bedToIgv.cpp - Building in src/bed12ToBed6 * compiling bed12ToBed6.cpp - Building in src/closestFile * compiling closestHelp.cpp * compiling closestFile.cpp - Building in src/clusterBed * compiling clusterMain.cpp clusterMain.cpp: In function 'int cluster_main(int, char**)': clusterMain.cpp:38:10: warning: variable 'haveMaxDistance' set but not used [-Wunused-but-set-variable] bool haveMaxDistance = false; ^ * compiling clusterBed.cpp - Building in src/complementFile * compiling complementHelp.cpp * compiling complementFile.cpp - Building in src/coverageFile * compiling coverageHelp.cpp * compiling coverageFile.cpp - Building in src/expand * compiling expand.cpp - Building in src/fastaFromBed * compiling fastaFromBedMain.cpp * compiling fastaFromBed.cpp - Building in src/flankBed * compiling flankBedMain.cpp * compiling flankBed.cpp - Building in src/genomeCoverageBed * compiling genomeCoverageMain.cpp * compiling genomeCoverageBed.cpp - Building in src/getOverlap * compiling getOverlap.cpp getOverlap.cpp: In function 'int getoverlap_main(int, char**)': getOverlap.cpp:44:10: warning: variable 'haveColumns' set but not used [-Wunused-but-set-variable] bool haveColumns = false; ^ - Building in src/groupBy * compiling groupBy.cpp * compiling groupByHelp.cpp - Building in src/intersectFile * compiling intersectHelp.cpp * compiling intersectFile.cpp - Building in src/fisher * compiling fisherHelp.cpp * compiling fisher.cpp * compiling kfunc.cpp - Building in src/jaccard * compiling jaccardHelp.cpp * compiling jaccard.cpp - Building in src/linksBed * compiling linksMain.cpp * compiling linksBed.cpp - Building in src/maskFastaFromBed * compiling maskFastaFromBedMain.cpp * compiling maskFastaFromBed.cpp - Building in src/mapFile * compiling mapHelp.cpp * compiling mapFile.cpp - Building in src/mergeFile * compiling mergeHelp.cpp * compiling mergeFile.cpp - Building in src/multiBamCov * compiling multiBamCovMain.cpp multiBamCovMain.cpp: In function 'int multibamcov_main(int, char**)': multiBamCovMain.cpp:38:10: warning: variable 'haveBed' set but not used [-Wunused-but-set-variable] bool haveBed = false; ^ multiBamCovMain.cpp:39:10: warning: variable 'haveBams' set but not used [-Wunused-but-set-variable] bool haveBams = false; ^ multiBamCovMain.cpp:47:10: warning: variable 'haveFraction' set but not used [-Wunused-but-set-variable] bool haveFraction = false; ^ * compiling multiBamCov.cpp - Building in src/multiIntersectBed * compiling multiIntersectBedMain.cpp multiIntersectBedMain.cpp: In function 'int multiintersect_main(int, char**)': multiIntersectBedMain.cpp:45:10: warning: variable 'haveFiles' set but not used [-Wunused-but-set-variable] bool haveFiles = false; ^ multiIntersectBedMain.cpp:47:10: warning: variable 'haveGenome' set but not used [-Wunused-but-set-variable] bool haveGenome = false; ^ multiIntersectBedMain.cpp:48:10: warning: variable 'haveFiller' set but not used [-Wunused-but-set-variable] bool haveFiller = true; ^ * compiling multiIntersectBed.cpp - Building in src/nekSandbox1 * compiling nekSandboxMain.cpp - Building in src/nucBed * compiling nucBedMain.cpp * compiling nucBed.cpp - Building in src/pairToBed * compiling pairToBedMain.cpp pairToBedMain.cpp: In function 'int pairtobed_main(int, char**)': pairToBedMain.cpp:43:10: warning: variable 'haveFraction' set but not used [-Wunused-but-set-variable] bool haveFraction = false; ^ * compiling pairToBed.cpp pairToBed.cpp: In member function 'void BedIntersectPE::FindSpanningOverlaps(const BEDPE&, std::vector&, const string&)': pairToBed.cpp:257:12: warning: variable 'spanLength' set but not used [-Wunused-but-set-variable] CHRPOS spanLength = 0; ^ pairToBed.cpp: In member function 'bool BedIntersectPE::FindOneOrMoreSpanningOverlaps(const BEDPE&, const string&)': pairToBed.cpp:310:9: warning: variable 'spanLength' set but not used [-Wunused-but-set-variable] int spanLength = 0; ^ - Building in src/pairToPair * compiling pairToPairMain.cpp pairToPairMain.cpp: In function 'int pairtopair_main(int, char**)': pairToPairMain.cpp:44:10: warning: variable 'haveFraction' set but not used [-Wunused-but-set-variable] bool haveFraction = false; ^ * compiling pairToPair.cpp pairToPair.cpp: In member function 'void PairToPair::FindOverlaps(const BEDPE&)': pairToPair.cpp:112:14: warning: variable 'found1' set but not used [-Wunused-but-set-variable] bool found1 = false; ^ pairToPair.cpp:113:14: warning: variable 'found2' set but not used [-Wunused-but-set-variable] bool found2 = false; ^ - Building in src/randomBed * compiling randomBedMain.cpp * compiling randomBed.cpp - Building in src/regressTest compiling RegressTest.cpp RegressTest.cpp: In member function 'bool RegressTest::executeAndCompareCorrectness(const fileListType&)': RegressTest.cpp:431:25: warning: ignoring return value of 'int system(const char*)', declared with attribute warn_unused_result [-Wunused-result] system(diffCmd.c_str()); ^ RegressTest.cpp: In member function 'bool RegressTest::startMemoryProfile(bool)': RegressTest.cpp:573:24: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ RegressTest.cpp: In member function 'bool RegressTest::calcMemoryStats()': RegressTest.cpp:622:25: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ compiling regressTestMain.cpp - Building in src/reldist * compiling reldistMain.cpp * compiling reldist.cpp reldist.cpp: In member function 'void RelativeDistance::ReportDistanceSummary()': reldist.cpp:73:62: warning: format '%lu' expects argument of type 'long unsigned int', but argument 3 has type 'unsigned int' [-Wformat=] (float) freqItr->second / (float) _tot_queries); ^ reldist.cpp:73:62: warning: format '%lu' expects argument of type 'long unsigned int', but argument 4 has type 'size_t {aka unsigned int}' [-Wformat=] - Building in src/sampleFile * compiling sampleHelp.cpp * compiling sampleFile.cpp - Building in src/shuffleBed * compiling shuffleBedMain.cpp * compiling shuffleBed.cpp - Building in src/slopBed * compiling slopBedMain.cpp * compiling slopBed.cpp slopBed.cpp: In member function 'void BedSlop::AddSlop(BED&)': slopBed.cpp:86:46: warning: comparison between signed and unsigned integer expressions [-Wsign-compare] if ( ((int)bed.end + (int)_leftSlop) <= chromSize ) ^ slopBed.cpp:100:47: warning: comparison between signed and unsigned integer expressions [-Wsign-compare] if ( ((int)bed.end + (int)_rightSlop) <= chromSize ) ^ - Building in src/sortBed * compiling sortMain.cpp * compiling sortBed.cpp - Building in src/spacingFile * compiling spacingHelp.cpp * compiling spacingFile.cpp - Building in src/split * compiling splitBed.cpp * compiling splitBedMain.cpp - Building in src/subtractFile * compiling subtractHelp.cpp * compiling subtractFile.cpp - Building in src/tagBam * compiling tagBamMain.cpp * compiling tagBam.cpp - Building in src/unionBedGraphs * compiling unionBedGraphsMain.cpp unionBedGraphsMain.cpp: In function 'int unionbedgraphs_main(int, char**)': unionBedGraphsMain.cpp:46:10: warning: variable 'haveFiles' set but not used [-Wunused-but-set-variable] bool haveFiles = false; ^ unionBedGraphsMain.cpp:48:10: warning: variable 'haveGenome' set but not used [-Wunused-but-set-variable] bool haveGenome = false; ^ unionBedGraphsMain.cpp:49:10: warning: variable 'haveFiller' set but not used [-Wunused-but-set-variable] bool haveFiller = true; ^ * compiling unionBedGraphs.cpp - Building in src/windowBed * compiling windowMain.cpp * compiling windowBed.cpp - Building in src/windowMaker * compiling windowMakerMain.cpp * compiling windowMaker.cpp - Building main bedtools binary. done. - Creating executables for old CLI. done. make[1]: Leaving directory '/«PKGBUILDDIR»' dh_auto_test -a make -j1 test make[1]: Entering directory '/«PKGBUILDDIR»' Building BEDTools: ========================================================= DETECTED_VERSION = v2.25.0 CURRENT_VERSION = v2.25.0 * Creating BamTools API - Building in src/utils/bedFile make[2]: '../../../obj//bedFile.o' is up to date. - Building in src/utils/BinTree make[2]: '../../../obj//BinTree.o' is up to date. - Building in src/utils/version make[2]: Nothing to be done for 'all'. - Building in src/utils/bedGraphFile make[2]: '../../../obj//bedGraphFile.o' is up to date. - Building in src/utils/chromsweep make[2]: '../../../obj//chromsweep.o' is up to date. - Building in src/utils/Contexts make[2]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools - Building in FileReaders make[3]: Nothing to be done for 'all'. - Building in Records make[3]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools/FileReaders make[2]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools/Records make[2]: Nothing to be done for 'all'. - Building in src/utils/general make[2]: Nothing to be done for 'all'. - Building in src/utils/gzstream make[2]: '../../../obj//gzstream.o' is up to date. - Building in src/utils/fileType make[2]: Nothing to be done for 'all'. - Building in src/utils/bedFilePE make[2]: '../../../obj//bedFilePE.o' is up to date. - Building in src/utils/KeyListOps make[2]: Nothing to be done for 'all'. - Building in src/utils/NewChromsweep make[2]: Nothing to be done for 'all'. - Building in src/utils/sequenceUtilities make[2]: '../../../obj//sequenceUtils.o' is up to date. - Building in src/utils/tabFile make[2]: '../../../obj//tabFile.o' is up to date. - Building in src/utils/BamTools make[2]: Nothing to be done for 'all'. - Building in src/utils/BamTools-Ancillary make[2]: Nothing to be done for 'all'. - Building in src/utils/BlockedIntervals make[2]: Nothing to be done for 'all'. - Building in src/utils/Fasta make[2]: Nothing to be done for 'all'. - Building in src/utils/VectorOps make[2]: '../../../obj//VectorOps.o' is up to date. - Building in src/utils/GenomeFile make[2]: '../../../obj//NewGenomeFile.o' is up to date. - Building in src/utils/RecordOutputMgr make[2]: '../../../obj//RecordOutputMgr.o' is up to date. - Building in src/utils/ToolBase make[2]: '../../../obj//ToolBase.o' is up to date. - Building in src/utils/driver make[2]: Nothing to be done for 'all'. - Building in src/annotateBed make[2]: Nothing to be done for 'all'. - Building in src/bamToBed make[2]: Nothing to be done for 'all'. - Building in src/bamToFastq make[2]: Nothing to be done for 'all'. - Building in src/bedToBam make[2]: Nothing to be done for 'all'. - Building in src/bedpeToBam make[2]: Nothing to be done for 'all'. - Building in src/bedToIgv make[2]: Nothing to be done for 'all'. - Building in src/bed12ToBed6 make[2]: Nothing to be done for 'all'. - Building in src/closestFile make[2]: Nothing to be done for 'all'. - Building in src/clusterBed make[2]: Nothing to be done for 'all'. - Building in src/complementFile make[2]: Nothing to be done for 'all'. - Building in src/coverageFile make[2]: Nothing to be done for 'all'. - Building in src/expand make[2]: Nothing to be done for 'all'. - Building in src/fastaFromBed make[2]: Nothing to be done for 'all'. - Building in src/flankBed make[2]: Nothing to be done for 'all'. - Building in src/genomeCoverageBed make[2]: Nothing to be done for 'all'. - Building in src/getOverlap make[2]: Nothing to be done for 'all'. - Building in src/groupBy make[2]: Nothing to be done for 'all'. - Building in src/intersectFile make[2]: Nothing to be done for 'all'. - Building in src/fisher make[2]: Nothing to be done for 'all'. - Building in src/jaccard make[2]: Nothing to be done for 'all'. - Building in src/linksBed make[2]: Nothing to be done for 'all'. - Building in src/maskFastaFromBed make[2]: Nothing to be done for 'all'. - Building in src/mapFile make[2]: Nothing to be done for 'all'. - Building in src/mergeFile make[2]: Nothing to be done for 'all'. - Building in src/multiBamCov make[2]: Nothing to be done for 'all'. - Building in src/multiIntersectBed make[2]: Nothing to be done for 'all'. - Building in src/nekSandbox1 make[2]: Nothing to be done for 'all'. - Building in src/nucBed make[2]: Nothing to be done for 'all'. - Building in src/pairToBed make[2]: Nothing to be done for 'all'. - Building in src/pairToPair make[2]: Nothing to be done for 'all'. - Building in src/randomBed make[2]: Nothing to be done for 'all'. - Building in src/regressTest compiling RegressTest.cpp RegressTest.cpp: In member function 'bool RegressTest::executeAndCompareCorrectness(const fileListType&)': RegressTest.cpp:431:25: warning: ignoring return value of 'int system(const char*)', declared with attribute warn_unused_result [-Wunused-result] system(diffCmd.c_str()); ^ RegressTest.cpp: In member function 'bool RegressTest::startMemoryProfile(bool)': RegressTest.cpp:573:24: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ RegressTest.cpp: In member function 'bool RegressTest::calcMemoryStats()': RegressTest.cpp:622:25: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ compiling regressTestMain.cpp - Building in src/reldist make[2]: Nothing to be done for 'all'. - Building in src/sampleFile make[2]: Nothing to be done for 'all'. - Building in src/shuffleBed make[2]: Nothing to be done for 'all'. - Building in src/slopBed make[2]: Nothing to be done for 'all'. - Building in src/sortBed make[2]: Nothing to be done for 'all'. - Building in src/spacingFile make[2]: Nothing to be done for 'all'. - Building in src/split make[2]: Nothing to be done for 'all'. - Building in src/subtractFile make[2]: Nothing to be done for 'all'. - Building in src/tagBam make[2]: Nothing to be done for 'all'. - Building in src/unionBedGraphs make[2]: Nothing to be done for 'all'. - Building in src/windowBed make[2]: Nothing to be done for 'all'. - Building in src/windowMaker make[2]: Nothing to be done for 'all'. - Building main bedtools binary. done. - Creating executables for old CLI. done. Performing general tests: general.t01...\c ok general.t02...\c ok general.t03...\c ok general.t04...\c ok general.t05...\c ok general.t06...\c ok general.t07...\c ok general.t08...\c ok general.t09...\c ok general.t10...\c ok general.t11...\c ok general.t12...\c ok general.t13...\c ok general.t14...\c ok general.15...\c ok general.t16...\c ok general.t17...\c ok general.t18...\c ok general.t19...\c ok general.t20...\c ok general.t21...\c ok general.22...\c ok general.t23...\c ok general.t24...\c ok general.t25...\c ok general.t26...\c ok general.t27...\c ok general.t28...\c ok general.29...\c ok general.t30...\c ok general.t31...\c ok general.t32...\c ok general.t33...\c ok general.t34...\c ok general.t35...\c ok general.36...\c ok general.t37...\c ok general.t38...\c ok general.t39...\c ok general.t40...\c ok general.t41...\c ok general.t42...\c ok Testing bedtools bed12tobed6: bed12tobed6.t1...\c ok bed12tobed6.t2...\c ok bed12tobed6.t3...\c ok bed12tobed6.t4...\c ok bed12tobed6.t5...\c ok Testing bedtools bamtobed: bamtobed.t1...\c Failed to open BAM file one_block.bam 0a1 > chr1 0 30 one_blocks 40 - fail bamtobed.t2...\c Failed to open BAM file one_block.bam 0a1 > chr1 0 30 one_blocks 40 - fail bamtobed.t3...\c Failed to open BAM file two_blocks.bam 0a1 > chr1 0 40 two_blocks 40 - fail bamtobed.t4...\c Failed to open BAM file two_blocks.bam 0a1,2 > chr1 0 15 two_blocks 40 - > chr1 25 40 two_blocks 40 - fail bamtobed.t5...\c Failed to open BAM file three_blocks.bam 0a1 > chr1 0 50 three_blocks 40 - fail bamtobed.t6...\c Failed to open BAM file three_blocks.bam 0a1,3 > chr1 0 10 three_blocks 40 - > chr1 20 30 three_blocks 40 - > chr1 40 50 three_blocks 40 - fail bamtobed.t7...\c Failed to open BAM file three_blocks.bam 0a1 > chr1 0 50 three_blocks 40 - 0 50 255,0,0 3 10,10,10 0,20,40 fail bamtobed.t8...\c Failed to open BAM file three_blocks.bam Failed to open BAM file three_blocks.bam ok bamtobed.t9...\c Failed to open BAM file two_blocks_w_D.bam 1,6d0 < chr1 0 15 two_blocks_1_1/2 40 + < chr1 25 40 two_blocks_1_1/2 40 + < chr1 99 129 two_blocks_1_2/1 40 + < chr1 0 15 two_blocks_2_1/2 40 + < chr1 25 42 two_blocks_2_1/2 40 + < chr1 99 129 two_blocks_2_2/1 40 + fail bamtobed.t10...\c Failed to open BAM file two_blocks_w_D.bam 1,7d0 < chr1 0 15 two_blocks_1_1/2 40 + < chr1 25 40 two_blocks_1_1/2 40 + < chr1 99 129 two_blocks_1_2/1 40 + < chr1 0 15 two_blocks_2_1/2 40 + < chr1 25 35 two_blocks_2_1/2 40 + < chr1 37 42 two_blocks_2_1/2 40 + < chr1 99 129 two_blocks_2_2/1 40 + fail bamtobed.t9...\c Failed to open BAM file two_blocks_w_D.bam 1,4d0 < chr1 0 40 two_blocks_1_1/2 40 + 0 40 255,0,0 2 15,15 0,25 < chr1 99 129 two_blocks_1_2/1 40 + 99 129 255,0,0 1 30 0 < chr1 0 42 two_blocks_2_1/2 40 + 0 42 255,0,0 2 15,17 0,25 < chr1 99 129 two_blocks_2_2/1 40 + 99 129 255,0,0 1 30 0 fail bamtobed.t11...\c Failed to open BAM file two_blocks_w_D.bam 1,4d0 < chr1 0 40 two_blocks_1_1/2 40 + 0 40 255,0,0 2 15,15 0,25 < chr1 99 129 two_blocks_1_2/1 40 + 99 129 255,0,0 1 30 0 < chr1 0 42 two_blocks_2_1/2 40 + 0 42 255,0,0 3 15,10,5 0,25,37 < chr1 99 129 two_blocks_2_2/1 40 + 99 129 255,0,0 1 30 0 fail Testing bedtools closest: closest.t1...\c ok closest.t2...\c ok closest.t3...\c ok closest.t4...\c ok closest.t5...\c ok closest.t6...\c ok closest.t7...\c ok closest.t8...\c ok closest.t9...\c ok closest.t10...\c ok closest.t11...\c ok closest.t13...\c ok closest.t14...\c ok closest.t15...\c ok closest.t16...\c ok closest.t17...\c ok closest.t18...\c ok closest.t19...\c ok closest.t20...\c ok closest.t21...\c ok closest.t22...\c ok closest.t23...\c ok closest.t24...\c ok closest.t25...\c ok closest.t26...\c ok closest.t27...\c ok closest.t28...\c ok closest.t29...\c ok closest.t30...\c ok closest.t31...\c ok closest.t32...\c ok closest.t33...\c ok closest.t34...\c ok closest.t35...\c ok closest.t36...\c ok closest.t37...\c ok closest.t38...\c ok closest.t39...\c ok closest.t40...\c ok closest.t41...\c ok closest.t42...\c ok closest.t43...\c ok closest.t44...\c ok closest.t45...\c ok closest.t46...\c ok closest.t47...\c ok closest.t48...\c ok closest.t49...\c ok closest.t50...\c ok closest.t51...\c ok closest.t52...\c ok closest.t53...\c ok closest.t54...\c ok closest.t55...\c ok closest.t56...\c ok closest.t57...\c ok closest.t58...\c ok closest.t59...\c ok ########################################################### # # CHROMOSOME SORT ORDER AND NAMING CONVENTIONS # ########################################################### closest.t01...\c ok closest.t02...\c ok closest.t03...\c ok closest.t04...\c ok closest.t05...\c ok closest.t06...\c ok closest.t07...\c ok closest.t08...\c ok closest.t09...\c ok closest.t10...\c ok closest.t11...\c ok closest.t12...\c ok closest.t13...\c ok closest.t14...\c ok closest.t15...\c ok closest.t16...\c ok closest.t17...\c ok closest.t18...\c ok closest.t19...\c ok closest.20...\c ok closest.21...\c ok closest.22...\c ok closest.23...\c ok ########################################################### # # K CLOSEST HITS TESTS # ########################################################### kclosest.t1...\c ok kclosest.t2...\c ok kclosest.t3...\c ok kclosest.t4...\c ok kclosest.t5...\c ok kclosest.t6...\c ok kclosest.t7...\c ok kclosest.t8...\c ok kclosest.t9...\c ok kclosest.t10...\c ok kclosest.t11...\c ok kclosest.t12...\c ok kclosest.t13...\c ok kclosest.t14...\c ok kclosest.t15...\c ok kclosest.t16...\c ok kclosest.t17...\c ok kclosest.t18...\c ok kclosest.t19...\c ok kclosest.t20...\c ok kclosest.t21...\c ok kclosest.t22...\c ok kclosest.t23...\c ok kclosest.t24...\c ok kclosest.t25...\c ok kclosest.t26...\c ok kclosest.t27...\c ok kclosest.t28...\c ok kclosest.t29...\c ok kclosest.t30...\c ok kclosest.t31...\c ok kclosest.t32...\c ok kclosest.t33...\c ok kclosest.t34...\c ok kclosest.t35...\c ok kclosest.t36...\c ok kclosest.t37...\c ok kclosest.t38...\c ok Testing bedtools cluster: cluster.t1...\c ok cluster.t2...\c ok Testing bedtools coverage: coverage.t1...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-coverage.sh: line 30: 14868 Aborted $BT coverage -abam three_blocks.bam -b three_blocks_nomatch.bed > obs 0a1 > chr1 0 50 three_blocks 40 - 0 50 0,0,0 3 10,10,10, 0,20,40, 1 40 50 0.8000000 fail coverage.t2...\c ok coverage.t3...\c ok coverage.t4...\c ok coverage.t5...\c ok coverage.t6...\c ok coverage.t7...\c ok coverage.t8...\c ok coverage.t9...\c ok coverage.t10...\c ok coverage.t11...\c ok coverage.t12...\c ok Testing bedtools expand: expand.t1...\c ok expand.t2...\c ok expand.t3...\c ok Testing bedtools flank: flank.t1...\c ok flank.t2...\c ok flank.t3...\c ok flank.t4...\c ok flank.t5...\c ok flank.t6...\c ok flank.t7...\c ok flank.t8...\c ok flank.t9...\c ok flank.t10...\c ok flank.t11...\c ok Testing bedtools fisher: fisher.t1...\c ok fisher.t2...\c ok fisher.t3...\c ok fisher.t4...\c ok Testing bedtools genomecov: genomecov.t1...\c Failed to open BAM file three_blocks.bam 0a1 > chr1 0 50 1 fail genomecov.t2...\c Failed to open BAM file three_blocks.bam 0a1,3 > chr1 0 10 1 > chr1 20 30 1 > chr1 40 50 1 fail genomecov.t3...\c Failed to open BAM file three_blocks.bam 0a1,6 > chr1 0 10 1 > chr1 10 20 0 > chr1 20 30 1 > chr1 30 40 0 > chr1 40 50 1 > chr1 50 1000 0 fail genomecov.t4...\c Failed to open BAM file - 0a1,4 > chr1 0 30 3 > chr1 30 40 2 > chr1 40 50 1 > chr1 50 1000 0 fail genomecov.t5...\c Failed to open BAM file - 0a1,7 > chr1 0 10 3 > chr1 10 15 2 > chr1 15 20 1 > chr1 20 25 2 > chr1 25 30 3 > chr1 30 50 1 > chr1 50 1000 0 fail genomecov.t6...\c Failed to open BAM file three_blocks.bam 0a1,30 > chr1 0 1 > chr1 1 1 > chr1 2 1 > chr1 3 1 > chr1 4 1 > chr1 5 1 > chr1 6 1 > chr1 7 1 > chr1 8 1 > chr1 9 1 > chr1 20 1 > chr1 21 1 > chr1 22 1 > chr1 23 1 > chr1 24 1 > chr1 25 1 > chr1 26 1 > chr1 27 1 > chr1 28 1 > chr1 29 1 > chr1 40 1 > chr1 41 1 > chr1 42 1 > chr1 43 1 > chr1 44 1 > chr1 45 1 > chr1 46 1 > chr1 47 1 > chr1 48 1 > chr1 49 1 fail genomecov.t7...\c Failed to open BAM file sam-w-del.bam 0a1,2 > chr1 0 10 1 > chr1 11 21 1 fail genomecov.t8...\c Failed to open BAM file y.bam 0a1,8 > 1 0 93 100 0.93 > 1 1 4 100 0.04 > 1 2 3 100 0.03 > 2 0 100 100 1 > 3 0 100 100 1 > genome 0 293 300 0.976667 > genome 1 4 300 0.0133333 > genome 2 3 300 0.01 fail genomecov.t9...\c Failed to open BAM file y.bam 0a1,3 > 1 15 17 1 > 1 17 20 2 > 1 20 22 1 fail genomecov.t10...\c Failed to open BAM file y.bam 0a1,7 > 1 0 15 0 > 1 15 17 1 > 1 17 20 2 > 1 20 22 1 > 1 22 100 0 > 2 0 100 0 > 3 0 100 0 fail genomecov.t11...\c Error: The requested genome file (genome.txt) could not be opened. Exiting! 0a1,8 > 1 0 93 100 0.93 > 1 1 4 100 0.04 > 1 2 3 100 0.03 > 2 0 100 100 1 > 3 0 100 100 1 > genome 0 293 300 0.976667 > genome 1 4 300 0.0133333 > genome 2 3 300 0.01 fail genomecov.t12...\c Error: The requested genome file (genome.txt) could not be opened. Exiting! 0a1,3 > 1 15 17 1 > 1 17 20 2 > 1 20 22 1 fail genomecov.t13...\c Error: The requested genome file (genome.txt) could not be opened. Exiting! 0a1,7 > 1 0 15 0 > 1 15 17 1 > 1 17 20 2 > 1 20 22 1 > 1 22 100 0 > 2 0 100 0 > 3 0 100 0 fail Testing bedtools getfasta: getfasta.t01...\c ok getfasta.t02...\c ok getfasta.t03...\c ok getfasta.t04...\c ok getfasta.t05...\c ok getfasta.t06...\c ok getfasta.t07...\c ok getfasta.t08...\c index file test.iupac.fa.fai not found, generating... ok getfasta.t09...\c index file test.iupac.fa.fai not found, generating... ok getfasta.t10...\c index file test.fa.fai not found, generating... ok Testing bedtools intersect: intersect.t01...\c ok intersect.t02...\c ok intersect.t03...\c ok intersect.t04...\c ok intersect.t05...\c ok intersect.t06...\c ok intersect.t07...\c ok intersect.t08...\c ok intersect.t09...\c ok intersect.t10...\c ok intersect.t11...\c ok intersect.t12...\c ok intersect.t13...\c ok intersect.t14...\c ok intersect.t15...\c ok intersect.t16...\c ok intersect.t17...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 0a1 > three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 fail intersect.t18...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". ok intersect.t19...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 0a1 > three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 fail intersect.t20...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". ok intersect.t21...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 0a1 > three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 fail intersect.t22...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". ok intersect.t22.a...\c ok intersect.t22.b...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 274: 15147 Aborted $BT intersect -a three_blocks_match.bam -b d.bed -split -wo -bed > obs 0a1 > chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 5 15 5 fail intersect.t22.c...\c ok intersect.t22.d...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 294: 15153 Aborted $BT intersect -a three_blocks_match.bam -b two_blocks_partial.bed -split -wo -bed > obs 0a1 > chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 0 45 three_blocks_match 0 + 0 0 0 2 5,10, 25,35, 10 fail intersect.t22.e...\c ok intersect.t22.f...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 314: 15161 Aborted $BT intersect -a three_blocks_match.bam -b three_blocks_nomatch.bed -split -wo -bed > obs ok intersect.t22.g...\c ok intersect.t23...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 0a1 > mapped 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 fail intersect.t24...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 0a1 > umapped 4 * 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50 fail intersect.t25...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 358: 15177 Aborted $BT intersect -abam one_block.bam -b c.bed -c -bed > obs 0a1 > chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, 1 fail intersect.t26...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 368: 15180 Aborted $BT intersect -abam one_block.bam -b c.bed -wo -bed > obs 0a1 > chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30 fail intersect.t27...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 378: 15183 Aborted $BT intersect -abam one_block.bam -b c.bed -wo -bed > obs 0a1 > chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30 fail intersect.t28...\c ok intersect.t29...\c ok intersect.t30...\c ok intersect.t31...\c ok intersect.t32...\c ok intersect.t33...\c ok intersect.t34...\c ok intersect.t35...\c ok intersect.t36...\c ok intersect.t37...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 470: 15213 Aborted $BT intersect -a a.bed -b a.bam > obs 0a1,2 > chr1 10 20 a1 1 + > chr1 100 200 a2 2 - fail intersect.t38...\c ok intersect.t39...\c ok intersect.t40...\c ok intersect.t41...\c ok intersect.t42...\c ok intersect.t43...\c ok intersect.t44...\c ok intersect.t45...\c ok intersect.t46...\c ok intersect.t47...\c ok intersect.t48...\c ok intersect.t49...\c ok intersect.t50...\c ok intersect.t51...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-intersect.sh: line 636: 15276 Aborted $BT intersect -a bug44_a.vcf.gz -b bug44_b.bed -wa -wb > obs 1d0 < MT 2706 . A G 2965 PASS BRF=0.05;FR=1;HP=1;HapScore=1;MGOF=17;MMLQ=30;MQ=62.05;NF=7607;NR=8147;PP=2965;QD=20;SC=AGGCGGGCATAACACAGCAAG;SbPval=0.52;Source=Platypus;TC=15840;TCF=7679;TCR=8161;TR=15754;WE=2749;WS=2693;CSQ=G|ENSG00000198763|ENST00000361453|Transcript|upstream_gene_variant||||||rs2854128|1764|1|MT-ND2|HGNC|7456|protein_coding|YES||ENSP00000355046|NU2M_HUMAN|Q7GXY9_HUMAN&Q5Q3P5_HUMAN&Q14X33_HUMAN&Q14WT3_HUMAN&A6ZH82_HUMAN&A6ZGN8_HUMAN&A6ZGG3_HUMAN|UPI0000000AA2||||||A:0.1656|||||||||||||,G|ENSG00000210151|ENST00000387416|Transcript|downstream_gene_variant||||||rs2854128|4740|-1|MT-TS1|HGNC|7497|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210077|ENST00000387342|Transcript|downstream_gene_variant||||||rs2854128|1036|1|MT-TV|HGNC|7500|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210144|ENST00000387409|Transcript|downstream_gene_variant||||||rs2854128|3120|-1|MT-TY|HGNC|7502|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210117|ENST00000387382|Transcript|upstream_gene_variant||||||rs2854128|2806|1|MT-TW|HGNC|7501|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210107|ENST00000387372|Transcript|downstream_gene_variant||||||rs2854128|1623|-1|MT-TQ|HGNC|7495|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210140|ENST00000387405|Transcript|downstream_gene_variant||||||rs2854128|3055|-1|MT-TC|HGNC|7477|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000211459|ENST00000389680|Transcript|downstream_gene_variant||||||rs2854128|1105|1|MT-RNR1|HGNC|7470|Mt_rRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210082|ENST00000387347|Transcript|non_coding_transcript_exon_variant&non_coding_transcript_variant|1036|||||rs2854128||1|MT-RNR2|HGNC|7471|Mt_rRNA|YES||||||||1/1|||A:0.1656|||||||||||||,G|ENSG00000210127|ENST00000387392|Transcript|downstream_gene_variant||||||rs2854128|2881|-1|MT-TA|HGNC|7475|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198712|ENST00000361739|Transcript|upstream_gene_variant||||||rs2854128|4880|1|MT-CO2|HGNC|7421|protein_coding|YES||ENSP00000354876|COX2_HUMAN|Q7GXZ8_HUMAN&Q4R1L5_HUMAN&Q4R1L3_HUMAN&Q14XT3_HUMAN&K7WVJ5_HUMAN&H9E7W2_HUMAN&H9E7T7_HUMAN&H9E7P8_HUMAN&H9E7F7_HUMAN&E2DTL8_HUMAN&D3WYY9_HUMAN&D2Y6Y2_HUMAN&D2Y6Y1_HUMAN&B2YKU2_HUMAN|UPI0000000AA4||||||A:0.1656|||||||||||||,G|ENSG00000210049|ENST00000387314|Transcript|downstream_gene_variant||||||rs2854128|2059|1|MT-TF|HGNC|7481|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198888|ENST00000361390|Transcript|upstream_gene_variant||||||rs2854128|601|1|MT-ND1|HGNC|7455|protein_coding|YES||ENSP00000354687|NU1M_HUMAN|Q85KV6_HUMAN&Q8WCX9_HUMAN&Q5Q757_HUMAN&Q14WI3_HUMAN&G3EBI1_HUMAN&D2Y6X8_HUMAN&D2Y6X6_HUMAN&A6ZHG8_HUMAN|UPI0000000AA1||||||A:0.1656|||||||||||||,G|ENSG00000209082|ENST00000386347|Transcript|upstream_gene_variant||||||rs2854128|524|1|MT-TL1|HGNC|7490|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198804|ENST00000361624|Transcript|upstream_gene_variant||||||rs2854128|3198|1|MT-CO1|HGNC|7419|protein_coding|YES||ENSP00000354499|COX1_HUMAN|Q957U9_HUMAN&Q7GXY8_HUMAN&M9Z2G2_HUMAN&Q8HBX8_HUMAN&Q5Q1W2_HUMAN&Q4R1L4_HUMAN&Q14XD3_HUMAN&Q14X83_HUMAN&F8U4W0_HUMAN&D3WYY6_HUMAN&D3WYY5_HUMAN&D3WYY4_HUMAN&D2Y6W4_HUMAN&C8YAE4_HUMAN&C3UPN2_HUMAN&B7TCT8_HUMAN&B2Y9D8_HUMAN&A5YMT3_HUMAN&A1XP63_HUMAN&A0S1I7_HUMAN|UPI0000000AA3||||||A:0.1656|||||||||||||,G|ENSG00000210154|ENST00000387419|Transcript|upstream_gene_variant||||||rs2854128|4812|1|MT-TD|HGNC|7478|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210112|ENST00000387377|Transcript|upstream_gene_variant||||||rs2854128|1696|1|MT-TM|HGNC|7492|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210135|ENST00000387400|Transcript|downstream_gene_variant||||||rs2854128|2951|-1|MT-TN|HGNC|7493|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210100|ENST00000387365|Transcript|upstream_gene_variant||||||rs2854128|1557|1|MT-TI|HGNC|7488|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||;GR=3.07;PH=0.654;PS=0.002 GT:GL:GOF:GQ:NR:NV 1/1:-300,-298.01,0:3:99:2733:2718 1/1:-300,-298.01,0:17:99:6509:6461 1/1:-300,-298.01,0:2:99:6598:6575 MT 2591 2747 rRNA fail intersect.t52...\c ok intersect.t53...\c 1d0 < \c fail intersect.t54...\c ok intersect.t55...\c 1d0 < \c fail intersect.t56...\c ok intersect.t57...\c ok intersect.t58...\c ok intersect.t59...\c 1d0 < \c fail intersect.t60...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 1d0 < \c fail intersect.t61...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 1,2d0 < a1 0 chr1 11 255 10M * 0 0 * * < a2 16 chr2 11 255 10M * 0 0 * * fail intersect.t62...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 1,2d0 < a1 0 chr1 11 255 10M * 0 0 * * < a2 16 chr2 11 255 10M * 0 0 * * fail intersect.t63...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 1,2d0 < a1 0 chr1 11 255 10M * 0 0 * * < a2 16 chr2 11 255 10M * 0 0 * * fail intersect.t64...\c [bam_header_read] EOF marker is absent. The input is probably truncated. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents [bam_header_read] invalid BAM binary header (this is not a BAM file). [main_samview] fail to read the header from "-". 1d0 < \c fail intersect.t65...\c ok ########################################################### # # MULTIPLE DATABASE INTERSECTION # ########################################################### intersect.t01...\c ok intersect.t02...\c ok intersect.t03...\c ok intersect.t04...\c ok intersect.t05...\c ok intersect.t06...\c ok intersect.t07...\c ok intersect.t08...\c ok intersect.t09...\c ok intersect.t10...\c ok intersect.t11...\c ok intersect.t12...\c ok intersect.t13...\c ok intersect.t13...\c ok intersect.t14...\c ok intersect.t15...\c ok intersect.t16...\c ok intersect.t17...\c ok intersect.t18...\c ok intersect.t19...\c ok ########################################################### # # CHROMOSOME SORT ORDER AND NAMING CONVENTIONS # ########################################################### intersect.t01...\c ok intersect.t02...\c ok intersect.t03...\c ok intersect.t04...\c ok intersect.t05...\c ok intersect.t06...\c ok intersect.t07...\c ok intersect.t08...\c ok intersect.t09...\c ok intersect.t10...\c ok intersect.t11...\c ok intersect.t12...\c ok intersect.t13...\c ok intersect.t14...\c ok intersect.t15...\c ok intersect.t16...\c ok intersect.t17...\c ok intersect.t18...\c ok intersect.t19...\c ok intersect.20...\c ok intersect.21...\c ok intersect.22...\c ok intersect.23...\c ok intersect.new.t01...\c ok intersect.new.t02...\c ok intersect.new.t03...\c ok intersect.new.t04...\c ok intersect.new.t05...\c ok intersect.new.t06...\c ok intersect.new.t07...\c ok intersect.new.t08...\c ok intersect.new.t09...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 115: 15508 Aborted $BT intersect -a a_bgzipped.bed.gz -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t10...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 127: 15511 Aborted $BT intersect -a - -b b.bed < a_bgzipped.bed.gz > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t11...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 139: 15514 Done cat a_bgzipped.bed.gz 15515 Aborted | $BT intersect -a - -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t12...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 151: 15519 Aborted $BT intersect -a <(cat a_bgzipped.bed.gz) -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t13...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 160: 15523 Aborted $BT intersect -a a.bam -b b.bed > obs Binary files obs and aVSb.bam differ fail intersect.new.t14...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 169: 15526 Aborted $BT intersect -a - -b b.bed < a.bam > obs Binary files obs and aVSb.bam differ fail intersect.new.t15...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 178: 15529 Done cat a.bam 15530 Aborted | $BT intersect -a - -b b.bed > obs Binary files obs and aVSb.bam differ fail intersect.new.t16...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 187: 15534 Aborted $BT intersect -a <(cat a.bam) -b b.bed > obs Binary files obs and aVSb.bam differ fail intersect.new.t17...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 201: 15538 Aborted $BT intersect -a a_with_bothUnmapped.bam -b b.bed -bed > obs 0a1,2 > chr1 100 101 a2 255 - 100 200 0,0,0 1 100, 0, > chr1 100 110 a2 255 - 100 200 0,0,0 1 100, 0, fail intersect.new.t18...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 220: 15541 Aborted $BT intersect -a a_with_bothUnmapped.bam -b b.bed -bed -v > obs 0a1,7 > chr1 10 20 a1 255 + 10 20 0,0,0 1 10, 0, > . -1 -1 FCC1MK2ACXX:1:1101:5780:51632#/1 0 . -1 -1 -1 0,0,0 0 . . > . -1 -1 FCC1MK2ACXX:1:1101:5780:51632#/2 0 . -1 -1 -1 0,0,0 0 . . > . -1 -1 FCC1MK2ACXX:1:1101:8137:99409#/1 0 . -1 -1 -1 0,0,0 0 . . > . -1 -1 FCC1MK2ACXX:1:1101:8137:99409#/2 0 . -1 -1 -1 0,0,0 0 . . > . -1 -1 FCC1MK2ACXX:1:1102:6799:2633#/1 0 . -1 -1 -1 0,0,0 0 . . > . -1 -1 FCC1MK2ACXX:1:1102:6799:2633#/2 0 . -1 -1 -1 0,0,0 0 . . fail intersect.new.t19...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 232: 15544 Aborted $BT intersect -a oneUnmapped.bam -b j1.bed -bed > obs 0a1 > chr1 98650 98704 FCC1MK2ACXX:1:1212:13841:9775#/1 0 + 98604 98704 0,0,0 1 100, 0, fail intersect.new.t20...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 243: 15547 Aborted $BT intersect -a oneUnmapped.bam -b j1.bed -bed -v > obs 0a1 > chr1 -1 -1 FCC1MK2ACXX:1:1212:13841:9775#/2 0 . -1 -1 -1 0,0,0 0 . . fail intersect.new.t20.b...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 254: 15551 Aborted $BT intersect -a queryUnmappedMateMappedCoordsInvalid.bam -b j1.bed -bed > obs ok intersect.new.t20.c...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 264: 15554 Aborted $BT intersect -a queryUnmappedMateMappedCoordsInvalid.bam -b j1.bed -bed -v > obs 0a1 > . -1 -1 TTTACCTTT:4FSQ5P1:286:D2GA7ACXX:6:2316:20858:89646 0 . -1 -1 -1 0,0,0 0 . . fail intersect.new.t21...\c ok intersect.new.t22...\c ok intersect.new.t23...\c ok intersect.new.t24...\c ok intersect.new.t25...\c ok intersect.new.t26...\c ok intersect.new.t27...\c ok intersect.new.t28...\c ok intersect.new.t29...\c ok intersect.new.t30...\c ok intersect.new.t31...\c ok intersect.new.t32...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 422: 15596 Aborted $BT intersect -a a_withLargeHeader_bgzipped.bed.gz -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t33...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 434: 15599 Aborted $BT intersect -a - -b b.bed < a_withLargeHeader_bgzipped.bed.gz > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t34...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 446: 15602 Done cat a_withLargeHeader_bgzipped.bed.gz 15603 Aborted | $BT intersect -a - -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t35...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 458: 15607 Aborted $BT intersect -a <(cat a_withLargeHeader_bgzipped.bed.gz) -b b.bed > obs 0a1,2 > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t36...\c ok intersect.new.t37...\c ok intersect.new.t38...\c ok intersect.new.t39...\c ok intersect.new.t40...\c ok intersect.new.t41...\c ok intersect.new.t42...\c ok intersect.new.t43...\c ok intersect.new.t44...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 548: 15641 Aborted $BT intersect -a a_withLargeHeader_bgzipped.bed.gz -b b.bed -header > obs 0a1,4002 > # This is line 0 of a file with a large header. > # This is line 1 of a file with a large header. > # This is line 2 of a file with a large header. > # This is line 3 of a file with a large header. > # This is line 4 of a file with a large header. > # This is line 5 of a file with a large header. > # This is line 6 of a file with a large header. > # This is line 7 of a file with a large header. > # This is line 8 of a file with a large header. > # This is line 9 of a file with a large header. > # This is line 10 of a file with a large header. > # This is line 11 of a file with a large header. > # This is line 12 of a file with a large header. > # This is line 13 of a file with a large header. > # This is line 14 of a file with a large header. > # This is line 15 of a file with a large header. > # This is line 16 of a file with a large header. > # This is line 17 of a file with a large header. > # This is line 18 of a file with a large header. > # This is line 19 of a file with a large header. > # This is line 20 of a file with a large header. > # This is line 21 of a file with a large header. > # This is line 22 of a file with a large header. > # This is line 23 of a file with a large header. > # This is line 24 of a file with a large header. > # This is line 25 of a file with a large header. > # This is line 26 of a file with a large header. > # This is line 27 of a file with a large header. > # This is line 28 of a file with a large header. > # This is line 29 of a file with a large header. > # This is line 30 of a file with a large header. > # This is line 31 of a file with a large header. > # This is line 32 of a file with a large header. > # This is line 33 of a file with a large header. > # This is line 34 of a file with a large header. > # This is line 35 of a file with a large header. > # This is line 36 of a file with a large header. > # This is line 37 of a file with a large header. > # This is line 38 of a file with a large header. > # This is line 39 of a file with a large header. > # This is line 40 of a file with a large header. > # This is line 41 of a file with a large header. > # This is line 42 of a file with a large header. > # This is line 43 of a file with a large header. > # This is line 44 of a file with a large header. > # This is line 45 of a file with a large header. > # This is line 46 of a file with a large header. > # This is line 47 of a file with a large header. > # This is line 48 of a file with a large header. > # This is line 49 of a file with a large header. > # This is line 50 of a file with a large header. > # This is line 51 of a file with a large header. > # This is line 52 of a file with a large header. > # This is line 53 of a file with a large header. > # This is line 54 of a file with a large header. > # This is line 55 of a file with a large header. > # This is line 56 of a file with a large header. > # This is line 57 of a file with a large header. > # This is line 58 of a file with a large header. > # This is line 59 of a file with a large header. > # This is line 60 of a file with a large header. > # This is line 61 of a file with a large header. > # This is line 62 of a file with a large header. > # This is line 63 of a file with a large header. > # This is line 64 of a file with a large header. > # This is line 65 of a file with a large header. > # This is line 66 of a file with a large header. > # This is line 67 of a file with a large header. > # This is line 68 of a file with a large header. > # This is line 69 of a file with a large header. > # This is line 70 of a file with a large header. > # This is line 71 of a file with a large header. > # This is line 72 of a file with a large header. > # This is line 73 of a file with a large header. > # This is line 74 of a file with a large header. > # This is line 75 of a file with a large header. > # This is line 76 of a file with a large header. > # This is line 77 of a file with a large header. > # This is line 78 of a file with a large header. > # This is line 79 of a file with a large header. > # This is line 80 of a file with a large header. > # This is line 81 of a file with a large header. > # This is line 82 of a file with a large header. > # This is line 83 of a file with a large header. > # This is line 84 of a file with a large header. > # This is line 85 of a file with a large header. > # This is line 86 of a file with a large header. > # This is line 87 of a file with a large header. > # This is line 88 of a file with a large header. > # This is line 89 of a file with a large header. > # This is line 90 of a file with a large header. > # This is line 91 of a file with a large header. > # This is line 92 of a file with a large header. > # This is line 93 of a file with a large header. > # This is line 94 of a file with a large header. > # This is line 95 of a file with a large header. > # This is line 96 of a file with a large header. > # This is line 97 of a file with a large header. > # This is line 98 of a file with a large header. > # This is line 99 of a file with a large header. > # This is line 100 of a file with a large header. > # This is line 101 of a file with a large header. > # This is line 102 of a file with a large header. > # This is line 103 of a file with a large header. > # This is line 104 of a file with a large header. > # This is line 105 of a file with a large header. > # This is line 106 of a file with a large header. > # This is line 107 of a file with a large header. > # This is line 108 of a file with a large header. > # This is line 109 of a file with a large header. > # This is line 110 of a file with a large header. > # This is line 111 of a file with a large header. > # This is line 112 of a file with a large header. > # This is line 113 of a file with a large header. > # This is line 114 of a file with a large header. > # This is line 115 of a file with a large header. > # This is line 116 of a file with a large header. > # This is line 117 of a file with a large header. > # This is line 118 of a file with a large header. > # This is line 119 of a file with a large header. > # This is line 120 of a file with a large header. > # This is line 121 of a file with a large header. > # This is line 122 of a file with a large header. > # This is line 123 of a file with a large header. > # This is line 124 of a file with a large header. > # This is line 125 of a file with a large header. > # This is line 126 of a file with a large header. > # This is line 127 of a file with a large header. > # This is line 128 of a file with a large header. > # This is line 129 of a file with a large header. > # This is line 130 of a file with a large header. > # This is line 131 of a file with a large header. > # This is line 132 of a file with a large header. > # This is line 133 of a file with a large header. > # This is line 134 of a file with a large header. > # This is line 135 of a file with a large header. > # This is line 136 of a file with a large header. > # This is line 137 of a file with a large header. > # This is line 138 of a file with a large header. > # This is line 139 of a file with a large header. > # This is line 140 of a file with a large header. > # This is line 141 of a file with a large header. > # This is line 142 of a file with a large header. > # This is line 143 of a file with a large header. > # This is line 144 of a file with a large header. > # This is line 145 of a file with a large header. > # This is line 146 of a file with a large header. > # This is line 147 of a file with a large header. > # This is line 148 of a file with a large header. > # This is line 149 of a file with a large header. > # This is line 150 of a file with a large header. > # This is line 151 of a file with a large header. > # This is line 152 of a file with a large header. > # This is line 153 of a file with a large header. > # This is line 154 of a file with a large header. > # This is line 155 of a file with a large header. > # This is line 156 of a file with a large header. > # This is line 157 of a file with a large header. > # This is line 158 of a file with a large header. > # This is line 159 of a file with a large header. > # This is line 160 of a file with a large header. > # This is line 161 of a file with a large header. > # This is line 162 of a file with a large header. > # This is line 163 of a file with a large header. > # This is line 164 of a file with a large header. > # This is line 165 of a file with a large header. > # This is line 166 of a file with a large header. > # This is line 167 of a file with a large header. > # This is line 168 of a file with a large header. > # This is line 169 of a file with a large header. > # This is line 170 of a file with a large header. > # This is line 171 of a file with a large header. > # This is line 172 of a file with a large header. > # This is line 173 of a file with a large header. > # This is line 174 of a file with a large header. > # This is line 175 of a file with a large header. > # This is line 176 of a file with a large header. > # This is line 177 of a file with a large header. > # This is line 178 of a file with a large header. > # This is line 179 of a file with a large header. > # This is line 180 of a file with a large header. > # This is line 181 of a file with a large header. > # This is line 182 of a file with a large header. > # This is line 183 of a file with a large header. > # This is line 184 of a file with a large header. > # This is line 185 of a file with a large header. > # This is line 186 of a file with a large header. > # This is line 187 of a file with a large header. > # This is line 188 of a file with a large header. > # This is line 189 of a file with a large header. > # This is line 190 of a file with a large header. > # This is line 191 of a file with a large header. > # This is line 192 of a file with a large header. > # This is line 193 of a file with a large header. > # This is line 194 of a file with a large header. > # This is line 195 of a file with a large header. > # This is line 196 of a file with a large header. > # This is line 197 of a file with a large header. > # This is line 198 of a file with a large header. > # This is line 199 of a file with a large header. > # This is line 200 of a file with a large header. > # This is line 201 of a file with a large header. > # This is line 202 of a file with a large header. > # This is line 203 of a file with a large header. > # This is line 204 of a file with a large header. > # This is line 205 of a file with a large header. > # This is line 206 of a file with a large header. > # This is line 207 of a file with a large header. > # This is line 208 of a file with a large header. > # This is line 209 of a file with a large header. > # This is line 210 of a file with a large header. > # This is line 211 of a file with a large header. > # This is line 212 of a file with a large header. > # This is line 213 of a file with a large header. > # This is line 214 of a file with a large header. > # This is line 215 of a file with a large header. > # This is line 216 of a file with a large header. > # This is line 217 of a file with a large header. > # This is line 218 of a file with a large header. > # This is line 219 of a file with a large header. > # This is line 220 of a file with a large header. > # This is line 221 of a file with a large header. > # This is line 222 of a file with a large header. > # This is line 223 of a file with a large header. > # This is line 224 of a file with a large header. > # This is line 225 of a file with a large header. > # This is line 226 of a file with a large header. > # This is line 227 of a file with a large header. > # This is line 228 of a file with a large header. > # This is line 229 of a file with a large header. > # This is line 230 of a file with a large header. > # This is line 231 of a file with a large header. > # This is line 232 of a file with a large header. > # This is line 233 of a file with a large header. > # This is line 234 of a file with a large header. > # This is line 235 of a file with a large header. > # This is line 236 of a file with a large header. > # This is line 237 of a file with a large header. > # This is line 238 of a file with a large header. > # This is line 239 of a file with a large header. > # This is line 240 of a file with a large header. > # This is line 241 of a file with a large header. > # This is line 242 of a file with a large header. > # This is line 243 of a file with a large header. > # This is line 244 of a file with a large header. > # This is line 245 of a file with a large header. > # This is line 246 of a file with a large header. > # This is line 247 of a file with a large header. > # This is line 248 of a file with a large header. > # This is line 249 of a file with a large header. > # This is line 250 of a file with a large header. > # This is line 251 of a file with a large header. > # This is line 252 of a file with a large header. > # This is line 253 of a file with a large header. > # This is line 254 of a file with a large header. > # This is line 255 of a file with a large header. > # This is line 256 of a file with a large header. > # This is line 257 of a file with a large header. > # This is line 258 of a file with a large header. > # This is line 259 of a file with a large header. > # This is line 260 of a file with a large header. > # This is line 261 of a file with a large header. > # This is line 262 of a file with a large header. > # This is line 263 of a file with a large header. > # This is line 264 of a file with a large header. > # This is line 265 of a file with a large header. > # This is line 266 of a file with a large header. > # This is line 267 of a file with a large header. > # This is line 268 of a file with a large header. > # This is line 269 of a file with a large header. > # This is line 270 of a file with a large header. > # This is line 271 of a file with a large header. > # This is line 272 of a file with a large header. > # This is line 273 of a file with a large header. > # This is line 274 of a file with a large header. > # This is line 275 of a file with a large header. > # This is line 276 of a file with a large header. > # This is line 277 of a file with a large header. > # This is line 278 of a file with a large header. > # This is line 279 of a file with a large header. > # This is line 280 of a file with a large header. > # This is line 281 of a file with a large header. > # This is line 282 of a file with a large header. > # This is line 283 of a file with a large header. > # This is line 284 of a file with a large header. > # This is line 285 of a file with a large header. > # This is line 286 of a file with a large header. > # This is line 287 of a file with a large header. > # This is line 288 of a file with a large header. > # This is line 289 of a file with a large header. > # This is line 290 of a file with a large header. > # This is line 291 of a file with a large header. > # This is line 292 of a file with a large header. > # This is line 293 of a file with a large header. > # This is line 294 of a file with a large header. > # This is line 295 of a file with a large header. > # This is line 296 of a file with a large header. > # This is line 297 of a file with a large header. > # This is line 298 of a file with a large header. > # This is line 299 of a file with a large header. > # This is line 300 of a file with a large header. > # This is line 301 of a file with a large header. > # This is line 302 of a file with a large header. > # This is line 303 of a file with a large header. > # This is line 304 of a file with a large header. > # This is line 305 of a file with a large header. > # This is line 306 of a file with a large header. > # This is line 307 of a file with a large header. > # This is line 308 of a file with a large header. > # This is line 309 of a file with a large header. > # This is line 310 of a file with a large header. > # This is line 311 of a file with a large header. > # This is line 312 of a file with a large header. > # This is line 313 of a file with a large header. > # This is line 314 of a file with a large header. > # This is line 315 of a file with a large header. > # This is line 316 of a file with a large header. > # This is line 317 of a file with a large header. > # This is line 318 of a file with a large header. > # This is line 319 of a file with a large header. > # This is line 320 of a file with a large header. > # This is line 321 of a file with a large header. > # This is line 322 of a file with a large header. > # This is line 323 of a file with a large header. > # This is line 324 of a file with a large header. > # This is line 325 of a file with a large header. > # This is line 326 of a file with a large header. > # This is line 327 of a file with a large header. > # This is line 328 of a file with a large header. > # This is line 329 of a file with a large header. > # This is line 330 of a file with a large header. > # This is line 331 of a file with a large header. > # This is line 332 of a file with a large header. > # This is line 333 of a file with a large header. > # This is line 334 of a file with a large header. > # This is line 335 of a file with a large header. > # This is line 336 of a file with a large header. > # This is line 337 of a file with a large header. > # This is line 338 of a file with a large header. > # This is line 339 of a file with a large header. > # This is line 340 of a file with a large header. > # This is line 341 of a file with a large header. > # This is line 342 of a file with a large header. > # This is line 343 of a file with a large header. > # This is line 344 of a file with a large header. > # This is line 345 of a file with a large header. > # This is line 346 of a file with a large header. > # This is line 347 of a file with a large header. > # This is line 348 of a file with a large header. > # This is line 349 of a file with a large header. > # This is line 350 of a file with a large header. > # This is line 351 of a file with a large header. > # This is line 352 of a file with a large header. > # This is line 353 of a file with a large header. > # This is line 354 of a file with a large header. > # This is line 355 of a file with a large header. > # This is line 356 of a file with a large header. > # This is line 357 of a file with a large header. > # This is line 358 of a file with a large header. > # This is line 359 of a file with a large header. > # This is line 360 of a file with a large header. > # This is line 361 of a file with a large header. > # This is line 362 of a file with a large header. > # This is line 363 of a file with a large header. > # This is line 364 of a file with a large header. > # This is line 365 of a file with a large header. > # This is line 366 of a file with a large header. > # This is line 367 of a file with a large header. > # This is line 368 of a file with a large header. > # This is line 369 of a file with a large header. > # This is line 370 of a file with a large header. > # This is line 371 of a file with a large header. > # This is line 372 of a file with a large header. > # This is line 373 of a file with a large header. > # This is line 374 of a file with a large header. > # This is line 375 of a file with a large header. > # This is line 376 of a file with a large header. > # This is line 377 of a file with a large header. > # This is line 378 of a file with a large header. > # This is line 379 of a file with a large header. > # This is line 380 of a file with a large header. > # This is line 381 of a file with a large header. > # This is line 382 of a file with a large header. > # This is line 383 of a file with a large header. > # This is line 384 of a file with a large header. > # This is line 385 of a file with a large header. > # This is line 386 of a file with a large header. > # This is line 387 of a file with a large header. > # This is line 388 of a file with a large header. > # This is line 389 of a file with a large header. > # This is line 390 of a file with a large header. > # This is line 391 of a file with a large header. > # This is line 392 of a file with a large header. > # This is line 393 of a file with a large header. > # This is line 394 of a file with a large header. > # This is line 395 of a file with a large header. > # This is line 396 of a file with a large header. > # This is line 397 of a file with a large header. > # This is line 398 of a file with a large header. > # This is line 399 of a file with a large header. > # This is line 400 of a file with a large header. > # This is line 401 of a file with a large header. > # This is line 402 of a file with a large header. > # This is line 403 of a file with a large header. > # This is line 404 of a file with a large header. > # This is line 405 of a file with a large header. > # This is line 406 of a file with a large header. > # This is line 407 of a file with a large header. > # This is line 408 of a file with a large header. > # This is line 409 of a file with a large header. > # This is line 410 of a file with a large header. > # This is line 411 of a file with a large header. > # This is line 412 of a file with a large header. > # This is line 413 of a file with a large header. > # This is line 414 of a file with a large header. > # This is line 415 of a file with a large header. > # This is line 416 of a file with a large header. > # This is line 417 of a file with a large header. > # This is line 418 of a file with a large header. > # This is line 419 of a file with a large header. > # This is line 420 of a file with a large header. > # This is line 421 of a file with a large header. > # This is line 422 of a file with a large header. > # This is line 423 of a file with a large header. > # This is line 424 of a file with a large header. > # This is line 425 of a file with a large header. > # This is line 426 of a file with a large header. > # This is line 427 of a file with a large header. > # This is line 428 of a file with a large header. > # This is line 429 of a file with a large header. > # This is line 430 of a file with a large header. > # This is line 431 of a file with a large header. > # This is line 432 of a file with a large header. > # This is line 433 of a file with a large header. > # This is line 434 of a file with a large header. > # This is line 435 of a file with a large header. > # This is line 436 of a file with a large header. > # This is line 437 of a file with a large header. > # This is line 438 of a file with a large header. > # This is line 439 of a file with a large header. > # This is line 440 of a file with a large header. > # This is line 441 of a file with a large header. > # This is line 442 of a file with a large header. > # This is line 443 of a file with a large header. > # This is line 444 of a file with a large header. > # This is line 445 of a file with a large header. > # This is line 446 of a file with a large header. > # This is line 447 of a file with a large header. > # This is line 448 of a file with a large header. > # This is line 449 of a file with a large header. > # This is line 450 of a file with a large header. > # This is line 451 of a file with a large header. > # This is line 452 of a file with a large header. > # This is line 453 of a file with a large header. > # This is line 454 of a file with a large header. > # This is line 455 of a file with a large header. > # This is line 456 of a file with a large header. > # This is line 457 of a file with a large header. > # This is line 458 of a file with a large header. > # This is line 459 of a file with a large header. > # This is line 460 of a file with a large header. > # This is line 461 of a file with a large header. > # This is line 462 of a file with a large header. > # This is line 463 of a file with a large header. > # This is line 464 of a file with a large header. > # This is line 465 of a file with a large header. > # This is line 466 of a file with a large header. > # This is line 467 of a file with a large header. > # This is line 468 of a file with a large header. > # This is line 469 of a file with a large header. > # This is line 470 of a file with a large header. > # This is line 471 of a file with a large header. > # This is line 472 of a file with a large header. > # This is line 473 of a file with a large header. > # This is line 474 of a file with a large header. > # This is line 475 of a file with a large header. > # This is line 476 of a file with a large header. > # This is line 477 of a file with a large header. > # This is line 478 of a file with a large header. > # This is line 479 of a file with a large header. > # This is line 480 of a file with a large header. > # This is line 481 of a file with a large header. > # This is line 482 of a file with a large header. > # This is line 483 of a file with a large header. > # This is line 484 of a file with a large header. > # This is line 485 of a file with a large header. > # This is line 486 of a file with a large header. > # This is line 487 of a file with a large header. > # This is line 488 of a file with a large header. > # This is line 489 of a file with a large header. > # This is line 490 of a file with a large header. > # This is line 491 of a file with a large header. > # This is line 492 of a file with a large header. > # This is line 493 of a file with a large header. > # This is line 494 of a file with a large header. > # This is line 495 of a file with a large header. > # This is line 496 of a file with a large header. > # This is line 497 of a file with a large header. > # This is line 498 of a file with a large header. > # This is line 499 of a file with a large header. > # This is line 500 of a file with a large header. > # This is line 501 of a file with a large header. > # This is line 502 of a file with a large header. > # This is line 503 of a file with a large header. > # This is line 504 of a file with a large header. > # This is line 505 of a file with a large header. > # This is line 506 of a file with a large header. > # This is line 507 of a file with a large header. > # This is line 508 of a file with a large header. > # This is line 509 of a file with a large header. > # This is line 510 of a file with a large header. > # This is line 511 of a file with a large header. > # This is line 512 of a file with a large header. > # This is line 513 of a file with a large header. > # This is line 514 of a file with a large header. > # This is line 515 of a file with a large header. > # This is line 516 of a file with a large header. > # This is line 517 of a file with a large header. > # This is line 518 of a file with a large header. > # This is line 519 of a file with a large header. > # This is line 520 of a file with a large header. > # This is line 521 of a file with a large header. > # This is line 522 of a file with a large header. > # This is line 523 of a file with a large header. > # This is line 524 of a file with a large header. > # This is line 525 of a file with a large header. > # This is line 526 of a file with a large header. > # This is line 527 of a file with a large header. > # This is line 528 of a file with a large header. > # This is line 529 of a file with a large header. > # This is line 530 of a file with a large header. > # This is line 531 of a file with a large header. > # This is line 532 of a file with a large header. > # This is line 533 of a file with a large header. > # This is line 534 of a file with a large header. > # This is line 535 of a file with a large header. > # This is line 536 of a file with a large header. > # This is line 537 of a file with a large header. > # This is line 538 of a file with a large header. > # This is line 539 of a file with a large header. > # This is line 540 of a file with a large header. > # This is line 541 of a file with a large header. > # This is line 542 of a file with a large header. > # This is line 543 of a file with a large header. > # This is line 544 of a file with a large header. > # This is line 545 of a file with a large header. > # This is line 546 of a file with a large header. > # This is line 547 of a file with a large header. > # This is line 548 of a file with a large header. > # This is line 549 of a file with a large header. > # This is line 550 of a file with a large header. > # This is line 551 of a file with a large header. > # This is line 552 of a file with a large header. > # This is line 553 of a file with a large header. > # This is line 554 of a file with a large header. > # This is line 555 of a file with a large header. > # This is line 556 of a file with a large header. > # This is line 557 of a file with a large header. > # This is line 558 of a file with a large header. > # This is line 559 of a file with a large header. > # This is line 560 of a file with a large header. > # This is line 561 of a file with a large header. > # This is line 562 of a file with a large header. > # This is line 563 of a file with a large header. > # This is line 564 of a file with a large header. > # This is line 565 of a file with a large header. > # This is line 566 of a file with a large header. > # This is line 567 of a file with a large header. > # This is line 568 of a file with a large header. > # This is line 569 of a file with a large header. > # This is line 570 of a file with a large header. > # This is line 571 of a file with a large header. > # This is line 572 of a file with a large header. > # This is line 573 of a file with a large header. > # This is line 574 of a file with a large header. > # This is line 575 of a file with a large header. > # This is line 576 of a file with a large header. > # This is line 577 of a file with a large header. > # This is line 578 of a file with a large header. > # This is line 579 of a file with a large header. > # This is line 580 of a file with a large header. > # This is line 581 of a file with a large header. > # This is line 582 of a file with a large header. > # This is line 583 of a file with a large header. > # This is line 584 of a file with a large header. > # This is line 585 of a file with a large header. > # This is line 586 of a file with a large header. > # This is line 587 of a file with a large header. > # This is line 588 of a file with a large header. > # This is line 589 of a file with a large header. > # This is line 590 of a file with a large header. > # This is line 591 of a file with a large header. > # This is line 592 of a file with a large header. > # This is line 593 of a file with a large header. > # This is line 594 of a file with a large header. > # This is line 595 of a file with a large header. > # This is line 596 of a file with a large header. > # This is line 597 of a file with a large header. > # This is line 598 of a file with a large header. > # This is line 599 of a file with a large header. > # This is line 600 of a file with a large header. > # This is line 601 of a file with a large header. > # This is line 602 of a file with a large header. > # This is line 603 of a file with a large header. > # This is line 604 of a file with a large header. > # This is line 605 of a file with a large header. > # This is line 606 of a file with a large header. > # This is line 607 of a file with a large header. > # This is line 608 of a file with a large header. > # This is line 609 of a file with a large header. > # This is line 610 of a file with a large header. > # This is line 611 of a file with a large header. > # This is line 612 of a file with a large header. > # This is line 613 of a file with a large header. > # This is line 614 of a file with a large header. > # This is line 615 of a file with a large header. > # This is line 616 of a file with a large header. > # This is line 617 of a file with a large header. > # This is line 618 of a file with a large header. > # This is line 619 of a file with a large header. > # This is line 620 of a file with a large header. > # This is line 621 of a file with a large header. > # This is line 622 of a file with a large header. > # This is line 623 of a file with a large header. > # This is line 624 of a file with a large header. > # This is line 625 of a file with a large header. > # This is line 626 of a file with a large header. > # This is line 627 of a file with a large header. > # This is line 628 of a file with a large header. > # This is line 629 of a file with a large header. > # This is line 630 of a file with a large header. > # This is line 631 of a file with a large header. > # This is line 632 of a file with a large header. > # This is line 633 of a file with a large header. > # This is line 634 of a file with a large header. > # This is line 635 of a file with a large header. > # This is line 636 of a file with a large header. > # This is line 637 of a file with a large header. > # This is line 638 of a file with a large header. > # This is line 639 of a file with a large header. > # This is line 640 of a file with a large header. > # This is line 641 of a file with a large header. > # This is line 642 of a file with a large header. > # This is line 643 of a file with a large header. > # This is line 644 of a file with a large header. > # This is line 645 of a file with a large header. > # This is line 646 of a file with a large header. > # This is line 647 of a file with a large header. > # This is line 648 of a file with a large header. > # This is line 649 of a file with a large header. > # This is line 650 of a file with a large header. > # This is line 651 of a file with a large header. > # This is line 652 of a file with a large header. > # This is line 653 of a file with a large header. > # This is line 654 of a file with a large header. > # This is line 655 of a file with a large header. > # This is line 656 of a file with a large header. > # This is line 657 of a file with a large header. > # This is line 658 of a file with a large header. > # This is line 659 of a file with a large header. > # This is line 660 of a file with a large header. > # This is line 661 of a file with a large header. > # This is line 662 of a file with a large header. > # This is line 663 of a file with a large header. > # This is line 664 of a file with a large header. > # This is line 665 of a file with a large header. > # This is line 666 of a file with a large header. > # This is line 667 of a file with a large header. > # This is line 668 of a file with a large header. > # This is line 669 of a file with a large header. > # This is line 670 of a file with a large header. > # This is line 671 of a file with a large header. > # This is line 672 of a file with a large header. > # This is line 673 of a file with a large header. > # This is line 674 of a file with a large header. > # This is line 675 of a file with a large header. > # This is line 676 of a file with a large header. > # This is line 677 of a file with a large header. > # This is line 678 of a file with a large header. > # This is line 679 of a file with a large header. > # This is line 680 of a file with a large header. > # This is line 681 of a file with a large header. > # This is line 682 of a file with a large header. > # This is line 683 of a file with a large header. > # This is line 684 of a file with a large header. > # This is line 685 of a file with a large header. > # This is line 686 of a file with a large header. > # This is line 687 of a file with a large header. > # This is line 688 of a file with a large header. > # This is line 689 of a file with a large header. > # This is line 690 of a file with a large header. > # This is line 691 of a file with a large header. > # This is line 692 of a file with a large header. > # This is line 693 of a file with a large header. > # This is line 694 of a file with a large header. > # This is line 695 of a file with a large header. > # This is line 696 of a file with a large header. > # This is line 697 of a file with a large header. > # This is line 698 of a file with a large header. > # This is line 699 of a file with a large header. > # This is line 700 of a file with a large header. > # This is line 701 of a file with a large header. > # This is line 702 of a file with a large header. > # This is line 703 of a file with a large header. > # This is line 704 of a file with a large header. > # This is line 705 of a file with a large header. > # This is line 706 of a file with a large header. > # This is line 707 of a file with a large header. > # This is line 708 of a file with a large header. > # This is line 709 of a file with a large header. > # This is line 710 of a file with a large header. > # This is line 711 of a file with a large header. > # This is line 712 of a file with a large header. > # This is line 713 of a file with a large header. > # This is line 714 of a file with a large header. > # This is line 715 of a file with a large header. > # This is line 716 of a file with a large header. > # This is line 717 of a file with a large header. > # This is line 718 of a file with a large header. > # This is line 719 of a file with a large header. > # This is line 720 of a file with a large header. > # This is line 721 of a file with a large header. > # This is line 722 of a file with a large header. > # This is line 723 of a file with a large header. > # This is line 724 of a file with a large header. > # This is line 725 of a file with a large header. > # This is line 726 of a file with a large header. > # This is line 727 of a file with a large header. > # This is line 728 of a file with a large header. > # This is line 729 of a file with a large header. > # This is line 730 of a file with a large header. > # This is line 731 of a file with a large header. > # This is line 732 of a file with a large header. > # This is line 733 of a file with a large header. > # This is line 734 of a file with a large header. > # This is line 735 of a file with a large header. > # This is line 736 of a file with a large header. > # This is line 737 of a file with a large header. > # This is line 738 of a file with a large header. > # This is line 739 of a file with a large header. > # This is line 740 of a file with a large header. > # This is line 741 of a file with a large header. > # This is line 742 of a file with a large header. > # This is line 743 of a file with a large header. > # This is line 744 of a file with a large header. > # This is line 745 of a file with a large header. > # This is line 746 of a file with a large header. > # This is line 747 of a file with a large header. > # This is line 748 of a file with a large header. > # This is line 749 of a file with a large header. > # This is line 750 of a file with a large header. > # This is line 751 of a file with a large header. > # This is line 752 of a file with a large header. > # This is line 753 of a file with a large header. > # This is line 754 of a file with a large header. > # This is line 755 of a file with a large header. > # This is line 756 of a file with a large header. > # This is line 757 of a file with a large header. > # This is line 758 of a file with a large header. > # This is line 759 of a file with a large header. > # This is line 760 of a file with a large header. > # This is line 761 of a file with a large header. > # This is line 762 of a file with a large header. > # This is line 763 of a file with a large header. > # This is line 764 of a file with a large header. > # This is line 765 of a file with a large header. > # This is line 766 of a file with a large header. > # This is line 767 of a file with a large header. > # This is line 768 of a file with a large header. > # This is line 769 of a file with a large header. > # This is line 770 of a file with a large header. > # This is line 771 of a file with a large header. > # This is line 772 of a file with a large header. > # This is line 773 of a file with a large header. > # This is line 774 of a file with a large header. > # This is line 775 of a file with a large header. > # This is line 776 of a file with a large header. > # This is line 777 of a file with a large header. > # This is line 778 of a file with a large header. > # This is line 779 of a file with a large header. > # This is line 780 of a file with a large header. > # This is line 781 of a file with a large header. > # This is line 782 of a file with a large header. > # This is line 783 of a file with a large header. > # This is line 784 of a file with a large header. > # This is line 785 of a file with a large header. > # This is line 786 of a file with a large header. > # This is line 787 of a file with a large header. > # This is line 788 of a file with a large header. > # This is line 789 of a file with a large header. > # This is line 790 of a file with a large header. > # This is line 791 of a file with a large header. > # This is line 792 of a file with a large header. > # This is line 793 of a file with a large header. > # This is line 794 of a file with a large header. > # This is line 795 of a file with a large header. > # This is line 796 of a file with a large header. > # This is line 797 of a file with a large header. > # This is line 798 of a file with a large header. > # This is line 799 of a file with a large header. > # This is line 800 of a file with a large header. > # This is line 801 of a file with a large header. > # This is line 802 of a file with a large header. > # This is line 803 of a file with a large header. > # This is line 804 of a file with a large header. > # This is line 805 of a file with a large header. > # This is line 806 of a file with a large header. > # This is line 807 of a file with a large header. > # This is line 808 of a file with a large header. > # This is line 809 of a file with a large header. > # This is line 810 of a file with a large header. > # This is line 811 of a file with a large header. > # This is line 812 of a file with a large header. > # This is line 813 of a file with a large header. > # This is line 814 of a file with a large header. > # This is line 815 of a file with a large header. > # This is line 816 of a file with a large header. > # This is line 817 of a file with a large header. > # This is line 818 of a file with a large header. > # This is line 819 of a file with a large header. > # This is line 820 of a file with a large header. > # This is line 821 of a file with a large header. > # This is line 822 of a file with a large header. > # This is line 823 of a file with a large header. > # This is line 824 of a file with a large header. > # This is line 825 of a file with a large header. > # This is line 826 of a file with a large header. > # This is line 827 of a file with a large header. > # This is line 828 of a file with a large header. > # This is line 829 of a file with a large header. > # This is line 830 of a file with a large header. > # This is line 831 of a file with a large header. > # This is line 832 of a file with a large header. > # This is line 833 of a file with a large header. > # This is line 834 of a file with a large header. > # This is line 835 of a file with a large header. > # This is line 836 of a file with a large header. > # This is line 837 of a file with a large header. > # This is line 838 of a file with a large header. > # This is line 839 of a file with a large header. > # This is line 840 of a file with a large header. > # This is line 841 of a file with a large header. > # This is line 842 of a file with a large header. > # This is line 843 of a file with a large header. > # This is line 844 of a file with a large header. > # This is line 845 of a file with a large header. > # This is line 846 of a file with a large header. > # This is line 847 of a file with a large header. > # This is line 848 of a file with a large header. > # This is line 849 of a file with a large header. > # This is line 850 of a file with a large header. > # This is line 851 of a file with a large header. > # This is line 852 of a file with a large header. > # This is line 853 of a file with a large header. > # This is line 854 of a file with a large header. > # This is line 855 of a file with a large header. > # This is line 856 of a file with a large header. > # This is line 857 of a file with a large header. > # This is line 858 of a file with a large header. > # This is line 859 of a file with a large header. > # This is line 860 of a file with a large header. > # This is line 861 of a file with a large header. > # This is line 862 of a file with a large header. > # This is line 863 of a file with a large header. > # This is line 864 of a file with a large header. > # This is line 865 of a file with a large header. > # This is line 866 of a file with a large header. > # This is line 867 of a file with a large header. > # This is line 868 of a file with a large header. > # This is line 869 of a file with a large header. > # This is line 870 of a file with a large header. > # This is line 871 of a file with a large header. > # This is line 872 of a file with a large header. > # This is line 873 of a file with a large header. > # This is line 874 of a file with a large header. > # This is line 875 of a file with a large header. > # This is line 876 of a file with a large header. > # This is line 877 of a file with a large header. > # This is line 878 of a file with a large header. > # This is line 879 of a file with a large header. > # This is line 880 of a file with a large header. > # This is line 881 of a file with a large header. > # This is line 882 of a file with a large header. > # This is line 883 of a file with a large header. > # This is line 884 of a file with a large header. > # This is line 885 of a file with a large header. > # This is line 886 of a file with a large header. > # This is line 887 of a file with a large header. > # This is line 888 of a file with a large header. > # This is line 889 of a file with a large header. > # This is line 890 of a file with a large header. > # This is line 891 of a file with a large header. > # This is line 892 of a file with a large header. > # This is line 893 of a file with a large header. > # This is line 894 of a file with a large header. > # This is line 895 of a file with a large header. > # This is line 896 of a file with a large header. > # This is line 897 of a file with a large header. > # This is line 898 of a file with a large header. > # This is line 899 of a file with a large header. > # This is line 900 of a file with a large header. > # This is line 901 of a file with a large header. > # This is line 902 of a file with a large header. > # This is line 903 of a file with a large header. > # This is line 904 of a file with a large header. > # This is line 905 of a file with a large header. > # This is line 906 of a file with a large header. > # This is line 907 of a file with a large header. > # This is line 908 of a file with a large header. > # This is line 909 of a file with a large header. > # This is line 910 of a file with a large header. > # This is line 911 of a file with a large header. > # This is line 912 of a file with a large header. > # This is line 913 of a file with a large header. > # This is line 914 of a file with a large header. > # This is line 915 of a file with a large header. > # This is line 916 of a file with a large header. > # This is line 917 of a file with a large header. > # This is line 918 of a file with a large header. > # This is line 919 of a file with a large header. > # This is line 920 of a file with a large header. > # This is line 921 of a file with a large header. > # This is line 922 of a file with a large header. > # This is line 923 of a file with a large header. > # This is line 924 of a file with a large header. > # This is line 925 of a file with a large header. > # This is line 926 of a file with a large header. > # This is line 927 of a file with a large header. > # This is line 928 of a file with a large header. > # This is line 929 of a file with a large header. > # This is line 930 of a file with a large header. > # This is line 931 of a file with a large header. > # This is line 932 of a file with a large header. > # This is line 933 of a file with a large header. > # This is line 934 of a file with a large header. > # This is line 935 of a file with a large header. > # This is line 936 of a file with a large header. > # This is line 937 of a file with a large header. > # This is line 938 of a file with a large header. > # This is line 939 of a file with a large header. > # This is line 940 of a file with a large header. > # This is line 941 of a file with a large header. > # This is line 942 of a file with a large header. > # This is line 943 of a file with a large header. > # This is line 944 of a file with a large header. > # This is line 945 of a file with a large header. > # This is line 946 of a file with a large header. > # This is line 947 of a file with a large header. > # This is line 948 of a file with a large header. > # This is line 949 of a file with a large header. > # This is line 950 of a file with a large header. > # This is line 951 of a file with a large header. > # This is line 952 of a file with a large header. > # This is line 953 of a file with a large header. > # This is line 954 of a file with a large header. > # This is line 955 of a file with a large header. > # This is line 956 of a file with a large header. > # This is line 957 of a file with a large header. > # This is line 958 of a file with a large header. > # This is line 959 of a file with a large header. > # This is line 960 of a file with a large header. > # This is line 961 of a file with a large header. > # This is line 962 of a file with a large header. > # This is line 963 of a file with a large header. > # This is line 964 of a file with a large header. > # This is line 965 of a file with a large header. > # This is line 966 of a file with a large header. > # This is line 967 of a file with a large header. > # This is line 968 of a file with a large header. > # This is line 969 of a file with a large header. > # This is line 970 of a file with a large header. > # This is line 971 of a file with a large header. > # This is line 972 of a file with a large header. > # This is line 973 of a file with a large header. > # This is line 974 of a file with a large header. > # This is line 975 of a file with a large header. > # This is line 976 of a file with a large header. > # This is line 977 of a file with a large header. > # This is line 978 of a file with a large header. > # This is line 979 of a file with a large header. > # This is line 980 of a file with a large header. > # This is line 981 of a file with a large header. > # This is line 982 of a file with a large header. > # This is line 983 of a file with a large header. > # This is line 984 of a file with a large header. > # This is line 985 of a file with a large header. > # This is line 986 of a file with a large header. > # This is line 987 of a file with a large header. > # This is line 988 of a file with a large header. > # This is line 989 of a file with a large header. > # This is line 990 of a file with a large header. > # This is line 991 of a file with a large header. > # This is line 992 of a file with a large header. > # This is line 993 of a file with a large header. > # This is line 994 of a file with a large header. > # This is line 995 of a file with a large header. > # This is line 996 of a file with a large header. > # This is line 997 of a file with a large header. > # This is line 998 of a file with a large header. > # This is line 999 of a file with a large header. > # This is line 1000 of a file with a large header. > # This is line 1001 of a file with a large header. > # This is line 1002 of a file with a large header. > # This is line 1003 of a file with a large header. > # This is line 1004 of a file with a large header. > # This is line 1005 of a file with a large header. > # This is line 1006 of a file with a large header. > # This is line 1007 of a file with a large header. > # This is line 1008 of a file with a large header. > # This is line 1009 of a file with a large header. > # This is line 1010 of a file with a large header. > # This is line 1011 of a file with a large header. > # This is line 1012 of a file with a large header. > # This is line 1013 of a file with a large header. > # This is line 1014 of a file with a large header. > # This is line 1015 of a file with a large header. > # This is line 1016 of a file with a large header. > # This is line 1017 of a file with a large header. > # This is line 1018 of a file with a large header. > # This is line 1019 of a file with a large header. > # This is line 1020 of a file with a large header. > # This is line 1021 of a file with a large header. > # This is line 1022 of a file with a large header. > # This is line 1023 of a file with a large header. > # This is line 1024 of a file with a large header. > # This is line 1025 of a file with a large header. > # This is line 1026 of a file with a large header. > # This is line 1027 of a file with a large header. > # This is line 1028 of a file with a large header. > # This is line 1029 of a file with a large header. > # This is line 1030 of a file with a large header. > # This is line 1031 of a file with a large header. > # This is line 1032 of a file with a large header. > # This is line 1033 of a file with a large header. > # This is line 1034 of a file with a large header. > # This is line 1035 of a file with a large header. > # This is line 1036 of a file with a large header. > # This is line 1037 of a file with a large header. > # This is line 1038 of a file with a large header. > # This is line 1039 of a file with a large header. > # This is line 1040 of a file with a large header. > # This is line 1041 of a file with a large header. > # This is line 1042 of a file with a large header. > # This is line 1043 of a file with a large header. > # This is line 1044 of a file with a large header. > # This is line 1045 of a file with a large header. > # This is line 1046 of a file with a large header. > # This is line 1047 of a file with a large header. > # This is line 1048 of a file with a large header. > # This is line 1049 of a file with a large header. > # This is line 1050 of a file with a large header. > # This is line 1051 of a file with a large header. > # This is line 1052 of a file with a large header. > # This is line 1053 of a file with a large header. > # This is line 1054 of a file with a large header. > # This is line 1055 of a file with a large header. > # This is line 1056 of a file with a large header. > # This is line 1057 of a file with a large header. > # This is line 1058 of a file with a large header. > # This is line 1059 of a file with a large header. > # This is line 1060 of a file with a large header. > # This is line 1061 of a file with a large header. > # This is line 1062 of a file with a large header. > # This is line 1063 of a file with a large header. > # This is line 1064 of a file with a large header. > # This is line 1065 of a file with a large header. > # This is line 1066 of a file with a large header. > # This is line 1067 of a file with a large header. > # This is line 1068 of a file with a large header. > # This is line 1069 of a file with a large header. > # This is line 1070 of a file with a large header. > # This is line 1071 of a file with a large header. > # This is line 1072 of a file with a large header. > # This is line 1073 of a file with a large header. > # This is line 1074 of a file with a large header. > # This is line 1075 of a file with a large header. > # This is line 1076 of a file with a large header. > # This is line 1077 of a file with a large header. > # This is line 1078 of a file with a large header. > # This is line 1079 of a file with a large header. > # This is line 1080 of a file with a large header. > # This is line 1081 of a file with a large header. > # This is line 1082 of a file with a large header. > # This is line 1083 of a file with a large header. > # This is line 1084 of a file with a large header. > # This is line 1085 of a file with a large header. > # This is line 1086 of a file with a large header. > # This is line 1087 of a file with a large header. > # This is line 1088 of a file with a large header. > # This is line 1089 of a file with a large header. > # This is line 1090 of a file with a large header. > # This is line 1091 of a file with a large header. > # This is line 1092 of a file with a large header. > # This is line 1093 of a file with a large header. > # This is line 1094 of a file with a large header. > # This is line 1095 of a file with a large header. > # This is line 1096 of a file with a large header. > # This is line 1097 of a file with a large header. > # This is line 1098 of a file with a large header. > # This is line 1099 of a file with a large header. > # This is line 1100 of a file with a large header. > # This is line 1101 of a file with a large header. > # This is line 1102 of a file with a large header. > # This is line 1103 of a file with a large header. > # This is line 1104 of a file with a large header. > # This is line 1105 of a file with a large header. > # This is line 1106 of a file with a large header. > # This is line 1107 of a file with a large header. > # This is line 1108 of a file with a large header. > # This is line 1109 of a file with a large header. > # This is line 1110 of a file with a large header. > # This is line 1111 of a file with a large header. > # This is line 1112 of a file with a large header. > # This is line 1113 of a file with a large header. > # This is line 1114 of a file with a large header. > # This is line 1115 of a file with a large header. > # This is line 1116 of a file with a large header. > # This is line 1117 of a file with a large header. > # This is line 1118 of a file with a large header. > # This is line 1119 of a file with a large header. > # This is line 1120 of a file with a large header. > # This is line 1121 of a file with a large header. > # This is line 1122 of a file with a large header. > # This is line 1123 of a file with a large header. > # This is line 1124 of a file with a large header. > # This is line 1125 of a file with a large header. > # This is line 1126 of a file with a large header. > # This is line 1127 of a file with a large header. > # This is line 1128 of a file with a large header. > # This is line 1129 of a file with a large header. > # This is line 1130 of a file with a large header. > # This is line 1131 of a file with a large header. > # This is line 1132 of a file with a large header. > # This is line 1133 of a file with a large header. > # This is line 1134 of a file with a large header. > # This is line 1135 of a file with a large header. > # This is line 1136 of a file with a large header. > # This is line 1137 of a file with a large header. > # This is line 1138 of a file with a large header. > # This is line 1139 of a file with a large header. > # This is line 1140 of a file with a large header. > # This is line 1141 of a file with a large header. > # This is line 1142 of a file with a large header. > # This is line 1143 of a file with a large header. > # This is line 1144 of a file with a large header. > # This is line 1145 of a file with a large header. > # This is line 1146 of a file with a large header. > # This is line 1147 of a file with a large header. > # This is line 1148 of a file with a large header. > # This is line 1149 of a file with a large header. > # This is line 1150 of a file with a large header. > # This is line 1151 of a file with a large header. > # This is line 1152 of a file with a large header. > # This is line 1153 of a file with a large header. > # This is line 1154 of a file with a large header. > # This is line 1155 of a file with a large header. > # This is line 1156 of a file with a large header. > # This is line 1157 of a file with a large header. > # This is line 1158 of a file with a large header. > # This is line 1159 of a file with a large header. > # This is line 1160 of a file with a large header. > # This is line 1161 of a file with a large header. > # This is line 1162 of a file with a large header. > # This is line 1163 of a file with a large header. > # This is line 1164 of a file with a large header. > # This is line 1165 of a file with a large header. > # This is line 1166 of a file with a large header. > # This is line 1167 of a file with a large header. > # This is line 1168 of a file with a large header. > # This is line 1169 of a file with a large header. > # This is line 1170 of a file with a large header. > # This is line 1171 of a file with a large header. > # This is line 1172 of a file with a large header. > # This is line 1173 of a file with a large header. > # This is line 1174 of a file with a large header. > # This is line 1175 of a file with a large header. > # This is line 1176 of a file with a large header. > # This is line 1177 of a file with a large header. > # This is line 1178 of a file with a large header. > # This is line 1179 of a file with a large header. > # This is line 1180 of a file with a large header. > # This is line 1181 of a file with a large header. > # This is line 1182 of a file with a large header. > # This is line 1183 of a file with a large header. > # This is line 1184 of a file with a large header. > # This is line 1185 of a file with a large header. > # This is line 1186 of a file with a large header. > # This is line 1187 of a file with a large header. > # This is line 1188 of a file with a large header. > # This is line 1189 of a file with a large header. > # This is line 1190 of a file with a large header. > # This is line 1191 of a file with a large header. > # This is line 1192 of a file with a large header. > # This is line 1193 of a file with a large header. > # This is line 1194 of a file with a large header. > # This is line 1195 of a file with a large header. > # This is line 1196 of a file with a large header. > # This is line 1197 of a file with a large header. > # This is line 1198 of a file with a large header. > # This is line 1199 of a file with a large header. > # This is line 1200 of a file with a large header. > # This is line 1201 of a file with a large header. > # This is line 1202 of a file with a large header. > # This is line 1203 of a file with a large header. > # This is line 1204 of a file with a large header. > # This is line 1205 of a file with a large header. > # This is line 1206 of a file with a large header. > # This is line 1207 of a file with a large header. > # This is line 1208 of a file with a large header. > # This is line 1209 of a file with a large header. > # This is line 1210 of a file with a large header. > # This is line 1211 of a file with a large header. > # This is line 1212 of a file with a large header. > # This is line 1213 of a file with a large header. > # This is line 1214 of a file with a large header. > # This is line 1215 of a file with a large header. > # This is line 1216 of a file with a large header. > # This is line 1217 of a file with a large header. > # This is line 1218 of a file with a large header. > # This is line 1219 of a file with a large header. > # This is line 1220 of a file with a large header. > # This is line 1221 of a file with a large header. > # This is line 1222 of a file with a large header. > # This is line 1223 of a file with a large header. > # This is line 1224 of a file with a large header. > # This is line 1225 of a file with a large header. > # This is line 1226 of a file with a large header. > # This is line 1227 of a file with a large header. > # This is line 1228 of a file with a large header. > # This is line 1229 of a file with a large header. > # This is line 1230 of a file with a large header. > # This is line 1231 of a file with a large header. > # This is line 1232 of a file with a large header. > # This is line 1233 of a file with a large header. > # This is line 1234 of a file with a large header. > # This is line 1235 of a file with a large header. > # This is line 1236 of a file with a large header. > # This is line 1237 of a file with a large header. > # This is line 1238 of a file with a large header. > # This is line 1239 of a file with a large header. > # This is line 1240 of a file with a large header. > # This is line 1241 of a file with a large header. > # This is line 1242 of a file with a large header. > # This is line 1243 of a file with a large header. > # This is line 1244 of a file with a large header. > # This is line 1245 of a file with a large header. > # This is line 1246 of a file with a large header. > # This is line 1247 of a file with a large header. > # This is line 1248 of a file with a large header. > # This is line 1249 of a file with a large header. > # This is line 1250 of a file with a large header. > # This is line 1251 of a file with a large header. > # This is line 1252 of a file with a large header. > # This is line 1253 of a file with a large header. > # This is line 1254 of a file with a large header. > # This is line 1255 of a file with a large header. > # This is line 1256 of a file with a large header. > # This is line 1257 of a file with a large header. > # This is line 1258 of a file with a large header. > # This is line 1259 of a file with a large header. > # This is line 1260 of a file with a large header. > # This is line 1261 of a file with a large header. > # This is line 1262 of a file with a large header. > # This is line 1263 of a file with a large header. > # This is line 1264 of a file with a large header. > # This is line 1265 of a file with a large header. > # This is line 1266 of a file with a large header. > # This is line 1267 of a file with a large header. > # This is line 1268 of a file with a large header. > # This is line 1269 of a file with a large header. > # This is line 1270 of a file with a large header. > # This is line 1271 of a file with a large header. > # This is line 1272 of a file with a large header. > # This is line 1273 of a file with a large header. > # This is line 1274 of a file with a large header. > # This is line 1275 of a file with a large header. > # This is line 1276 of a file with a large header. > # This is line 1277 of a file with a large header. > # This is line 1278 of a file with a large header. > # This is line 1279 of a file with a large header. > # This is line 1280 of a file with a large header. > # This is line 1281 of a file with a large header. > # This is line 1282 of a file with a large header. > # This is line 1283 of a file with a large header. > # This is line 1284 of a file with a large header. > # This is line 1285 of a file with a large header. > # This is line 1286 of a file with a large header. > # This is line 1287 of a file with a large header. > # This is line 1288 of a file with a large header. > # This is line 1289 of a file with a large header. > # This is line 1290 of a file with a large header. > # This is line 1291 of a file with a large header. > # This is line 1292 of a file with a large header. > # This is line 1293 of a file with a large header. > # This is line 1294 of a file with a large header. > # This is line 1295 of a file with a large header. > # This is line 1296 of a file with a large header. > # This is line 1297 of a file with a large header. > # This is line 1298 of a file with a large header. > # This is line 1299 of a file with a large header. > # This is line 1300 of a file with a large header. > # This is line 1301 of a file with a large header. > # This is line 1302 of a file with a large header. > # This is line 1303 of a file with a large header. > # This is line 1304 of a file with a large header. > # This is line 1305 of a file with a large header. > # This is line 1306 of a file with a large header. > # This is line 1307 of a file with a large header. > # This is line 1308 of a file with a large header. > # This is line 1309 of a file with a large header. > # This is line 1310 of a file with a large header. > # This is line 1311 of a file with a large header. > # This is line 1312 of a file with a large header. > # This is line 1313 of a file with a large header. > # This is line 1314 of a file with a large header. > # This is line 1315 of a file with a large header. > # This is line 1316 of a file with a large header. > # This is line 1317 of a file with a large header. > # This is line 1318 of a file with a large header. > # This is line 1319 of a file with a large header. > # This is line 1320 of a file with a large header. > # This is line 1321 of a file with a large header. > # This is line 1322 of a file with a large header. > # This is line 1323 of a file with a large header. > # This is line 1324 of a file with a large header. > # This is line 1325 of a file with a large header. > # This is line 1326 of a file with a large header. > # This is line 1327 of a file with a large header. > # This is line 1328 of a file with a large header. > # This is line 1329 of a file with a large header. > # This is line 1330 of a file with a large header. > # This is line 1331 of a file with a large header. > # This is line 1332 of a file with a large header. > # This is line 1333 of a file with a large header. > # This is line 1334 of a file with a large header. > # This is line 1335 of a file with a large header. > # This is line 1336 of a file with a large header. > # This is line 1337 of a file with a large header. > # This is line 1338 of a file with a large header. > # This is line 1339 of a file with a large header. > # This is line 1340 of a file with a large header. > # This is line 1341 of a file with a large header. > # This is line 1342 of a file with a large header. > # This is line 1343 of a file with a large header. > # This is line 1344 of a file with a large header. > # This is line 1345 of a file with a large header. > # This is line 1346 of a file with a large header. > # This is line 1347 of a file with a large header. > # This is line 1348 of a file with a large header. > # This is line 1349 of a file with a large header. > # This is line 1350 of a file with a large header. > # This is line 1351 of a file with a large header. > # This is line 1352 of a file with a large header. > # This is line 1353 of a file with a large header. > # This is line 1354 of a file with a large header. > # This is line 1355 of a file with a large header. > # This is line 1356 of a file with a large header. > # This is line 1357 of a file with a large header. > # This is line 1358 of a file with a large header. > # This is line 1359 of a file with a large header. > # This is line 1360 of a file with a large header. > # This is line 1361 of a file with a large header. > # This is line 1362 of a file with a large header. > # This is line 1363 of a file with a large header. > # This is line 1364 of a file with a large header. > # This is line 1365 of a file with a large header. > # This is line 1366 of a file with a large header. > # This is line 1367 of a file with a large header. > # This is line 1368 of a file with a large header. > # This is line 1369 of a file with a large header. > # This is line 1370 of a file with a large header. > # This is line 1371 of a file with a large header. > # This is line 1372 of a file with a large header. > # This is line 1373 of a file with a large header. > # This is line 1374 of a file with a large header. > # This is line 1375 of a file with a large header. > # This is line 1376 of a file with a large header. > # This is line 1377 of a file with a large header. > # This is line 1378 of a file with a large header. > # This is line 1379 of a file with a large header. > # This is line 1380 of a file with a large header. > # This is line 1381 of a file with a large header. > # This is line 1382 of a file with a large header. > # This is line 1383 of a file with a large header. > # This is line 1384 of a file with a large header. > # This is line 1385 of a file with a large header. > # This is line 1386 of a file with a large header. > # This is line 1387 of a file with a large header. > # This is line 1388 of a file with a large header. > # This is line 1389 of a file with a large header. > # This is line 1390 of a file with a large header. > # This is line 1391 of a file with a large header. > # This is line 1392 of a file with a large header. > # This is line 1393 of a file with a large header. > # This is line 1394 of a file with a large header. > # This is line 1395 of a file with a large header. > # This is line 1396 of a file with a large header. > # This is line 1397 of a file with a large header. > # This is line 1398 of a file with a large header. > # This is line 1399 of a file with a large header. > # This is line 1400 of a file with a large header. > # This is line 1401 of a file with a large header. > # This is line 1402 of a file with a large header. > # This is line 1403 of a file with a large header. > # This is line 1404 of a file with a large header. > # This is line 1405 of a file with a large header. > # This is line 1406 of a file with a large header. > # This is line 1407 of a file with a large header. > # This is line 1408 of a file with a large header. > # This is line 1409 of a file with a large header. > # This is line 1410 of a file with a large header. > # This is line 1411 of a file with a large header. > # This is line 1412 of a file with a large header. > # This is line 1413 of a file with a large header. > # This is line 1414 of a file with a large header. > # This is line 1415 of a file with a large header. > # This is line 1416 of a file with a large header. > # This is line 1417 of a file with a large header. > # This is line 1418 of a file with a large header. > # This is line 1419 of a file with a large header. > # This is line 1420 of a file with a large header. > # This is line 1421 of a file with a large header. > # This is line 1422 of a file with a large header. > # This is line 1423 of a file with a large header. > # This is line 1424 of a file with a large header. > # This is line 1425 of a file with a large header. > # This is line 1426 of a file with a large header. > # This is line 1427 of a file with a large header. > # This is line 1428 of a file with a large header. > # This is line 1429 of a file with a large header. > # This is line 1430 of a file with a large header. > # This is line 1431 of a file with a large header. > # This is line 1432 of a file with a large header. > # This is line 1433 of a file with a large header. > # This is line 1434 of a file with a large header. > # This is line 1435 of a file with a large header. > # This is line 1436 of a file with a large header. > # This is line 1437 of a file with a large header. > # This is line 1438 of a file with a large header. > # This is line 1439 of a file with a large header. > # This is line 1440 of a file with a large header. > # This is line 1441 of a file with a large header. > # This is line 1442 of a file with a large header. > # This is line 1443 of a file with a large header. > # This is line 1444 of a file with a large header. > # This is line 1445 of a file with a large header. > # This is line 1446 of a file with a large header. > # This is line 1447 of a file with a large header. > # This is line 1448 of a file with a large header. > # This is line 1449 of a file with a large header. > # This is line 1450 of a file with a large header. > # This is line 1451 of a file with a large header. > # This is line 1452 of a file with a large header. > # This is line 1453 of a file with a large header. > # This is line 1454 of a file with a large header. > # This is line 1455 of a file with a large header. > # This is line 1456 of a file with a large header. > # This is line 1457 of a file with a large header. > # This is line 1458 of a file with a large header. > # This is line 1459 of a file with a large header. > # This is line 1460 of a file with a large header. > # This is line 1461 of a file with a large header. > # This is line 1462 of a file with a large header. > # This is line 1463 of a file with a large header. > # This is line 1464 of a file with a large header. > # This is line 1465 of a file with a large header. > # This is line 1466 of a file with a large header. > # This is line 1467 of a file with a large header. > # This is line 1468 of a file with a large header. > # This is line 1469 of a file with a large header. > # This is line 1470 of a file with a large header. > # This is line 1471 of a file with a large header. > # This is line 1472 of a file with a large header. > # This is line 1473 of a file with a large header. > # This is line 1474 of a file with a large header. > # This is line 1475 of a file with a large header. > # This is line 1476 of a file with a large header. > # This is line 1477 of a file with a large header. > # This is line 1478 of a file with a large header. > # This is line 1479 of a file with a large header. > # This is line 1480 of a file with a large header. > # This is line 1481 of a file with a large header. > # This is line 1482 of a file with a large header. > # This is line 1483 of a file with a large header. > # This is line 1484 of a file with a large header. > # This is line 1485 of a file with a large header. > # This is line 1486 of a file with a large header. > # This is line 1487 of a file with a large header. > # This is line 1488 of a file with a large header. > # This is line 1489 of a file with a large header. > # This is line 1490 of a file with a large header. > # This is line 1491 of a file with a large header. > # This is line 1492 of a file with a large header. > # This is line 1493 of a file with a large header. > # This is line 1494 of a file with a large header. > # This is line 1495 of a file with a large header. > # This is line 1496 of a file with a large header. > # This is line 1497 of a file with a large header. > # This is line 1498 of a file with a large header. > # This is line 1499 of a file with a large header. > # This is line 1500 of a file with a large header. > # This is line 1501 of a file with a large header. > # This is line 1502 of a file with a large header. > # This is line 1503 of a file with a large header. > # This is line 1504 of a file with a large header. > # This is line 1505 of a file with a large header. > # This is line 1506 of a file with a large header. > # This is line 1507 of a file with a large header. > # This is line 1508 of a file with a large header. > # This is line 1509 of a file with a large header. > # This is line 1510 of a file with a large header. > # This is line 1511 of a file with a large header. > # This is line 1512 of a file with a large header. > # This is line 1513 of a file with a large header. > # This is line 1514 of a file with a large header. > # This is line 1515 of a file with a large header. > # This is line 1516 of a file with a large header. > # This is line 1517 of a file with a large header. > # This is line 1518 of a file with a large header. > # This is line 1519 of a file with a large header. > # This is line 1520 of a file with a large header. > # This is line 1521 of a file with a large header. > # This is line 1522 of a file with a large header. > # This is line 1523 of a file with a large header. > # This is line 1524 of a file with a large header. > # This is line 1525 of a file with a large header. > # This is line 1526 of a file with a large header. > # This is line 1527 of a file with a large header. > # This is line 1528 of a file with a large header. > # This is line 1529 of a file with a large header. > # This is line 1530 of a file with a large header. > # This is line 1531 of a file with a large header. > # This is line 1532 of a file with a large header. > # This is line 1533 of a file with a large header. > # This is line 1534 of a file with a large header. > # This is line 1535 of a file with a large header. > # This is line 1536 of a file with a large header. > # This is line 1537 of a file with a large header. > # This is line 1538 of a file with a large header. > # This is line 1539 of a file with a large header. > # This is line 1540 of a file with a large header. > # This is line 1541 of a file with a large header. > # This is line 1542 of a file with a large header. > # This is line 1543 of a file with a large header. > # This is line 1544 of a file with a large header. > # This is line 1545 of a file with a large header. > # This is line 1546 of a file with a large header. > # This is line 1547 of a file with a large header. > # This is line 1548 of a file with a large header. > # This is line 1549 of a file with a large header. > # This is line 1550 of a file with a large header. > # This is line 1551 of a file with a large header. > # This is line 1552 of a file with a large header. > # This is line 1553 of a file with a large header. > # This is line 1554 of a file with a large header. > # This is line 1555 of a file with a large header. > # This is line 1556 of a file with a large header. > # This is line 1557 of a file with a large header. > # This is line 1558 of a file with a large header. > # This is line 1559 of a file with a large header. > # This is line 1560 of a file with a large header. > # This is line 1561 of a file with a large header. > # This is line 1562 of a file with a large header. > # This is line 1563 of a file with a large header. > # This is line 1564 of a file with a large header. > # This is line 1565 of a file with a large header. > # This is line 1566 of a file with a large header. > # This is line 1567 of a file with a large header. > # This is line 1568 of a file with a large header. > # This is line 1569 of a file with a large header. > # This is line 1570 of a file with a large header. > # This is line 1571 of a file with a large header. > # This is line 1572 of a file with a large header. > # This is line 1573 of a file with a large header. > # This is line 1574 of a file with a large header. > # This is line 1575 of a file with a large header. > # This is line 1576 of a file with a large header. > # This is line 1577 of a file with a large header. > # This is line 1578 of a file with a large header. > # This is line 1579 of a file with a large header. > # This is line 1580 of a file with a large header. > # This is line 1581 of a file with a large header. > # This is line 1582 of a file with a large header. > # This is line 1583 of a file with a large header. > # This is line 1584 of a file with a large header. > # This is line 1585 of a file with a large header. > # This is line 1586 of a file with a large header. > # This is line 1587 of a file with a large header. > # This is line 1588 of a file with a large header. > # This is line 1589 of a file with a large header. > # This is line 1590 of a file with a large header. > # This is line 1591 of a file with a large header. > # This is line 1592 of a file with a large header. > # This is line 1593 of a file with a large header. > # This is line 1594 of a file with a large header. > # This is line 1595 of a file with a large header. > # This is line 1596 of a file with a large header. > # This is line 1597 of a file with a large header. > # This is line 1598 of a file with a large header. > # This is line 1599 of a file with a large header. > # This is line 1600 of a file with a large header. > # This is line 1601 of a file with a large header. > # This is line 1602 of a file with a large header. > # This is line 1603 of a file with a large header. > # This is line 1604 of a file with a large header. > # This is line 1605 of a file with a large header. > # This is line 1606 of a file with a large header. > # This is line 1607 of a file with a large header. > # This is line 1608 of a file with a large header. > # This is line 1609 of a file with a large header. > # This is line 1610 of a file with a large header. > # This is line 1611 of a file with a large header. > # This is line 1612 of a file with a large header. > # This is line 1613 of a file with a large header. > # This is line 1614 of a file with a large header. > # This is line 1615 of a file with a large header. > # This is line 1616 of a file with a large header. > # This is line 1617 of a file with a large header. > # This is line 1618 of a file with a large header. > # This is line 1619 of a file with a large header. > # This is line 1620 of a file with a large header. > # This is line 1621 of a file with a large header. > # This is line 1622 of a file with a large header. > # This is line 1623 of a file with a large header. > # This is line 1624 of a file with a large header. > # This is line 1625 of a file with a large header. > # This is line 1626 of a file with a large header. > # This is line 1627 of a file with a large header. > # This is line 1628 of a file with a large header. > # This is line 1629 of a file with a large header. > # This is line 1630 of a file with a large header. > # This is line 1631 of a file with a large header. > # This is line 1632 of a file with a large header. > # This is line 1633 of a file with a large header. > # This is line 1634 of a file with a large header. > # This is line 1635 of a file with a large header. > # This is line 1636 of a file with a large header. > # This is line 1637 of a file with a large header. > # This is line 1638 of a file with a large header. > # This is line 1639 of a file with a large header. > # This is line 1640 of a file with a large header. > # This is line 1641 of a file with a large header. > # This is line 1642 of a file with a large header. > # This is line 1643 of a file with a large header. > # This is line 1644 of a file with a large header. > # This is line 1645 of a file with a large header. > # This is line 1646 of a file with a large header. > # This is line 1647 of a file with a large header. > # This is line 1648 of a file with a large header. > # This is line 1649 of a file with a large header. > # This is line 1650 of a file with a large header. > # This is line 1651 of a file with a large header. > # This is line 1652 of a file with a large header. > # This is line 1653 of a file with a large header. > # This is line 1654 of a file with a large header. > # This is line 1655 of a file with a large header. > # This is line 1656 of a file with a large header. > # This is line 1657 of a file with a large header. > # This is line 1658 of a file with a large header. > # This is line 1659 of a file with a large header. > # This is line 1660 of a file with a large header. > # This is line 1661 of a file with a large header. > # This is line 1662 of a file with a large header. > # This is line 1663 of a file with a large header. > # This is line 1664 of a file with a large header. > # This is line 1665 of a file with a large header. > # This is line 1666 of a file with a large header. > # This is line 1667 of a file with a large header. > # This is line 1668 of a file with a large header. > # This is line 1669 of a file with a large header. > # This is line 1670 of a file with a large header. > # This is line 1671 of a file with a large header. > # This is line 1672 of a file with a large header. > # This is line 1673 of a file with a large header. > # This is line 1674 of a file with a large header. > # This is line 1675 of a file with a large header. > # This is line 1676 of a file with a large header. > # This is line 1677 of a file with a large header. > # This is line 1678 of a file with a large header. > # This is line 1679 of a file with a large header. > # This is line 1680 of a file with a large header. > # This is line 1681 of a file with a large header. > # This is line 1682 of a file with a large header. > # This is line 1683 of a file with a large header. > # This is line 1684 of a file with a large header. > # This is line 1685 of a file with a large header. > # This is line 1686 of a file with a large header. > # This is line 1687 of a file with a large header. > # This is line 1688 of a file with a large header. > # This is line 1689 of a file with a large header. > # This is line 1690 of a file with a large header. > # This is line 1691 of a file with a large header. > # This is line 1692 of a file with a large header. > # This is line 1693 of a file with a large header. > # This is line 1694 of a file with a large header. > # This is line 1695 of a file with a large header. > # This is line 1696 of a file with a large header. > # This is line 1697 of a file with a large header. > # This is line 1698 of a file with a large header. > # This is line 1699 of a file with a large header. > # This is line 1700 of a file with a large header. > # This is line 1701 of a file with a large header. > # This is line 1702 of a file with a large header. > # This is line 1703 of a file with a large header. > # This is line 1704 of a file with a large header. > # This is line 1705 of a file with a large header. > # This is line 1706 of a file with a large header. > # This is line 1707 of a file with a large header. > # This is line 1708 of a file with a large header. > # This is line 1709 of a file with a large header. > # This is line 1710 of a file with a large header. > # This is line 1711 of a file with a large header. > # This is line 1712 of a file with a large header. > # This is line 1713 of a file with a large header. > # This is line 1714 of a file with a large header. > # This is line 1715 of a file with a large header. > # This is line 1716 of a file with a large header. > # This is line 1717 of a file with a large header. > # This is line 1718 of a file with a large header. > # This is line 1719 of a file with a large header. > # This is line 1720 of a file with a large header. > # This is line 1721 of a file with a large header. > # This is line 1722 of a file with a large header. > # This is line 1723 of a file with a large header. > # This is line 1724 of a file with a large header. > # This is line 1725 of a file with a large header. > # This is line 1726 of a file with a large header. > # This is line 1727 of a file with a large header. > # This is line 1728 of a file with a large header. > # This is line 1729 of a file with a large header. > # This is line 1730 of a file with a large header. > # This is line 1731 of a file with a large header. > # This is line 1732 of a file with a large header. > # This is line 1733 of a file with a large header. > # This is line 1734 of a file with a large header. > # This is line 1735 of a file with a large header. > # This is line 1736 of a file with a large header. > # This is line 1737 of a file with a large header. > # This is line 1738 of a file with a large header. > # This is line 1739 of a file with a large header. > # This is line 1740 of a file with a large header. > # This is line 1741 of a file with a large header. > # This is line 1742 of a file with a large header. > # This is line 1743 of a file with a large header. > # This is line 1744 of a file with a large header. > # This is line 1745 of a file with a large header. > # This is line 1746 of a file with a large header. > # This is line 1747 of a file with a large header. > # This is line 1748 of a file with a large header. > # This is line 1749 of a file with a large header. > # This is line 1750 of a file with a large header. > # This is line 1751 of a file with a large header. > # This is line 1752 of a file with a large header. > # This is line 1753 of a file with a large header. > # This is line 1754 of a file with a large header. > # This is line 1755 of a file with a large header. > # This is line 1756 of a file with a large header. > # This is line 1757 of a file with a large header. > # This is line 1758 of a file with a large header. > # This is line 1759 of a file with a large header. > # This is line 1760 of a file with a large header. > # This is line 1761 of a file with a large header. > # This is line 1762 of a file with a large header. > # This is line 1763 of a file with a large header. > # This is line 1764 of a file with a large header. > # This is line 1765 of a file with a large header. > # This is line 1766 of a file with a large header. > # This is line 1767 of a file with a large header. > # This is line 1768 of a file with a large header. > # This is line 1769 of a file with a large header. > # This is line 1770 of a file with a large header. > # This is line 1771 of a file with a large header. > # This is line 1772 of a file with a large header. > # This is line 1773 of a file with a large header. > # This is line 1774 of a file with a large header. > # This is line 1775 of a file with a large header. > # This is line 1776 of a file with a large header. > # This is line 1777 of a file with a large header. > # This is line 1778 of a file with a large header. > # This is line 1779 of a file with a large header. > # This is line 1780 of a file with a large header. > # This is line 1781 of a file with a large header. > # This is line 1782 of a file with a large header. > # This is line 1783 of a file with a large header. > # This is line 1784 of a file with a large header. > # This is line 1785 of a file with a large header. > # This is line 1786 of a file with a large header. > # This is line 1787 of a file with a large header. > # This is line 1788 of a file with a large header. > # This is line 1789 of a file with a large header. > # This is line 1790 of a file with a large header. > # This is line 1791 of a file with a large header. > # This is line 1792 of a file with a large header. > # This is line 1793 of a file with a large header. > # This is line 1794 of a file with a large header. > # This is line 1795 of a file with a large header. > # This is line 1796 of a file with a large header. > # This is line 1797 of a file with a large header. > # This is line 1798 of a file with a large header. > # This is line 1799 of a file with a large header. > # This is line 1800 of a file with a large header. > # This is line 1801 of a file with a large header. > # This is line 1802 of a file with a large header. > # This is line 1803 of a file with a large header. > # This is line 1804 of a file with a large header. > # This is line 1805 of a file with a large header. > # This is line 1806 of a file with a large header. > # This is line 1807 of a file with a large header. > # This is line 1808 of a file with a large header. > # This is line 1809 of a file with a large header. > # This is line 1810 of a file with a large header. > # This is line 1811 of a file with a large header. > # This is line 1812 of a file with a large header. > # This is line 1813 of a file with a large header. > # This is line 1814 of a file with a large header. > # This is line 1815 of a file with a large header. > # This is line 1816 of a file with a large header. > # This is line 1817 of a file with a large header. > # This is line 1818 of a file with a large header. > # This is line 1819 of a file with a large header. > # This is line 1820 of a file with a large header. > # This is line 1821 of a file with a large header. > # This is line 1822 of a file with a large header. > # This is line 1823 of a file with a large header. > # This is line 1824 of a file with a large header. > # This is line 1825 of a file with a large header. > # This is line 1826 of a file with a large header. > # This is line 1827 of a file with a large header. > # This is line 1828 of a file with a large header. > # This is line 1829 of a file with a large header. > # This is line 1830 of a file with a large header. > # This is line 1831 of a file with a large header. > # This is line 1832 of a file with a large header. > # This is line 1833 of a file with a large header. > # This is line 1834 of a file with a large header. > # This is line 1835 of a file with a large header. > # This is line 1836 of a file with a large header. > # This is line 1837 of a file with a large header. > # This is line 1838 of a file with a large header. > # This is line 1839 of a file with a large header. > # This is line 1840 of a file with a large header. > # This is line 1841 of a file with a large header. > # This is line 1842 of a file with a large header. > # This is line 1843 of a file with a large header. > # This is line 1844 of a file with a large header. > # This is line 1845 of a file with a large header. > # This is line 1846 of a file with a large header. > # This is line 1847 of a file with a large header. > # This is line 1848 of a file with a large header. > # This is line 1849 of a file with a large header. > # This is line 1850 of a file with a large header. > # This is line 1851 of a file with a large header. > # This is line 1852 of a file with a large header. > # This is line 1853 of a file with a large header. > # This is line 1854 of a file with a large header. > # This is line 1855 of a file with a large header. > # This is line 1856 of a file with a large header. > # This is line 1857 of a file with a large header. > # This is line 1858 of a file with a large header. > # This is line 1859 of a file with a large header. > # This is line 1860 of a file with a large header. > # This is line 1861 of a file with a large header. > # This is line 1862 of a file with a large header. > # This is line 1863 of a file with a large header. > # This is line 1864 of a file with a large header. > # This is line 1865 of a file with a large header. > # This is line 1866 of a file with a large header. > # This is line 1867 of a file with a large header. > # This is line 1868 of a file with a large header. > # This is line 1869 of a file with a large header. > # This is line 1870 of a file with a large header. > # This is line 1871 of a file with a large header. > # This is line 1872 of a file with a large header. > # This is line 1873 of a file with a large header. > # This is line 1874 of a file with a large header. > # This is line 1875 of a file with a large header. > # This is line 1876 of a file with a large header. > # This is line 1877 of a file with a large header. > # This is line 1878 of a file with a large header. > # This is line 1879 of a file with a large header. > # This is line 1880 of a file with a large header. > # This is line 1881 of a file with a large header. > # This is line 1882 of a file with a large header. > # This is line 1883 of a file with a large header. > # This is line 1884 of a file with a large header. > # This is line 1885 of a file with a large header. > # This is line 1886 of a file with a large header. > # This is line 1887 of a file with a large header. > # This is line 1888 of a file with a large header. > # This is line 1889 of a file with a large header. > # This is line 1890 of a file with a large header. > # This is line 1891 of a file with a large header. > # This is line 1892 of a file with a large header. > # This is line 1893 of a file with a large header. > # This is line 1894 of a file with a large header. > # This is line 1895 of a file with a large header. > # This is line 1896 of a file with a large header. > # This is line 1897 of a file with a large header. > # This is line 1898 of a file with a large header. > # This is line 1899 of a file with a large header. > # This is line 1900 of a file with a large header. > # This is line 1901 of a file with a large header. > # This is line 1902 of a file with a large header. > # This is line 1903 of a file with a large header. > # This is line 1904 of a file with a large header. > # This is line 1905 of a file with a large header. > # This is line 1906 of a file with a large header. > # This is line 1907 of a file with a large header. > # This is line 1908 of a file with a large header. > # This is line 1909 of a file with a large header. > # This is line 1910 of a file with a large header. > # This is line 1911 of a file with a large header. > # This is line 1912 of a file with a large header. > # This is line 1913 of a file with a large header. > # This is line 1914 of a file with a large header. > # This is line 1915 of a file with a large header. > # This is line 1916 of a file with a large header. > # This is line 1917 of a file with a large header. > # This is line 1918 of a file with a large header. > # This is line 1919 of a file with a large header. > # This is line 1920 of a file with a large header. > # This is line 1921 of a file with a large header. > # This is line 1922 of a file with a large header. > # This is line 1923 of a file with a large header. > # This is line 1924 of a file with a large header. > # This is line 1925 of a file with a large header. > # This is line 1926 of a file with a large header. > # This is line 1927 of a file with a large header. > # This is line 1928 of a file with a large header. > # This is line 1929 of a file with a large header. > # This is line 1930 of a file with a large header. > # This is line 1931 of a file with a large header. > # This is line 1932 of a file with a large header. > # This is line 1933 of a file with a large header. > # This is line 1934 of a file with a large header. > # This is line 1935 of a file with a large header. > # This is line 1936 of a file with a large header. > # This is line 1937 of a file with a large header. > # This is line 1938 of a file with a large header. > # This is line 1939 of a file with a large header. > # This is line 1940 of a file with a large header. > # This is line 1941 of a file with a large header. > # This is line 1942 of a file with a large header. > # This is line 1943 of a file with a large header. > # This is line 1944 of a file with a large header. > # This is line 1945 of a file with a large header. > # This is line 1946 of a file with a large header. > # This is line 1947 of a file with a large header. > # This is line 1948 of a file with a large header. > # This is line 1949 of a file with a large header. > # This is line 1950 of a file with a large header. > # This is line 1951 of a file with a large header. > # This is line 1952 of a file with a large header. > # This is line 1953 of a file with a large header. > # This is line 1954 of a file with a large header. > # This is line 1955 of a file with a large header. > # This is line 1956 of a file with a large header. > # This is line 1957 of a file with a large header. > # This is line 1958 of a file with a large header. > # This is line 1959 of a file with a large header. > # This is line 1960 of a file with a large header. > # This is line 1961 of a file with a large header. > # This is line 1962 of a file with a large header. > # This is line 1963 of a file with a large header. > # This is line 1964 of a file with a large header. > # This is line 1965 of a file with a large header. > # This is line 1966 of a file with a large header. > # This is line 1967 of a file with a large header. > # This is line 1968 of a file with a large header. > # This is line 1969 of a file with a large header. > # This is line 1970 of a file with a large header. > # This is line 1971 of a file with a large header. > # This is line 1972 of a file with a large header. > # This is line 1973 of a file with a large header. > # This is line 1974 of a file with a large header. > # This is line 1975 of a file with a large header. > # This is line 1976 of a file with a large header. > # This is line 1977 of a file with a large header. > # This is line 1978 of a file with a large header. > # This is line 1979 of a file with a large header. > # This is line 1980 of a file with a large header. > # This is line 1981 of a file with a large header. > # This is line 1982 of a file with a large header. > # This is line 1983 of a file with a large header. > # This is line 1984 of a file with a large header. > # This is line 1985 of a file with a large header. > # This is line 1986 of a file with a large header. > # This is line 1987 of a file with a large header. > # This is line 1988 of a file with a large header. > # This is line 1989 of a file with a large header. > # This is line 1990 of a file with a large header. > # This is line 1991 of a file with a large header. > # This is line 1992 of a file with a large header. > # This is line 1993 of a file with a large header. > # This is line 1994 of a file with a large header. > # This is line 1995 of a file with a large header. > # This is line 1996 of a file with a large header. > # This is line 1997 of a file with a large header. > # This is line 1998 of a file with a large header. > # This is line 1999 of a file with a large header. > # This is line 2000 of a file with a large header. > # This is line 2001 of a file with a large header. > # This is line 2002 of a file with a large header. > # This is line 2003 of a file with a large header. > # This is line 2004 of a file with a large header. > # This is line 2005 of a file with a large header. > # This is line 2006 of a file with a large header. > # This is line 2007 of a file with a large header. > # This is line 2008 of a file with a large header. > # This is line 2009 of a file with a large header. > # This is line 2010 of a file with a large header. > # This is line 2011 of a file with a large header. > # This is line 2012 of a file with a large header. > # This is line 2013 of a file with a large header. > # This is line 2014 of a file with a large header. > # This is line 2015 of a file with a large header. > # This is line 2016 of a file with a large header. > # This is line 2017 of a file with a large header. > # This is line 2018 of a file with a large header. > # This is line 2019 of a file with a large header. > # This is line 2020 of a file with a large header. > # This is line 2021 of a file with a large header. > # This is line 2022 of a file with a large header. > # This is line 2023 of a file with a large header. > # This is line 2024 of a file with a large header. > # This is line 2025 of a file with a large header. > # This is line 2026 of a file with a large header. > # This is line 2027 of a file with a large header. > # This is line 2028 of a file with a large header. > # This is line 2029 of a file with a large header. > # This is line 2030 of a file with a large header. > # This is line 2031 of a file with a large header. > # This is line 2032 of a file with a large header. > # This is line 2033 of a file with a large header. > # This is line 2034 of a file with a large header. > # This is line 2035 of a file with a large header. > # This is line 2036 of a file with a large header. > # This is line 2037 of a file with a large header. > # This is line 2038 of a file with a large header. > # This is line 2039 of a file with a large header. > # This is line 2040 of a file with a large header. > # This is line 2041 of a file with a large header. > # This is line 2042 of a file with a large header. > # This is line 2043 of a file with a large header. > # This is line 2044 of a file with a large header. > # This is line 2045 of a file with a large header. > # This is line 2046 of a file with a large header. > # This is line 2047 of a file with a large header. > # This is line 2048 of a file with a large header. > # This is line 2049 of a file with a large header. > # This is line 2050 of a file with a large header. > # This is line 2051 of a file with a large header. > # This is line 2052 of a file with a large header. > # This is line 2053 of a file with a large header. > # This is line 2054 of a file with a large header. > # This is line 2055 of a file with a large header. > # This is line 2056 of a file with a large header. > # This is line 2057 of a file with a large header. > # This is line 2058 of a file with a large header. > # This is line 2059 of a file with a large header. > # This is line 2060 of a file with a large header. > # This is line 2061 of a file with a large header. > # This is line 2062 of a file with a large header. > # This is line 2063 of a file with a large header. > # This is line 2064 of a file with a large header. > # This is line 2065 of a file with a large header. > # This is line 2066 of a file with a large header. > # This is line 2067 of a file with a large header. > # This is line 2068 of a file with a large header. > # This is line 2069 of a file with a large header. > # This is line 2070 of a file with a large header. > # This is line 2071 of a file with a large header. > # This is line 2072 of a file with a large header. > # This is line 2073 of a file with a large header. > # This is line 2074 of a file with a large header. > # This is line 2075 of a file with a large header. > # This is line 2076 of a file with a large header. > # This is line 2077 of a file with a large header. > # This is line 2078 of a file with a large header. > # This is line 2079 of a file with a large header. > # This is line 2080 of a file with a large header. > # This is line 2081 of a file with a large header. > # This is line 2082 of a file with a large header. > # This is line 2083 of a file with a large header. > # This is line 2084 of a file with a large header. > # This is line 2085 of a file with a large header. > # This is line 2086 of a file with a large header. > # This is line 2087 of a file with a large header. > # This is line 2088 of a file with a large header. > # This is line 2089 of a file with a large header. > # This is line 2090 of a file with a large header. > # This is line 2091 of a file with a large header. > # This is line 2092 of a file with a large header. > # This is line 2093 of a file with a large header. > # This is line 2094 of a file with a large header. > # This is line 2095 of a file with a large header. > # This is line 2096 of a file with a large header. > # This is line 2097 of a file with a large header. > # This is line 2098 of a file with a large header. > # This is line 2099 of a file with a large header. > # This is line 2100 of a file with a large header. > # This is line 2101 of a file with a large header. > # This is line 2102 of a file with a large header. > # This is line 2103 of a file with a large header. > # This is line 2104 of a file with a large header. > # This is line 2105 of a file with a large header. > # This is line 2106 of a file with a large header. > # This is line 2107 of a file with a large header. > # This is line 2108 of a file with a large header. > # This is line 2109 of a file with a large header. > # This is line 2110 of a file with a large header. > # This is line 2111 of a file with a large header. > # This is line 2112 of a file with a large header. > # This is line 2113 of a file with a large header. > # This is line 2114 of a file with a large header. > # This is line 2115 of a file with a large header. > # This is line 2116 of a file with a large header. > # This is line 2117 of a file with a large header. > # This is line 2118 of a file with a large header. > # This is line 2119 of a file with a large header. > # This is line 2120 of a file with a large header. > # This is line 2121 of a file with a large header. > # This is line 2122 of a file with a large header. > # This is line 2123 of a file with a large header. > # This is line 2124 of a file with a large header. > # This is line 2125 of a file with a large header. > # This is line 2126 of a file with a large header. > # This is line 2127 of a file with a large header. > # This is line 2128 of a file with a large header. > # This is line 2129 of a file with a large header. > # This is line 2130 of a file with a large header. > # This is line 2131 of a file with a large header. > # This is line 2132 of a file with a large header. > # This is line 2133 of a file with a large header. > # This is line 2134 of a file with a large header. > # This is line 2135 of a file with a large header. > # This is line 2136 of a file with a large header. > # This is line 2137 of a file with a large header. > # This is line 2138 of a file with a large header. > # This is line 2139 of a file with a large header. > # This is line 2140 of a file with a large header. > # This is line 2141 of a file with a large header. > # This is line 2142 of a file with a large header. > # This is line 2143 of a file with a large header. > # This is line 2144 of a file with a large header. > # This is line 2145 of a file with a large header. > # This is line 2146 of a file with a large header. > # This is line 2147 of a file with a large header. > # This is line 2148 of a file with a large header. > # This is line 2149 of a file with a large header. > # This is line 2150 of a file with a large header. > # This is line 2151 of a file with a large header. > # This is line 2152 of a file with a large header. > # This is line 2153 of a file with a large header. > # This is line 2154 of a file with a large header. > # This is line 2155 of a file with a large header. > # This is line 2156 of a file with a large header. > # This is line 2157 of a file with a large header. > # This is line 2158 of a file with a large header. > # This is line 2159 of a file with a large header. > # This is line 2160 of a file with a large header. > # This is line 2161 of a file with a large header. > # This is line 2162 of a file with a large header. > # This is line 2163 of a file with a large header. > # This is line 2164 of a file with a large header. > # This is line 2165 of a file with a large header. > # This is line 2166 of a file with a large header. > # This is line 2167 of a file with a large header. > # This is line 2168 of a file with a large header. > # This is line 2169 of a file with a large header. > # This is line 2170 of a file with a large header. > # This is line 2171 of a file with a large header. > # This is line 2172 of a file with a large header. > # This is line 2173 of a file with a large header. > # This is line 2174 of a file with a large header. > # This is line 2175 of a file with a large header. > # This is line 2176 of a file with a large header. > # This is line 2177 of a file with a large header. > # This is line 2178 of a file with a large header. > # This is line 2179 of a file with a large header. > # This is line 2180 of a file with a large header. > # This is line 2181 of a file with a large header. > # This is line 2182 of a file with a large header. > # This is line 2183 of a file with a large header. > # This is line 2184 of a file with a large header. > # This is line 2185 of a file with a large header. > # This is line 2186 of a file with a large header. > # This is line 2187 of a file with a large header. > # This is line 2188 of a file with a large header. > # This is line 2189 of a file with a large header. > # This is line 2190 of a file with a large header. > # This is line 2191 of a file with a large header. > # This is line 2192 of a file with a large header. > # This is line 2193 of a file with a large header. > # This is line 2194 of a file with a large header. > # This is line 2195 of a file with a large header. > # This is line 2196 of a file with a large header. > # This is line 2197 of a file with a large header. > # This is line 2198 of a file with a large header. > # This is line 2199 of a file with a large header. > # This is line 2200 of a file with a large header. > # This is line 2201 of a file with a large header. > # This is line 2202 of a file with a large header. > # This is line 2203 of a file with a large header. > # This is line 2204 of a file with a large header. > # This is line 2205 of a file with a large header. > # This is line 2206 of a file with a large header. > # This is line 2207 of a file with a large header. > # This is line 2208 of a file with a large header. > # This is line 2209 of a file with a large header. > # This is line 2210 of a file with a large header. > # This is line 2211 of a file with a large header. > # This is line 2212 of a file with a large header. > # This is line 2213 of a file with a large header. > # This is line 2214 of a file with a large header. > # This is line 2215 of a file with a large header. > # This is line 2216 of a file with a large header. > # This is line 2217 of a file with a large header. > # This is line 2218 of a file with a large header. > # This is line 2219 of a file with a large header. > # This is line 2220 of a file with a large header. > # This is line 2221 of a file with a large header. > # This is line 2222 of a file with a large header. > # This is line 2223 of a file with a large header. > # This is line 2224 of a file with a large header. > # This is line 2225 of a file with a large header. > # This is line 2226 of a file with a large header. > # This is line 2227 of a file with a large header. > # This is line 2228 of a file with a large header. > # This is line 2229 of a file with a large header. > # This is line 2230 of a file with a large header. > # This is line 2231 of a file with a large header. > # This is line 2232 of a file with a large header. > # This is line 2233 of a file with a large header. > # This is line 2234 of a file with a large header. > # This is line 2235 of a file with a large header. > # This is line 2236 of a file with a large header. > # This is line 2237 of a file with a large header. > # This is line 2238 of a file with a large header. > # This is line 2239 of a file with a large header. > # This is line 2240 of a file with a large header. > # This is line 2241 of a file with a large header. > # This is line 2242 of a file with a large header. > # This is line 2243 of a file with a large header. > # This is line 2244 of a file with a large header. > # This is line 2245 of a file with a large header. > # This is line 2246 of a file with a large header. > # This is line 2247 of a file with a large header. > # This is line 2248 of a file with a large header. > # This is line 2249 of a file with a large header. > # This is line 2250 of a file with a large header. > # This is line 2251 of a file with a large header. > # This is line 2252 of a file with a large header. > # This is line 2253 of a file with a large header. > # This is line 2254 of a file with a large header. > # This is line 2255 of a file with a large header. > # This is line 2256 of a file with a large header. > # This is line 2257 of a file with a large header. > # This is line 2258 of a file with a large header. > # This is line 2259 of a file with a large header. > # This is line 2260 of a file with a large header. > # This is line 2261 of a file with a large header. > # This is line 2262 of a file with a large header. > # This is line 2263 of a file with a large header. > # This is line 2264 of a file with a large header. > # This is line 2265 of a file with a large header. > # This is line 2266 of a file with a large header. > # This is line 2267 of a file with a large header. > # This is line 2268 of a file with a large header. > # This is line 2269 of a file with a large header. > # This is line 2270 of a file with a large header. > # This is line 2271 of a file with a large header. > # This is line 2272 of a file with a large header. > # This is line 2273 of a file with a large header. > # This is line 2274 of a file with a large header. > # This is line 2275 of a file with a large header. > # This is line 2276 of a file with a large header. > # This is line 2277 of a file with a large header. > # This is line 2278 of a file with a large header. > # This is line 2279 of a file with a large header. > # This is line 2280 of a file with a large header. > # This is line 2281 of a file with a large header. > # This is line 2282 of a file with a large header. > # This is line 2283 of a file with a large header. > # This is line 2284 of a file with a large header. > # This is line 2285 of a file with a large header. > # This is line 2286 of a file with a large header. > # This is line 2287 of a file with a large header. > # This is line 2288 of a file with a large header. > # This is line 2289 of a file with a large header. > # This is line 2290 of a file with a large header. > # This is line 2291 of a file with a large header. > # This is line 2292 of a file with a large header. > # This is line 2293 of a file with a large header. > # This is line 2294 of a file with a large header. > # This is line 2295 of a file with a large header. > # This is line 2296 of a file with a large header. > # This is line 2297 of a file with a large header. > # This is line 2298 of a file with a large header. > # This is line 2299 of a file with a large header. > # This is line 2300 of a file with a large header. > # This is line 2301 of a file with a large header. > # This is line 2302 of a file with a large header. > # This is line 2303 of a file with a large header. > # This is line 2304 of a file with a large header. > # This is line 2305 of a file with a large header. > # This is line 2306 of a file with a large header. > # This is line 2307 of a file with a large header. > # This is line 2308 of a file with a large header. > # This is line 2309 of a file with a large header. > # This is line 2310 of a file with a large header. > # This is line 2311 of a file with a large header. > # This is line 2312 of a file with a large header. > # This is line 2313 of a file with a large header. > # This is line 2314 of a file with a large header. > # This is line 2315 of a file with a large header. > # This is line 2316 of a file with a large header. > # This is line 2317 of a file with a large header. > # This is line 2318 of a file with a large header. > # This is line 2319 of a file with a large header. > # This is line 2320 of a file with a large header. > # This is line 2321 of a file with a large header. > # This is line 2322 of a file with a large header. > # This is line 2323 of a file with a large header. > # This is line 2324 of a file with a large header. > # This is line 2325 of a file with a large header. > # This is line 2326 of a file with a large header. > # This is line 2327 of a file with a large header. > # This is line 2328 of a file with a large header. > # This is line 2329 of a file with a large header. > # This is line 2330 of a file with a large header. > # This is line 2331 of a file with a large header. > # This is line 2332 of a file with a large header. > # This is line 2333 of a file with a large header. > # This is line 2334 of a file with a large header. > # This is line 2335 of a file with a large header. > # This is line 2336 of a file with a large header. > # This is line 2337 of a file with a large header. > # This is line 2338 of a file with a large header. > # This is line 2339 of a file with a large header. > # This is line 2340 of a file with a large header. > # This is line 2341 of a file with a large header. > # This is line 2342 of a file with a large header. > # This is line 2343 of a file with a large header. > # This is line 2344 of a file with a large header. > # This is line 2345 of a file with a large header. > # This is line 2346 of a file with a large header. > # This is line 2347 of a file with a large header. > # This is line 2348 of a file with a large header. > # This is line 2349 of a file with a large header. > # This is line 2350 of a file with a large header. > # This is line 2351 of a file with a large header. > # This is line 2352 of a file with a large header. > # This is line 2353 of a file with a large header. > # This is line 2354 of a file with a large header. > # This is line 2355 of a file with a large header. > # This is line 2356 of a file with a large header. > # This is line 2357 of a file with a large header. > # This is line 2358 of a file with a large header. > # This is line 2359 of a file with a large header. > # This is line 2360 of a file with a large header. > # This is line 2361 of a file with a large header. > # This is line 2362 of a file with a large header. > # This is line 2363 of a file with a large header. > # This is line 2364 of a file with a large header. > # This is line 2365 of a file with a large header. > # This is line 2366 of a file with a large header. > # This is line 2367 of a file with a large header. > # This is line 2368 of a file with a large header. > # This is line 2369 of a file with a large header. > # This is line 2370 of a file with a large header. > # This is line 2371 of a file with a large header. > # This is line 2372 of a file with a large header. > # This is line 2373 of a file with a large header. > # This is line 2374 of a file with a large header. > # This is line 2375 of a file with a large header. > # This is line 2376 of a file with a large header. > # This is line 2377 of a file with a large header. > # This is line 2378 of a file with a large header. > # This is line 2379 of a file with a large header. > # This is line 2380 of a file with a large header. > # This is line 2381 of a file with a large header. > # This is line 2382 of a file with a large header. > # This is line 2383 of a file with a large header. > # This is line 2384 of a file with a large header. > # This is line 2385 of a file with a large header. > # This is line 2386 of a file with a large header. > # This is line 2387 of a file with a large header. > # This is line 2388 of a file with a large header. > # This is line 2389 of a file with a large header. > # This is line 2390 of a file with a large header. > # This is line 2391 of a file with a large header. > # This is line 2392 of a file with a large header. > # This is line 2393 of a file with a large header. > # This is line 2394 of a file with a large header. > # This is line 2395 of a file with a large header. > # This is line 2396 of a file with a large header. > # This is line 2397 of a file with a large header. > # This is line 2398 of a file with a large header. > # This is line 2399 of a file with a large header. > # This is line 2400 of a file with a large header. > # This is line 2401 of a file with a large header. > # This is line 2402 of a file with a large header. > # This is line 2403 of a file with a large header. > # This is line 2404 of a file with a large header. > # This is line 2405 of a file with a large header. > # This is line 2406 of a file with a large header. > # This is line 2407 of a file with a large header. > # This is line 2408 of a file with a large header. > # This is line 2409 of a file with a large header. > # This is line 2410 of a file with a large header. > # This is line 2411 of a file with a large header. > # This is line 2412 of a file with a large header. > # This is line 2413 of a file with a large header. > # This is line 2414 of a file with a large header. > # This is line 2415 of a file with a large header. > # This is line 2416 of a file with a large header. > # This is line 2417 of a file with a large header. > # This is line 2418 of a file with a large header. > # This is line 2419 of a file with a large header. > # This is line 2420 of a file with a large header. > # This is line 2421 of a file with a large header. > # This is line 2422 of a file with a large header. > # This is line 2423 of a file with a large header. > # This is line 2424 of a file with a large header. > # This is line 2425 of a file with a large header. > # This is line 2426 of a file with a large header. > # This is line 2427 of a file with a large header. > # This is line 2428 of a file with a large header. > # This is line 2429 of a file with a large header. > # This is line 2430 of a file with a large header. > # This is line 2431 of a file with a large header. > # This is line 2432 of a file with a large header. > # This is line 2433 of a file with a large header. > # This is line 2434 of a file with a large header. > # This is line 2435 of a file with a large header. > # This is line 2436 of a file with a large header. > # This is line 2437 of a file with a large header. > # This is line 2438 of a file with a large header. > # This is line 2439 of a file with a large header. > # This is line 2440 of a file with a large header. > # This is line 2441 of a file with a large header. > # This is line 2442 of a file with a large header. > # This is line 2443 of a file with a large header. > # This is line 2444 of a file with a large header. > # This is line 2445 of a file with a large header. > # This is line 2446 of a file with a large header. > # This is line 2447 of a file with a large header. > # This is line 2448 of a file with a large header. > # This is line 2449 of a file with a large header. > # This is line 2450 of a file with a large header. > # This is line 2451 of a file with a large header. > # This is line 2452 of a file with a large header. > # This is line 2453 of a file with a large header. > # This is line 2454 of a file with a large header. > # This is line 2455 of a file with a large header. > # This is line 2456 of a file with a large header. > # This is line 2457 of a file with a large header. > # This is line 2458 of a file with a large header. > # This is line 2459 of a file with a large header. > # This is line 2460 of a file with a large header. > # This is line 2461 of a file with a large header. > # This is line 2462 of a file with a large header. > # This is line 2463 of a file with a large header. > # This is line 2464 of a file with a large header. > # This is line 2465 of a file with a large header. > # This is line 2466 of a file with a large header. > # This is line 2467 of a file with a large header. > # This is line 2468 of a file with a large header. > # This is line 2469 of a file with a large header. > # This is line 2470 of a file with a large header. > # This is line 2471 of a file with a large header. > # This is line 2472 of a file with a large header. > # This is line 2473 of a file with a large header. > # This is line 2474 of a file with a large header. > # This is line 2475 of a file with a large header. > # This is line 2476 of a file with a large header. > # This is line 2477 of a file with a large header. > # This is line 2478 of a file with a large header. > # This is line 2479 of a file with a large header. > # This is line 2480 of a file with a large header. > # This is line 2481 of a file with a large header. > # This is line 2482 of a file with a large header. > # This is line 2483 of a file with a large header. > # This is line 2484 of a file with a large header. > # This is line 2485 of a file with a large header. > # This is line 2486 of a file with a large header. > # This is line 2487 of a file with a large header. > # This is line 2488 of a file with a large header. > # This is line 2489 of a file with a large header. > # This is line 2490 of a file with a large header. > # This is line 2491 of a file with a large header. > # This is line 2492 of a file with a large header. > # This is line 2493 of a file with a large header. > # This is line 2494 of a file with a large header. > # This is line 2495 of a file with a large header. > # This is line 2496 of a file with a large header. > # This is line 2497 of a file with a large header. > # This is line 2498 of a file with a large header. > # This is line 2499 of a file with a large header. > # This is line 2500 of a file with a large header. > # This is line 2501 of a file with a large header. > # This is line 2502 of a file with a large header. > # This is line 2503 of a file with a large header. > # This is line 2504 of a file with a large header. > # This is line 2505 of a file with a large header. > # This is line 2506 of a file with a large header. > # This is line 2507 of a file with a large header. > # This is line 2508 of a file with a large header. > # This is line 2509 of a file with a large header. > # This is line 2510 of a file with a large header. > # This is line 2511 of a file with a large header. > # This is line 2512 of a file with a large header. > # This is line 2513 of a file with a large header. > # This is line 2514 of a file with a large header. > # This is line 2515 of a file with a large header. > # This is line 2516 of a file with a large header. > # This is line 2517 of a file with a large header. > # This is line 2518 of a file with a large header. > # This is line 2519 of a file with a large header. > # This is line 2520 of a file with a large header. > # This is line 2521 of a file with a large header. > # This is line 2522 of a file with a large header. > # This is line 2523 of a file with a large header. > # This is line 2524 of a file with a large header. > # This is line 2525 of a file with a large header. > # This is line 2526 of a file with a large header. > # This is line 2527 of a file with a large header. > # This is line 2528 of a file with a large header. > # This is line 2529 of a file with a large header. > # This is line 2530 of a file with a large header. > # This is line 2531 of a file with a large header. > # This is line 2532 of a file with a large header. > # This is line 2533 of a file with a large header. > # This is line 2534 of a file with a large header. > # This is line 2535 of a file with a large header. > # This is line 2536 of a file with a large header. > # This is line 2537 of a file with a large header. > # This is line 2538 of a file with a large header. > # This is line 2539 of a file with a large header. > # This is line 2540 of a file with a large header. > # This is line 2541 of a file with a large header. > # This is line 2542 of a file with a large header. > # This is line 2543 of a file with a large header. > # This is line 2544 of a file with a large header. > # This is line 2545 of a file with a large header. > # This is line 2546 of a file with a large header. > # This is line 2547 of a file with a large header. > # This is line 2548 of a file with a large header. > # This is line 2549 of a file with a large header. > # This is line 2550 of a file with a large header. > # This is line 2551 of a file with a large header. > # This is line 2552 of a file with a large header. > # This is line 2553 of a file with a large header. > # This is line 2554 of a file with a large header. > # This is line 2555 of a file with a large header. > # This is line 2556 of a file with a large header. > # This is line 2557 of a file with a large header. > # This is line 2558 of a file with a large header. > # This is line 2559 of a file with a large header. > # This is line 2560 of a file with a large header. > # This is line 2561 of a file with a large header. > # This is line 2562 of a file with a large header. > # This is line 2563 of a file with a large header. > # This is line 2564 of a file with a large header. > # This is line 2565 of a file with a large header. > # This is line 2566 of a file with a large header. > # This is line 2567 of a file with a large header. > # This is line 2568 of a file with a large header. > # This is line 2569 of a file with a large header. > # This is line 2570 of a file with a large header. > # This is line 2571 of a file with a large header. > # This is line 2572 of a file with a large header. > # This is line 2573 of a file with a large header. > # This is line 2574 of a file with a large header. > # This is line 2575 of a file with a large header. > # This is line 2576 of a file with a large header. > # This is line 2577 of a file with a large header. > # This is line 2578 of a file with a large header. > # This is line 2579 of a file with a large header. > # This is line 2580 of a file with a large header. > # This is line 2581 of a file with a large header. > # This is line 2582 of a file with a large header. > # This is line 2583 of a file with a large header. > # This is line 2584 of a file with a large header. > # This is line 2585 of a file with a large header. > # This is line 2586 of a file with a large header. > # This is line 2587 of a file with a large header. > # This is line 2588 of a file with a large header. > # This is line 2589 of a file with a large header. > # This is line 2590 of a file with a large header. > # This is line 2591 of a file with a large header. > # This is line 2592 of a file with a large header. > # This is line 2593 of a file with a large header. > # This is line 2594 of a file with a large header. > # This is line 2595 of a file with a large header. > # This is line 2596 of a file with a large header. > # This is line 2597 of a file with a large header. > # This is line 2598 of a file with a large header. > # This is line 2599 of a file with a large header. > # This is line 2600 of a file with a large header. > # This is line 2601 of a file with a large header. > # This is line 2602 of a file with a large header. > # This is line 2603 of a file with a large header. > # This is line 2604 of a file with a large header. > # This is line 2605 of a file with a large header. > # This is line 2606 of a file with a large header. > # This is line 2607 of a file with a large header. > # This is line 2608 of a file with a large header. > # This is line 2609 of a file with a large header. > # This is line 2610 of a file with a large header. > # This is line 2611 of a file with a large header. > # This is line 2612 of a file with a large header. > # This is line 2613 of a file with a large header. > # This is line 2614 of a file with a large header. > # This is line 2615 of a file with a large header. > # This is line 2616 of a file with a large header. > # This is line 2617 of a file with a large header. > # This is line 2618 of a file with a large header. > # This is line 2619 of a file with a large header. > # This is line 2620 of a file with a large header. > # This is line 2621 of a file with a large header. > # This is line 2622 of a file with a large header. > # This is line 2623 of a file with a large header. > # This is line 2624 of a file with a large header. > # This is line 2625 of a file with a large header. > # This is line 2626 of a file with a large header. > # This is line 2627 of a file with a large header. > # This is line 2628 of a file with a large header. > # This is line 2629 of a file with a large header. > # This is line 2630 of a file with a large header. > # This is line 2631 of a file with a large header. > # This is line 2632 of a file with a large header. > # This is line 2633 of a file with a large header. > # This is line 2634 of a file with a large header. > # This is line 2635 of a file with a large header. > # This is line 2636 of a file with a large header. > # This is line 2637 of a file with a large header. > # This is line 2638 of a file with a large header. > # This is line 2639 of a file with a large header. > # This is line 2640 of a file with a large header. > # This is line 2641 of a file with a large header. > # This is line 2642 of a file with a large header. > # This is line 2643 of a file with a large header. > # This is line 2644 of a file with a large header. > # This is line 2645 of a file with a large header. > # This is line 2646 of a file with a large header. > # This is line 2647 of a file with a large header. > # This is line 2648 of a file with a large header. > # This is line 2649 of a file with a large header. > # This is line 2650 of a file with a large header. > # This is line 2651 of a file with a large header. > # This is line 2652 of a file with a large header. > # This is line 2653 of a file with a large header. > # This is line 2654 of a file with a large header. > # This is line 2655 of a file with a large header. > # This is line 2656 of a file with a large header. > # This is line 2657 of a file with a large header. > # This is line 2658 of a file with a large header. > # This is line 2659 of a file with a large header. > # This is line 2660 of a file with a large header. > # This is line 2661 of a file with a large header. > # This is line 2662 of a file with a large header. > # This is line 2663 of a file with a large header. > # This is line 2664 of a file with a large header. > # This is line 2665 of a file with a large header. > # This is line 2666 of a file with a large header. > # This is line 2667 of a file with a large header. > # This is line 2668 of a file with a large header. > # This is line 2669 of a file with a large header. > # This is line 2670 of a file with a large header. > # This is line 2671 of a file with a large header. > # This is line 2672 of a file with a large header. > # This is line 2673 of a file with a large header. > # This is line 2674 of a file with a large header. > # This is line 2675 of a file with a large header. > # This is line 2676 of a file with a large header. > # This is line 2677 of a file with a large header. > # This is line 2678 of a file with a large header. > # This is line 2679 of a file with a large header. > # This is line 2680 of a file with a large header. > # This is line 2681 of a file with a large header. > # This is line 2682 of a file with a large header. > # This is line 2683 of a file with a large header. > # This is line 2684 of a file with a large header. > # This is line 2685 of a file with a large header. > # This is line 2686 of a file with a large header. > # This is line 2687 of a file with a large header. > # This is line 2688 of a file with a large header. > # This is line 2689 of a file with a large header. > # This is line 2690 of a file with a large header. > # This is line 2691 of a file with a large header. > # This is line 2692 of a file with a large header. > # This is line 2693 of a file with a large header. > # This is line 2694 of a file with a large header. > # This is line 2695 of a file with a large header. > # This is line 2696 of a file with a large header. > # This is line 2697 of a file with a large header. > # This is line 2698 of a file with a large header. > # This is line 2699 of a file with a large header. > # This is line 2700 of a file with a large header. > # This is line 2701 of a file with a large header. > # This is line 2702 of a file with a large header. > # This is line 2703 of a file with a large header. > # This is line 2704 of a file with a large header. > # This is line 2705 of a file with a large header. > # This is line 2706 of a file with a large header. > # This is line 2707 of a file with a large header. > # This is line 2708 of a file with a large header. > # This is line 2709 of a file with a large header. > # This is line 2710 of a file with a large header. > # This is line 2711 of a file with a large header. > # This is line 2712 of a file with a large header. > # This is line 2713 of a file with a large header. > # This is line 2714 of a file with a large header. > # This is line 2715 of a file with a large header. > # This is line 2716 of a file with a large header. > # This is line 2717 of a file with a large header. > # This is line 2718 of a file with a large header. > # This is line 2719 of a file with a large header. > # This is line 2720 of a file with a large header. > # This is line 2721 of a file with a large header. > # This is line 2722 of a file with a large header. > # This is line 2723 of a file with a large header. > # This is line 2724 of a file with a large header. > # This is line 2725 of a file with a large header. > # This is line 2726 of a file with a large header. > # This is line 2727 of a file with a large header. > # This is line 2728 of a file with a large header. > # This is line 2729 of a file with a large header. > # This is line 2730 of a file with a large header. > # This is line 2731 of a file with a large header. > # This is line 2732 of a file with a large header. > # This is line 2733 of a file with a large header. > # This is line 2734 of a file with a large header. > # This is line 2735 of a file with a large header. > # This is line 2736 of a file with a large header. > # This is line 2737 of a file with a large header. > # This is line 2738 of a file with a large header. > # This is line 2739 of a file with a large header. > # This is line 2740 of a file with a large header. > # This is line 2741 of a file with a large header. > # This is line 2742 of a file with a large header. > # This is line 2743 of a file with a large header. > # This is line 2744 of a file with a large header. > # This is line 2745 of a file with a large header. > # This is line 2746 of a file with a large header. > # This is line 2747 of a file with a large header. > # This is line 2748 of a file with a large header. > # This is line 2749 of a file with a large header. > # This is line 2750 of a file with a large header. > # This is line 2751 of a file with a large header. > # This is line 2752 of a file with a large header. > # This is line 2753 of a file with a large header. > # This is line 2754 of a file with a large header. > # This is line 2755 of a file with a large header. > # This is line 2756 of a file with a large header. > # This is line 2757 of a file with a large header. > # This is line 2758 of a file with a large header. > # This is line 2759 of a file with a large header. > # This is line 2760 of a file with a large header. > # This is line 2761 of a file with a large header. > # This is line 2762 of a file with a large header. > # This is line 2763 of a file with a large header. > # This is line 2764 of a file with a large header. > # This is line 2765 of a file with a large header. > # This is line 2766 of a file with a large header. > # This is line 2767 of a file with a large header. > # This is line 2768 of a file with a large header. > # This is line 2769 of a file with a large header. > # This is line 2770 of a file with a large header. > # This is line 2771 of a file with a large header. > # This is line 2772 of a file with a large header. > # This is line 2773 of a file with a large header. > # This is line 2774 of a file with a large header. > # This is line 2775 of a file with a large header. > # This is line 2776 of a file with a large header. > # This is line 2777 of a file with a large header. > # This is line 2778 of a file with a large header. > # This is line 2779 of a file with a large header. > # This is line 2780 of a file with a large header. > # This is line 2781 of a file with a large header. > # This is line 2782 of a file with a large header. > # This is line 2783 of a file with a large header. > # This is line 2784 of a file with a large header. > # This is line 2785 of a file with a large header. > # This is line 2786 of a file with a large header. > # This is line 2787 of a file with a large header. > # This is line 2788 of a file with a large header. > # This is line 2789 of a file with a large header. > # This is line 2790 of a file with a large header. > # This is line 2791 of a file with a large header. > # This is line 2792 of a file with a large header. > # This is line 2793 of a file with a large header. > # This is line 2794 of a file with a large header. > # This is line 2795 of a file with a large header. > # This is line 2796 of a file with a large header. > # This is line 2797 of a file with a large header. > # This is line 2798 of a file with a large header. > # This is line 2799 of a file with a large header. > # This is line 2800 of a file with a large header. > # This is line 2801 of a file with a large header. > # This is line 2802 of a file with a large header. > # This is line 2803 of a file with a large header. > # This is line 2804 of a file with a large header. > # This is line 2805 of a file with a large header. > # This is line 2806 of a file with a large header. > # This is line 2807 of a file with a large header. > # This is line 2808 of a file with a large header. > # This is line 2809 of a file with a large header. > # This is line 2810 of a file with a large header. > # This is line 2811 of a file with a large header. > # This is line 2812 of a file with a large header. > # This is line 2813 of a file with a large header. > # This is line 2814 of a file with a large header. > # This is line 2815 of a file with a large header. > # This is line 2816 of a file with a large header. > # This is line 2817 of a file with a large header. > # This is line 2818 of a file with a large header. > # This is line 2819 of a file with a large header. > # This is line 2820 of a file with a large header. > # This is line 2821 of a file with a large header. > # This is line 2822 of a file with a large header. > # This is line 2823 of a file with a large header. > # This is line 2824 of a file with a large header. > # This is line 2825 of a file with a large header. > # This is line 2826 of a file with a large header. > # This is line 2827 of a file with a large header. > # This is line 2828 of a file with a large header. > # This is line 2829 of a file with a large header. > # This is line 2830 of a file with a large header. > # This is line 2831 of a file with a large header. > # This is line 2832 of a file with a large header. > # This is line 2833 of a file with a large header. > # This is line 2834 of a file with a large header. > # This is line 2835 of a file with a large header. > # This is line 2836 of a file with a large header. > # This is line 2837 of a file with a large header. > # This is line 2838 of a file with a large header. > # This is line 2839 of a file with a large header. > # This is line 2840 of a file with a large header. > # This is line 2841 of a file with a large header. > # This is line 2842 of a file with a large header. > # This is line 2843 of a file with a large header. > # This is line 2844 of a file with a large header. > # This is line 2845 of a file with a large header. > # This is line 2846 of a file with a large header. > # This is line 2847 of a file with a large header. > # This is line 2848 of a file with a large header. > # This is line 2849 of a file with a large header. > # This is line 2850 of a file with a large header. > # This is line 2851 of a file with a large header. > # This is line 2852 of a file with a large header. > # This is line 2853 of a file with a large header. > # This is line 2854 of a file with a large header. > # This is line 2855 of a file with a large header. > # This is line 2856 of a file with a large header. > # This is line 2857 of a file with a large header. > # This is line 2858 of a file with a large header. > # This is line 2859 of a file with a large header. > # This is line 2860 of a file with a large header. > # This is line 2861 of a file with a large header. > # This is line 2862 of a file with a large header. > # This is line 2863 of a file with a large header. > # This is line 2864 of a file with a large header. > # This is line 2865 of a file with a large header. > # This is line 2866 of a file with a large header. > # This is line 2867 of a file with a large header. > # This is line 2868 of a file with a large header. > # This is line 2869 of a file with a large header. > # This is line 2870 of a file with a large header. > # This is line 2871 of a file with a large header. > # This is line 2872 of a file with a large header. > # This is line 2873 of a file with a large header. > # This is line 2874 of a file with a large header. > # This is line 2875 of a file with a large header. > # This is line 2876 of a file with a large header. > # This is line 2877 of a file with a large header. > # This is line 2878 of a file with a large header. > # This is line 2879 of a file with a large header. > # This is line 2880 of a file with a large header. > # This is line 2881 of a file with a large header. > # This is line 2882 of a file with a large header. > # This is line 2883 of a file with a large header. > # This is line 2884 of a file with a large header. > # This is line 2885 of a file with a large header. > # This is line 2886 of a file with a large header. > # This is line 2887 of a file with a large header. > # This is line 2888 of a file with a large header. > # This is line 2889 of a file with a large header. > # This is line 2890 of a file with a large header. > # This is line 2891 of a file with a large header. > # This is line 2892 of a file with a large header. > # This is line 2893 of a file with a large header. > # This is line 2894 of a file with a large header. > # This is line 2895 of a file with a large header. > # This is line 2896 of a file with a large header. > # This is line 2897 of a file with a large header. > # This is line 2898 of a file with a large header. > # This is line 2899 of a file with a large header. > # This is line 2900 of a file with a large header. > # This is line 2901 of a file with a large header. > # This is line 2902 of a file with a large header. > # This is line 2903 of a file with a large header. > # This is line 2904 of a file with a large header. > # This is line 2905 of a file with a large header. > # This is line 2906 of a file with a large header. > # This is line 2907 of a file with a large header. > # This is line 2908 of a file with a large header. > # This is line 2909 of a file with a large header. > # This is line 2910 of a file with a large header. > # This is line 2911 of a file with a large header. > # This is line 2912 of a file with a large header. > # This is line 2913 of a file with a large header. > # This is line 2914 of a file with a large header. > # This is line 2915 of a file with a large header. > # This is line 2916 of a file with a large header. > # This is line 2917 of a file with a large header. > # This is line 2918 of a file with a large header. > # This is line 2919 of a file with a large header. > # This is line 2920 of a file with a large header. > # This is line 2921 of a file with a large header. > # This is line 2922 of a file with a large header. > # This is line 2923 of a file with a large header. > # This is line 2924 of a file with a large header. > # This is line 2925 of a file with a large header. > # This is line 2926 of a file with a large header. > # This is line 2927 of a file with a large header. > # This is line 2928 of a file with a large header. > # This is line 2929 of a file with a large header. > # This is line 2930 of a file with a large header. > # This is line 2931 of a file with a large header. > # This is line 2932 of a file with a large header. > # This is line 2933 of a file with a large header. > # This is line 2934 of a file with a large header. > # This is line 2935 of a file with a large header. > # This is line 2936 of a file with a large header. > # This is line 2937 of a file with a large header. > # This is line 2938 of a file with a large header. > # This is line 2939 of a file with a large header. > # This is line 2940 of a file with a large header. > # This is line 2941 of a file with a large header. > # This is line 2942 of a file with a large header. > # This is line 2943 of a file with a large header. > # This is line 2944 of a file with a large header. > # This is line 2945 of a file with a large header. > # This is line 2946 of a file with a large header. > # This is line 2947 of a file with a large header. > # This is line 2948 of a file with a large header. > # This is line 2949 of a file with a large header. > # This is line 2950 of a file with a large header. > # This is line 2951 of a file with a large header. > # This is line 2952 of a file with a large header. > # This is line 2953 of a file with a large header. > # This is line 2954 of a file with a large header. > # This is line 2955 of a file with a large header. > # This is line 2956 of a file with a large header. > # This is line 2957 of a file with a large header. > # This is line 2958 of a file with a large header. > # This is line 2959 of a file with a large header. > # This is line 2960 of a file with a large header. > # This is line 2961 of a file with a large header. > # This is line 2962 of a file with a large header. > # This is line 2963 of a file with a large header. > # This is line 2964 of a file with a large header. > # This is line 2965 of a file with a large header. > # This is line 2966 of a file with a large header. > # This is line 2967 of a file with a large header. > # This is line 2968 of a file with a large header. > # This is line 2969 of a file with a large header. > # This is line 2970 of a file with a large header. > # This is line 2971 of a file with a large header. > # This is line 2972 of a file with a large header. > # This is line 2973 of a file with a large header. > # This is line 2974 of a file with a large header. > # This is line 2975 of a file with a large header. > # This is line 2976 of a file with a large header. > # This is line 2977 of a file with a large header. > # This is line 2978 of a file with a large header. > # This is line 2979 of a file with a large header. > # This is line 2980 of a file with a large header. > # This is line 2981 of a file with a large header. > # This is line 2982 of a file with a large header. > # This is line 2983 of a file with a large header. > # This is line 2984 of a file with a large header. > # This is line 2985 of a file with a large header. > # This is line 2986 of a file with a large header. > # This is line 2987 of a file with a large header. > # This is line 2988 of a file with a large header. > # This is line 2989 of a file with a large header. > # This is line 2990 of a file with a large header. > # This is line 2991 of a file with a large header. > # This is line 2992 of a file with a large header. > # This is line 2993 of a file with a large header. > # This is line 2994 of a file with a large header. > # This is line 2995 of a file with a large header. > # This is line 2996 of a file with a large header. > # This is line 2997 of a file with a large header. > # This is line 2998 of a file with a large header. > # This is line 2999 of a file with a large header. > # This is line 3000 of a file with a large header. > # This is line 3001 of a file with a large header. > # This is line 3002 of a file with a large header. > # This is line 3003 of a file with a large header. > # This is line 3004 of a file with a large header. > # This is line 3005 of a file with a large header. > # This is line 3006 of a file with a large header. > # This is line 3007 of a file with a large header. > # This is line 3008 of a file with a large header. > # This is line 3009 of a file with a large header. > # This is line 3010 of a file with a large header. > # This is line 3011 of a file with a large header. > # This is line 3012 of a file with a large header. > # This is line 3013 of a file with a large header. > # This is line 3014 of a file with a large header. > # This is line 3015 of a file with a large header. > # This is line 3016 of a file with a large header. > # This is line 3017 of a file with a large header. > # This is line 3018 of a file with a large header. > # This is line 3019 of a file with a large header. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents new_test-intersect.sh: line 558: 15644 Aborted $BT intersect -a - -b b.bed -header < a_withLargeHeader_bgzipped.bed.gz > obs > # This is line 3020 of a file with a large header. > # This is line 3021 of a file with a large header. > # This is line 3022 of a file with a large header. > # This is line 3023 of a file with a large header. > # This is line 3024 of a file with a large header. > # This is line 3025 of a file with a large header. > # This is line 3026 of a file with a large header. > # This is line 3027 of a file with a large header. > # This is line 3028 of a file with a large header. > # This is line 3029 of a file with a large header. > # This is line 3030 of a file with a large header. > # This is line 3031 of a file with a large header. > # This is line 3032 of a file with a large header. > # This is line 3033 of a file with a large header. > # This is line 3034 of a file with a large header. > # This is line 3035 of a file with a large header. > # This is line 3036 of a file with a large header. > # This is line 3037 of a file with a large header. > # This is line 3038 of a file with a large header. > # This is line 3039 of a file with a large header. > # This is line 3040 of a file with a large header. > # This is line 3041 of a file with a large header. > # This is line 3042 of a file with a large header. > # This is line 3043 of a file with a large header. > # This is line 3044 of a file with a large header. > # This is line 3045 of a file with a large header. > # This is line 3046 of a file with a large header. > # This is line 3047 of a file with a large header. > # This is line 3048 of a file with a large header. > # This is line 3049 of a file with a large header. > # This is line 3050 of a file with a large header. > # This is line 3051 of a file with a large header. > # This is line 3052 of a file with a large header. > # This is line 3053 of a file with a large header. > # This is line 3054 of a file with a large header. > # This is line 3055 of a file with a large header. > # This is line 3056 of a file with a large header. > # This is line 3057 of a file with a large header. > # This is line 3058 of a file with a large header. > # This is line 3059 of a file with a large header. > # This is line 3060 of a file with a large header. > # This is line 3061 of a file with a large header. > # This is line 3062 of a file with a large header. > # This is line 3063 of a file with a large header. > # This is line 3064 of a file with a large header. > # This is line 3065 of a file with a large header. > # This is line 3066 of a file with a large header. > # This is line 3067 of a file with a large header. > # This is line 3068 of a file with a large header. > # This is line 3069 of a file with a large header. > # This is line 3070 of a file with a large header. > # This is line 3071 of a file with a large header. > # This is line 3072 of a file with a large header. > # This is line 3073 of a file with a large header. > # This is line 3074 of a file with a large header. > # This is line 3075 of a file with a large header. > # This is line 3076 of a file with a large header. > # This is line 3077 of a file with a large header. > # This is line 3078 of a file with a large header. > # This is line 3079 of a file with a large header. > # This is line 3080 of a file with a large header. > # This is line 3081 of a file with a large header. > # This is line 3082 of a file with a large header. > # This is line 3083 of a file with a large header. > # This is line 3084 of a file with a large header. > # This is line 3085 of a file with a large header. > # This is line 3086 of a file with a large header. > # This is line 3087 of a file with a large header. > # This is line 3088 of a file with a large header. > # This is line 3089 of a file with a large header. > # This is line 3090 of a file with a large header. > # This is line 3091 of a file with a large header. > # This is line 3092 of a file with a large header. > # This is line 3093 of a file with a large header. > # This is line 3094 of a file with a large header. > # This is line 3095 of a file with a large header. > # This is line 3096 of a file with a large header. > # This is line 3097 of a file with a large header. > # This is line 3098 of a file with a large header. > # This is line 3099 of a file with a large header. > # This is line 3100 of a file with a large header. > # This is line 3101 of a file with a large header. > # This is line 3102 of a file with a large header. > # This is line 3103 of a file with a large header. > # This is line 3104 of a file with a large header. > # This is line 3105 of a file with a large header. > # This is line 3106 of a file with a large header. > # This is line 3107 of a file with a large header. > # This is line 3108 of a file with a large header. > # This is line 3109 of a file with a large header. > # This is line 3110 of a file with a large header. > # This is line 3111 of a file with a large header. > # This is line 3112 of a file with a large header. > # This is line 3113 of a file with a large header. > # This is line 3114 of a file with a large header. > # This is line 3115 of a file with a large header. > # This is line 3116 of a file with a large header. > # This is line 3117 of a file with a large header. > # This is line 3118 of a file with a large header. > # This is line 3119 of a file with a large header. > # This is line 3120 of a file with a large header. > # This is line 3121 of a file with a large header. > # This is line 3122 of a file with a large header. > # This is line 3123 of a file with a large header. > # This is line 3124 of a file with a large header. > # This is line 3125 of a file with a large header. > # This is line 3126 of a file with a large header. > # This is line 3127 of a file with a large header. > # This is line 3128 of a file with a large header. > # This is line 3129 of a file with a large header. > # This is line 3130 of a file with a large header. > # This is line 3131 of a file with a large header. > # This is line 3132 of a file with a large header. > # This is line 3133 of a file with a large header. > # This is line 3134 of a file with a large header. > # This is line 3135 of a file with a large header. > # This is line 3136 of a file with a large header. > # This is line 3137 of a file with a large header. > # This is line 3138 of a file with a large header. > # This is line 3139 of a file with a large header. > # This is line 3140 of a file with a large header. > # This is line 3141 of a file with a large header. > # This is line 3142 of a file with a large header. > # This is line 3143 of a file with a large header. > # This is line 3144 of a file with a large header. > # This is line 3145 of a file with a large header. > # This is line 3146 of a file with a large header. > # This is line 3147 of a file with a large header. > # This is line 3148 of a file with a large header. > # This is line 3149 of a file with a large header. > # This is line 3150 of a file with a large header. > # This is line 3151 of a file with a large header. > # This is line 3152 of a file with a large header. > # This is line 3153 of a file with a large header. > # This is line 3154 of a file with a large header. > # This is line 3155 of a file with a large header. > # This is line 3156 of a file with a large header. > # This is line 3157 of a file with a large header. > # This is line 3158 of a file with a large header. > # This is line 3159 of a file with a large header. > # This is line 3160 of a file with a large header. > # This is line 3161 of a file with a large header. > # This is line 3162 of a file with a large header. > # This is line 3163 of a file with a large header. > # This is line 3164 of a file with a large header. > # This is line 3165 of a file with a large header. > # This is line 3166 of a file with a large header. > # This is line 3167 of a file with a large header. > # This is line 3168 of a file with a large header. > # This is line 3169 of a file with a large header. > # This is line 3170 of a file with a large header. > # This is line 3171 of a file with a large header. > # This is line 3172 of a file with a large header. > # This is line 3173 of a file with a large header. > # This is line 3174 of a file with a large header. > # This is line 3175 of a file with a large header. > # This is line 3176 of a file with a large header. > # This is line 3177 of a file with a large header. > # This is line 3178 of a file with a large header. > # This is line 3179 of a file with a large header. > # This is line 3180 of a file with a large header. > # This is line 3181 of a file with a large header. > # This is line 3182 of a file with a large header. > # This is line 3183 of a file with a large header. > # This is line 3184 of a file with a large header. > # This is line 3185 of a file with a large header. > # This is line 3186 of a file with a large header. > # This is line 3187 of a file with a large header. > # This is line 3188 of a file with a large header. > # This is line 3189 of a file with a large header. > # This is line 3190 of a file with a large header. > # This is line 3191 of a file with a large header. > # This is line 3192 of a file with a large header. > # This is line 3193 of a file with a large header. > # This is line 3194 of a file with a large header. > # This is line 3195 of a file with a large header. > # This is line 3196 of a file with a large header. > # This is line 3197 of a file with a large header. > # This is line 3198 of a file with a large header. > # This is line 3199 of a file with a large header. > # This is line 3200 of a file with a large header. > # This is line 3201 of a file with a large header. > # This is line 3202 of a file with a large header. > # This is line 3203 of a file with a large header. > # This is line 3204 of a file with a large header. > # This is line 3205 of a file with a large header. > # This is line 3206 of a file with a large header. > # This is line 3207 of a file with a large header. > # This is line 3208 of a file with a large header. > # This is line 3209 of a file with a large header. > # This is line 3210 of a file with a large header. > # This is line 3211 of a file with a large header. > # This is line 3212 of a file with a large header. > # This is line 3213 of a file with a large header. > # This is line 3214 of a file with a large header. > # This is line 3215 of a file with a large header. > # This is line 3216 of a file with a large header. > # This is line 3217 of a file with a large header. > # This is line 3218 of a file with a large header. > # This is line 3219 of a file with a large header. > # This is line 3220 of a file with a large header. > # This is line 3221 of a file with a large header. > # This is line 3222 of a file with a large header. > # This is line 3223 of a file with a large header. > # This is line 3224 of a file with a large header. > # This is line 3225 of a file with a large header. > # This is line 3226 of a file with a large header. > # This is line 3227 of a file with a large header. > # This is line 3228 of a file with a large header. > # This is line 3229 of a file with a large header. > # This is line 3230 of a file with a large header. > # This is line 3231 of a file with a large header. > # This is line 3232 of a file with a large header. > # This is line 3233 of a file with a large header. > # This is line 3234 of a file with a large header. > # This is line 3235 of a file with a large header. > # This is line 3236 of a file with a large header. > # This is line 3237 of a file with a large header. > # This is line 3238 of a file with a large header. > # This is line 3239 of a file with a large header. > # This is line 3240 of a file with a large header. > # This is line 3241 of a file with a large header. > # This is line 3242 of a file with a large header. > # This is line 3243 of a file with a large header. > # This is line 3244 of a file with a large header. > # This is line 3245 of a file with a large header. > # This is line 3246 of a file with a large header. > # This is line 3247 of a file with a large header. > # This is line 3248 of a file with a large header. > # This is line 3249 of a file with a large header. > # This is line 3250 of a file with a large header. > # This is line 3251 of a file with a large header. > # This is line 3252 of a file with a large header. > # This is line 3253 of a file with a large header. > # This is line 3254 of a file with a large header. > # This is line 3255 of a file with a large header. > # This is line 3256 of a file with a large header. > # This is line 3257 of a file with a large header. > # This is line 3258 of a file with a large header. > # This is line 3259 of a file with a large header. > # This is line 3260 of a file with a large header. > # This is line 3261 of a file with a large header. > # This is line 3262 of a file with a large header. > # This is line 3263 of a file with a large header. > # This is line 3264 of a file with a large header. > # This is line 3265 of a file with a large header. > # This is line 3266 of a file with a large header. > # This is line 3267 of a file with a large header. > # This is line 3268 of a file with a large header. > # This is line 3269 of a file with a large header. > # This is line 3270 of a file with a large header. > # This is line 3271 of a file with a large header. > # This is line 3272 of a file with a large header. > # This is line 3273 of a file with a large header. > # This is line 3274 of a file with a large header. > # This is line 3275 of a file with a large header. > # This is line 3276 of a file with a large header. > # This is line 3277 of a file with a large header. > # This is line 3278 of a file with a large header. > # This is line 3279 of a file with a large header. > # This is line 3280 of a file with a large header. > # This is line 3281 of a file with a large header. > # This is line 3282 of a file with a large header. > # This is line 3283 of a file with a large header. > # This is line 3284 of a file with a large header. > # This is line 3285 of a file with a large header. > # This is line 3286 of a file with a large header. > # This is line 3287 of a file with a large header. > # This is line 3288 of a file with a large header. > # This is line 3289 of a file with a large header. > # This is line 3290 of a file with a large header. > # This is line 3291 of a file with a large header. > # This is line 3292 of a file with a large header. > # This is line 3293 of a file with a large header. > # This is line 3294 of a file with a large header. > # This is line 3295 of a file with a large header. > # This is line 3296 of a file with a large header. > # This is line 3297 of a file with a large header. > # This is line 3298 of a file with a large header. > # This is line 3299 of a file with a large header. > # This is line 3300 of a file with a large header. > # This is line 3301 of a file with a large header. > # This is line 3302 of a file with a large header. > # This is line 3303 of a file with a large header. > # This is line 3304 of a file with a large header. > # This is line 3305 of a file with a large header. > # This is line 3306 of a file with a large header. > # This is line 3307 of a file with a large header. > # This is line 3308 of a file with a large header. > # This is line 3309 of a file with a large header. > # This is line 3310 of a file with a large header. > # This is line 3311 of a file with a large header. > # This is line 3312 of a file with a large header. > # This is line 3313 of a file with a large header. > # This is line 3314 of a file with a large header. > # This is line 3315 of a file with a large header. > # This is line 3316 of a file with a large header. > # This is line 3317 of a file with a large header. > # This is line 3318 of a file with a large header. > # This is line 3319 of a file with a large header. > # This is line 3320 of a file with a large header. > # This is line 3321 of a file with a large header. > # This is line 3322 of a file with a large header. > # This is line 3323 of a file with a large header. > # This is line 3324 of a file with a large header. > # This is line 3325 of a file with a large header. > # This is line 3326 of a file with a large header. > # This is line 3327 of a file with a large header. > # This is line 3328 of a file with a large header. > # This is line 3329 of a file with a large header. > # This is line 3330 of a file with a large header. > # This is line 3331 of a file with a large header. > # This is line 3332 of a file with a large header. > # This is line 3333 of a file with a large header. > # This is line 3334 of a file with a large header. > # This is line 3335 of a file with a large header. > # This is line 3336 of a file with a large header. > # This is line 3337 of a file with a large header. > # This is line 3338 of a file with a large header. > # This is line 3339 of a file with a large header. > # This is line 3340 of a file with a large header. > # This is line 3341 of a file with a large header. > # This is line 3342 of a file with a large header. > # This is line 3343 of a file with a large header. > # This is line 3344 of a file with a large header. > # This is line 3345 of a file with a large header. > # This is line 3346 of a file with a large header. > # This is line 3347 of a file with a large header. > # This is line 3348 of a file with a large header. > # This is line 3349 of a file with a large header. > # This is line 3350 of a file with a large header. > # This is line 3351 of a file with a large header. > # This is line 3352 of a file with a large header. > # This is line 3353 of a file with a large header. > # This is line 3354 of a file with a large header. > # This is line 3355 of a file with a large header. > # This is line 3356 of a file with a large header. > # This is line 3357 of a file with a large header. > # This is line 3358 of a file with a large header. > # This is line 3359 of a file with a large header. > # This is line 3360 of a file with a large header. > # This is line 3361 of a file with a large header. > # This is line 3362 of a file with a large header. > # This is line 3363 of a file with a large header. > # This is line 3364 of a file with a large header. > # This is line 3365 of a file with a large header. > # This is line 3366 of a file with a large header. > # This is line 3367 of a file with a large header. > # This is line 3368 of a file with a large header. > # This is line 3369 of a file with a large header. > # This is line 3370 of a file with a large header. > # This is line 3371 of a file with a large header. > # This is line 3372 of a file with a large header. > # This is line 3373 of a file with a large header. > # This is line 3374 of a file with a large header. > # This is line 3375 of a file with a large header. > # This is line 3376 of a file with a large header. > # This is line 3377 of a file with a large header. > # This is line 3378 of a file with a large header. > # This is line 3379 of a file with a large header. > # This is line 3380 of a file with a large header. > # This is line 3381 of a file with a large header. > # This is line 3382 of a file with a large header. > # This is line 3383 of a file with a large header. > # This is line 3384 of a file with a large header. > # This is line 3385 of a file with a large header. > # This is line 3386 of a file with a large header. > # This is line 3387 of a file with a large header. > # This is line 3388 of a file with a large header. > # This is line 3389 of a file with a large header. > # This is line 3390 of a file with a large header. > # This is line 3391 of a file with a large header. > # This is line 3392 of a file with a large header. > # This is line 3393 of a file with a large header. > # This is line 3394 of a file with a large header. > # This is line 3395 of a file with a large header. > # This is line 3396 of a file with a large header. > # This is line 3397 of a file with a large header. > # This is line 3398 of a file with a large header. > # This is line 3399 of a file with a large header. > # This is line 3400 of a file with a large header. > # This is line 3401 of a file with a large header. > # This is line 3402 of a file with a large header. > # This is line 3403 of a file with a large header. > # This is line 3404 of a file with a large header. > # This is line 3405 of a file with a large header. > # This is line 3406 of a file with a large header. > # This is line 3407 of a file with a large header. > # This is line 3408 of a file with a large header. > # This is line 3409 of a file with a large header. > # This is line 3410 of a file with a large header. > # This is line 3411 of a file with a large header. > # This is line 3412 of a file with a large header. > # This is line 3413 of a file with a large header. > # This is line 3414 of a file with a large header. > # This is line 3415 of a file with a large header. > # This is line 3416 of a file with a large header. > # This is line 3417 of a file with a large header. > # This is line 3418 of a file with a large header. > # This is line 3419 of a file with a large header. > # This is line 3420 of a file with a large header. > # This is line 3421 of a file with a large header. > # This is line 3422 of a file with a large header. > # This is line 3423 of a file with a large header. > # This is line 3424 of a file with a large header. > # This is line 3425 of a file with a large header. > # This is line 3426 of a file with a large header. > # This is line 3427 of a file with a large header. > # This is line 3428 of a file with a large header. > # This is line 3429 of a file with a large header. > # This is line 3430 of a file with a large header. > # This is line 3431 of a file with a large header. > # This is line 3432 of a file with a large header. > # This is line 3433 of a file with a large header. > # This is line 3434 of a file with a large header. > # This is line 3435 of a file with a large header. > # This is line 3436 of a file with a large header. > # This is line 3437 of a file with a large header. > # This is line 3438 of a file with a large header. > # This is line 3439 of a file with a large header. > # This is line 3440 of a file with a large header. > # This is line 3441 of a file with a large header. > # This is line 3442 of a file with a large header. > # This is line 3443 of a file with a large header. > # This is line 3444 of a file with a large header. > # This is line 3445 of a file with a large header. > # This is line 3446 of a file with a large header. > # This is line 3447 of a file with a large header. > # This is line 3448 of a file with a large header. > # This is line 3449 of a file with a large header. > # This is line 3450 of a file with a large header. > # This is line 3451 of a file with a large header. > # This is line 3452 of a file with a large header. > # This is line 3453 of a file with a large header. > # This is line 3454 of a file with a large header. > # This is line 3455 of a file with a large header. > # This is line 3456 of a file with a large header. > # This is line 3457 of a file with a large header. > # This is line 3458 of a file with a large header. > # This is line 3459 of a file with a large header. > # This is line 3460 of a file with a large header. > # This is line 3461 of a file with a large header. > # This is line 3462 of a file with a large header. > # This is line 3463 of a file with a large header. > # This is line 3464 of a file with a large header. > # This is line 3465 of a file with a large header. > # This is line 3466 of a file with a large header. > # This is line 3467 of a file with a large header. > # This is line 3468 of a file with a large header. > # This is line 3469 of a file with a large header. > # This is line 3470 of a file with a large header. > # This is line 3471 of a file with a large header. > # This is line 3472 of a file with a large header. > # This is line 3473 of a file with a large header. > # This is line 3474 of a file with a large header. > # This is line 3475 of a file with a large header. > # This is line 3476 of a file with a large header. > # This is line 3477 of a file with a large header. > # This is line 3478 of a file with a large header. > # This is line 3479 of a file with a large header. > # This is line 3480 of a file with a large header. > # This is line 3481 of a file with a large header. > # This is line 3482 of a file with a large header. > # This is line 3483 of a file with a large header. > # This is line 3484 of a file with a large header. > # This is line 3485 of a file with a large header. > # This is line 3486 of a file with a large header. > # This is line 3487 of a file with a large header. > # This is line 3488 of a file with a large header. > # This is line 3489 of a file with a large header. > # This is line 3490 of a file with a large header. > # This is line 3491 of a file with a large header. > # This is line 3492 of a file with a large header. > # This is line 3493 of a file with a large header. > # This is line 3494 of a file with a large header. > # This is line 3495 of a file with a large header. > # This is line 3496 of a file with a large header. > # This is line 3497 of a file with a large header. > # This is line 3498 of a file with a large header. > # This is line 3499 of a file with a large header. > # This is line 3500 of a file with a large header. > # This is line 3501 of a file with a large header. > # This is line 3502 of a file with a large header. > # This is line 3503 of a file with a large header. > # This is line 3504 of a file with a large header. > # This is line 3505 of a file with a large header. > # This is line 3506 of a file with a large header. > # This is line 3507 of a file with a large header. > # This is line 3508 of a file with a large header. > # This is line 3509 of a file with a large header. > # This is line 3510 of a file with a large header. > # This is line 3511 of a file with a large header. > # This is line 3512 of a file with a large header. > # This is line 3513 of a file with a large header. > # This is line 3514 of a file with a large header. > # This is line 3515 of a file with a large header. > # This is line 3516 of a file with a large header. > # This is line 3517 of a file with a large header. > # This is line 3518 of a file with a large header. > # This is line 3519 of a file with a large header. > # This is line 3520 of a file with a large header. > # This is line 3521 of a file with a large header. > # This is line 3522 of a file with a large header. > # This is line 3523 of a file with a large header. > # This is line 3524 of a file with a large header. > # This is line 3525 of a file with a large header. > # This is line 3526 of a file with a large header. > # This is line 3527 of a file with a large header. > # This is line 3528 of a file with a large header. > # This is line 3529 of a file with a large header. > # This is line 3530 of a file with a large header. > # This is line 3531 of a file with a large header. > # This is line 3532 of a file with a large header. > # This is line 3533 of a file with a large header. > # This is line 3534 of a file with a large header. > # This is line 3535 of a file with a large header. > # This is line 3536 of a file with a large header. > # This is line 3537 of a file with a large header. > # This is line 3538 of a file with a large header. > # This is line 3539 of a file with a large header. > # This is line 3540 of a file with a large header. > # This is line 3541 of a file with a large header. > # This is line 3542 of a file with a large header. > # This is line 3543 of a file with a large header. > # This is line 3544 of a file with a large header. > # This is line 3545 of a file with a large header. > # This is line 3546 of a file with a large header. > # This is line 3547 of a file with a large header. > # This is line 3548 of a file with a large header. > # This is line 3549 of a file with a large header. > # This is line 3550 of a file with a large header. > # This is line 3551 of a file with a large header. > # This is line 3552 of a file with a large header. > # This is line 3553 of a file with a large header. > # This is line 3554 of a file with a large header. > # This is line 3555 of a file with a large header. > # This is line 3556 of a file with a large header. > # This is line 3557 of a file with a large header. > # This is line 3558 of a file with a large header. > # This is line 3559 of a file with a large header. > # This is line 3560 of a file with a large header. > # This is line 3561 of a file with a large header. > # This is line 3562 of a file with a large header. > # This is line 3563 of a file with a large header. > # This is line 3564 of a file with a large header. > # This is line 3565 of a file with a large header. > # This is line 3566 of a file with a large header. > # This is line 3567 of a file with a large header. > # This is line 3568 of a file with a large header. > # This is line 3569 of a file with a large header. > # This is line 3570 of a file with a large header. > # This is line 3571 of a file with a large header. > # This is line 3572 of a file with a large header. > # This is line 3573 of a file with a large header. > # This is line 3574 of a file with a large header. > # This is line 3575 of a file with a large header. > # This is line 3576 of a file with a large header. > # This is line 3577 of a file with a large header. > # This is line 3578 of a file with a large header. > # This is line 3579 of a file with a large header. > # This is line 3580 of a file with a large header. > # This is line 3581 of a file with a large header. > # This is line 3582 of a file with a large header. > # This is line 3583 of a file with a large header. > # This is line 3584 of a file with a large header. > # This is line 3585 of a file with a large header. > # This is line 3586 of a file with a large header. > # This is line 3587 of a file with a large header. > # This is line 3588 of a file with a large header. > # This is line 3589 of a file with a large header. > # This is line 3590 of a file with a large header. > # This is line 3591 of a file with a large header. > # This is line 3592 of a file with a large header. > # This is line 3593 of a file with a large header. > # This is line 3594 of a file with a large header. > # This is line 3595 of a file with a large header. > # This is line 3596 of a file with a large header. > # This is line 3597 of a file with a large header. > # This is line 3598 of a file with a large header. > # This is line 3599 of a file with a large header. > # This is line 3600 of a file with a large header. > # This is line 3601 of a file with a large header. > # This is line 3602 of a file with a large header. > # This is line 3603 of a file with a large header. > # This is line 3604 of a file with a large header. > # This is line 3605 of a file with a large header. > # This is line 3606 of a file with a large header. > # This is line 3607 of a file with a large header. > # This is line 3608 of a file with a large header. > # This is line 3609 of a file with a large header. > # This is line 3610 of a file with a large header. > # This is line 3611 of a file with a large header. > # This is line 3612 of a file with a large header. > # This is line 3613 of a file with a large header. > # This is line 3614 of a file with a large header. > # This is line 3615 of a file with a large header. > # This is line 3616 of a file with a large header. > # This is line 3617 of a file with a large header. > # This is line 3618 of a file with a large header. > # This is line 3619 of a file with a large header. > # This is line 3620 of a file with a large header. > # This is line 3621 of a file with a large header. > # This is line 3622 of a file with a large header. > # This is line 3623 of a file with a large header. > # This is line 3624 of a file with a large header. > # This is line 3625 of a file with a large header. > # This is line 3626 of a file with a large header. > # This is line 3627 of a file with a large header. > # This is line 3628 of a file with a large header. > # This is line 3629 of a file with a large header. > # This is line 3630 of a file with a large header. > # This is line 3631 of a file with a large header. > # This is line 3632 of a file with a large header. > # This is line 3633 of a file with a large header. > # This is line 3634 of a file with a large header. > # This is line 3635 of a file with a large header. > # This is line 3636 of a file with a large header. > # This is line 3637 of a file with a large header. > # This is line 3638 of a file with a large header. > # This is line 3639 of a file with a large header. > # This is line 3640 of a file with a large header. > # This is line 3641 of a file with a large header. > # This is line 3642 of a file with a large header. > # This is line 3643 of a file with a large header. > # This is line 3644 of a file with a large header. > # This is line 3645 of a file with a large header. > # This is line 3646 of a file with a large header. > # This is line 3647 of a file with a large header. > # This is line 3648 of a file with a large header. > # This is line 3649 of a file with a large header. > # This is line 3650 of a file with a large header. > # This is line 3651 of a file with a large header. > # This is line 3652 of a file with a large header. > # This is line 3653 of a file with a large header. > # This is line 3654 of a file with a large header. > # This is line 3655 of a file with a large header. > # This is line 3656 of a file with a large header. > # This is line 3657 of a file with a large header. > # This is line 3658 of a file with a large header. > # This is line 3659 of a file with a large header. > # This is line 3660 of a file with a large header. > # This is line 3661 of a file with a large header. > # This is line 3662 of a file with a large header. > # This is line 3663 of a file with a large header. > # This is line 3664 of a file with a large header. > # This is line 3665 of a file with a large header. > # This is line 3666 of a file with a large header. > # This is line 3667 of a file with a large header. > # This is line 3668 of a file with a large header. > # This is line 3669 of a file with a large header. > # This is line 3670 of a file with a large header. > # This is line 3671 of a file with a large header. > # This is line 3672 of a file with a large header. > # This is line 3673 of a file with a large header. > # This is line 3674 of a file with a large header. > # This is line 3675 of a file with a large header. > # This is line 3676 of a file with a large header. > # This is line 3677 of a file with a large header. > # This is line 3678 of a file with a large header. > # This is line 3679 of a file with a large header. > # This is line 3680 of a file with a large header. > # This is line 3681 of a file with a large header. > # This is line 3682 of a file with a large header. > # This is line 3683 of a file with a large header. > # This is line 3684 of a file with a large header. > # This is line 3685 of a file with a large header. > # This is line 3686 of a file with a large header. > # This is line 3687 of a file with a large header. > # This is line 3688 of a file with a large header. > # This is line 3689 of a file with a large header. > # This is line 3690 of a file with a large header. > # This is line 3691 of a file with a large header. > # This is line 3692 of a file with a large header. > # This is line 3693 of a file with a large header. > # This is line 3694 of a file with a large header. > # This is line 3695 of a file with a large header. > # This is line 3696 of a file with a large header. > # This is line 3697 of a file with a large header. > # This is line 3698 of a file with a large header. > # This is line 3699 of a file with a large header. > # This is line 3700 of a file with a large header. > # This is line 3701 of a file with a large header. > # This is line 3702 of a file with a large header. > # This is line 3703 of a file with a large header. > # This is line 3704 of a file with a large header. > # This is line 3705 of a file with a large header. > # This is line 3706 of a file with a large header. > # This is line 3707 of a file with a large header. > # This is line 3708 of a file with a large header. > # This is line 3709 of a file with a large header. > # This is line 3710 of a file with a large header. > # This is line 3711 of a file with a large header. > # This is line 3712 of a file with a large header. > # This is line 3713 of a file with a large header. > # This is line 3714 of a file with a large header. > # This is line 3715 of a file with a large header. > # This is line 3716 of a file with a large header. > # This is line 3717 of a file with a large header. > # This is line 3718 of a file with a large header. > # This is line 3719 of a file with a large header. > # This is line 3720 of a file with a large header. > # This is line 3721 of a file with a large header. > # This is line 3722 of a file with a large header. > # This is line 3723 of a file with a large header. > # This is line 3724 of a file with a large header. > # This is line 3725 of a file with a large header. > # This is line 3726 of a file with a large header. > # This is line 3727 of a file with a large header. > # This is line 3728 of a file with a large header. > # This is line 3729 of a file with a large header. > # This is line 3730 of a file with a large header. > # This is line 3731 of a file with a large header. > # This is line 3732 of a file with a large header. > # This is line 3733 of a file with a large header. > # This is line 3734 of a file with a large header. > # This is line 3735 of a file with a large header. > # This is line 3736 of a file with a large header. > # This is line 3737 of a file with a large header. > # This is line 3738 of a file with a large header. > # This is line 3739 of a file with a large header. > # This is line 3740 of a file with a large header. > # This is line 3741 of a file with a large header. > # This is line 3742 of a file with a large header. > # This is line 3743 of a file with a large header. > # This is line 3744 of a file with a large header. > # This is line 3745 of a file with a large header. > # This is line 3746 of a file with a large header. > # This is line 3747 of a file with a large header. > # This is line 3748 of a file with a large header. > # This is line 3749 of a file with a large header. > # This is line 3750 of a file with a large header. > # This is line 3751 of a file with a large header. > # This is line 3752 of a file with a large header. > # This is line 3753 of a file with a large header. > # This is line 3754 of a file with a large header. > # This is line 3755 of a file with a large header. > # This is line 3756 of a file with a large header. > # This is line 3757 of a file with a large header. > # This is line 3758 of a file with a large header. > # This is line 3759 of a file with a large header. > # This is line 3760 of a file with a large header. > # This is line 3761 of a file with a large header. > # This is line 3762 of a file with a large header. > # This is line 3763 of a file with a large header. > # This is line 3764 of a file with a large header. > # This is line 3765 of a file with a large header. > # This is line 3766 of a file with a large header. > # This is line 3767 of a file with a large header. > # This is line 3768 of a file with a large header. > # This is line 3769 of a file with a large header. > # This is line 3770 of a file with a large header. > # This is line 3771 of a file with a large header. > # This is line 3772 of a file with a large header. > # This is line 3773 of a file with a large header. > # This is line 3774 of a file with a large header. > # This is line 3775 of a file with a large header. > # This is line 3776 of a file with a large header. > # This is line 3777 of a file with a large header. > # This is line 3778 of a file with a large header. > # This is line 3779 of a file with a large header. > # This is line 3780 of a file with a large header. > # This is line 3781 of a file with a large header. > # This is line 3782 of a file with a large header. > # This is line 3783 of a file with a large header. > # This is line 3784 of a file with a large header. > # This is line 3785 of a file with a large header. > # This is line 3786 of a file with a large header. > # This is line 3787 of a file with a large header. > # This is line 3788 of a file with a large header. > # This is line 3789 of a file with a large header. > # This is line 3790 of a file with a large header. > # This is line 3791 of a file with a large header. > # This is line 3792 of a file with a large header. > # This is line 3793 of a file with a large header. > # This is line 3794 of a file with a large header. > # This is line 3795 of a file with a large header. > # This is line 3796 of a file with a large header. > # This is line 3797 of a file with a large header. > # This is line 3798 of a file with a large header. > # This is line 3799 of a file with a large header. > # This is line 3800 of a file with a large header. > # This is line 3801 of a file with a large header. > # This is line 3802 of a file with a large header. > # This is line 3803 of a file with a large header. > # This is line 3804 of a file with a large header. > # This is line 3805 of a file with a large header. > # This is line 3806 of a file with a large header. > # This is line 3807 of a file with a large header. > # This is line 3808 of a file with a large header. > # This is line 3809 of a file with a large header. > # This is line 3810 of a file with a large header. > # This is line 3811 of a file with a large header. > # This is line 3812 of a file with a large header. > # This is line 3813 of a file with a large header. > # This is line 3814 of a file with a large header. > # This is line 3815 of a file with a large header. > # This is line 3816 of a file with a large header. > # This is line 3817 of a file with a large header. > # This is line 3818 of a file with a large header. > # This is line 3819 of a file with a large header. > # This is line 3820 of a file with a large header. > # This is line 3821 of a file with a large header. > # This is line 3822 of a file with a large header. > # This is line 3823 of a file with a large header. > # This is line 3824 of a file with a large header. > # This is line 3825 of a file with a large header. > # This is line 3826 of a file with a large header. > # This is line 3827 of a file with a large header. > # This is line 3828 of a file with a large header. > # This is line 3829 of a file with a large header. > # This is line 3830 of a file with a large header. > # This is line 3831 of a file with a large header. > # This is line 3832 of a file with a large header. > # This is line 3833 of a file with a large header. > # This is line 3834 of a file with a large header. > # This is line 3835 of a file with a large header. > # This is line 3836 of a file with a large header. > # This is line 3837 of a file with a large header. > # This is line 3838 of a file with a large header. > # This is line 3839 of a file with a large header. > # This is line 3840 of a file with a large header. > # This is line 3841 of a file with a large header. > # This is line 3842 of a file with a large header. > # This is line 3843 of a file with a large header. > # This is line 3844 of a file with a large header. > # This is line 3845 of a file with a large header. > # This is line 3846 of a file with a large header. > # This is line 3847 of a file with a large header. > # This is line 3848 of a file with a large header. > # This is line 3849 of a file with a large header. > # This is line 3850 of a file with a large header. > # This is line 3851 of a file with a large header. > # This is line 3852 of a file with a large header. > # This is line 3853 of a file with a large header. > # This is line 3854 of a file with a large header. > # This is line 3855 of a file with a large header. > # This is line 3856 of a file with a large header. > # This is line 3857 of a file with a large header. > # This is line 3858 of a file with a large header. > # This is line 3859 of a file with a large header. > # This is line 3860 of a file with a large header. > # This is line 3861 of a file with a large header. > # This is line 3862 of a file with a large header. > # This is line 3863 of a file with a large header. > # This is line 3864 of a file with a large header. > # This is line 3865 of a file with a large header. > # This is line 3866 of a file with a large header. > # This is line 3867 of a file with a large header. > # This is line 3868 of a file with a large header. > # This is line 3869 of a file with a large header. > # This is line 3870 of a file with a large header. > # This is line 3871 of a file with a large header. > # This is line 3872 of a file with a large header. > # This is line 3873 of a file with a large header. > # This is line 3874 of a file with a large header. > # This is line 3875 of a file with a large header. > # This is line 3876 of a file with a large header. > # This is line 3877 of a file with a large header. > # This is line 3878 of a file with a large header. > # This is line 3879 of a file with a large header. > # This is line 3880 of a file with a large header. > # This is line 3881 of a file with a large header. > # This is line 3882 of a file with a large header. > # This is line 3883 of a file with a large header. > # This is line 3884 of a file with a large header. > # This is line 3885 of a file with a large header. > # This is line 3886 of a file with a large header. > # This is line 3887 of a file with a large header. > # This is line 3888 of a file with a large header. > # This is line 3889 of a file with a large header. > # This is line 3890 of a file with a large header. > # This is line 3891 of a file with a large header. > # This is line 3892 of a file with a large header. > # This is line 3893 of a file with a large header. > # This is line 3894 of a file with a large header. > # This is line 3895 of a file with a large header. > # This is line 3896 of a file with a large header. > # This is line 3897 of a file with a large header. > # This is line 3898 of a file with a large header. > # This is line 3899 of a file with a large header. > # This is line 3900 of a file with a large header. > # This is line 3901 of a file with a large header. > # This is line 3902 of a file with a large header. > # This is line 3903 of a file with a large header. > # This is line 3904 of a file with a large header. > # This is line 3905 of a file with a large header. > # This is line 3906 of a file with a large header. > # This is line 3907 of a file with a large header. > # This is line 3908 of a file with a large header. > # This is line 3909 of a file with a large header. > # This is line 3910 of a file with a large header. > # This is line 3911 of a file with a large header. > # This is line 3912 of a file with a large header. > # This is line 3913 of a file with a large header. > # This is line 3914 of a file with a large header. > # This is line 3915 of a file with a large header. > # This is line 3916 of a file with a large header. > # This is line 3917 of a file with a large header. > # This is line 3918 of a file with a large header. > # This is line 3919 of a file with a large header. > # This is line 3920 of a file with a large header. > # This is line 3921 of a file with a large header. > # This is line 3922 of a file with a large header. > # This is line 3923 of a file with a large header. > # This is line 3924 of a file with a large header. > # This is line 3925 of a file with a large header. > # This is line 3926 of a file with a large header. > # This is line 3927 of a file with a large header. > # This is line 3928 of a file with a large header. > # This is line 3929 of a file with a large header. > # This is line 3930 of a file with a large header. > # This is line 3931 of a file with a large header. > # This is line 3932 of a file with a large header. > # This is line 3933 of a file with a large header. > # This is line 3934 of a file with a large header. > # This is line 3935 of a file with a large header. > # This is line 3936 of a file with a large header. > # This is line 3937 of a file with a large header. > # This is line 3938 of a file with a large header. > # This is line 3939 of a file with a large header. > # This is line 3940 of a file with a large header. > # This is line 3941 of a file with a large header. > # This is line 3942 of a file with a large header. > # This is line 3943 of a file with a large header. > # This is line 3944 of a file with a large header. > # This is line 3945 of a file with a large header. > # This is line 3946 of a file with a large header. > # This is line 3947 of a file with a large header. > # This is line 3948 of a file with a large header. > # This is line 3949 of a file with a large header. > # This is line 3950 of a file with a large header. > # This is line 3951 of a file with a large header. > # This is line 3952 of a file with a large header. > # This is line 3953 of a file with a large header. > # This is line 3954 of a file with a large header. > # This is line 3955 of a file with a large header. > # This is line 3956 of a file with a large header. > # This is line 3957 of a file with a large header. > # This is line 3958 of a file with a large header. > # This is line 3959 of a file with a large header. > # This is line 3960 of a file with a large header. > # This is line 3961 of a file with a large header. > # This is line 3962 of a file with a large header. > # This is line 3963 of a file with a large header. > # This is line 3964 of a file with a large header. > # This is line 3965 of a file with a large header. > # This is line 3966 of a file with a large header. > # This is line 3967 of a file with a large header. > # This is line 3968 of a file with a large header. > # This is line 3969 of a file with a large header. > # This is line 3970 of a file with a large header. > # This is line 3971 of a file with a large header. > # This is line 3972 of a file with a large header. > # This is line 3973 of a file with a large header. > # This is line 3974 of a file with a large header. > # This is line 3975 of a file with a large header. > # This is line 3976 of a file with a large header. > # This is line 3977 of a file with a large header. > # This is line 3978 of a file with a large header. > # This is line 3979 of a file with a large header. > # This is line 3980 of a file with a large header. > # This is line 3981 of a file with a large header. > # This is line 3982 of a file with a large header. > # This is line 3983 of a file with a large header. > # This is line 3984 of a file with a large header. > # This is line 3985 of a file with a large header. > # This is line 3986 of a file with a large header. > # This is line 3987 of a file with a large header. > # This is line 3988 of a file with a large header. > # This is line 3989 of a file with a large header. > # This is line 3990 of a file with a large header. > # This is line 3991 of a file with a large header. > # This is line 3992 of a file with a large header. > # This is line 3993 of a file with a large header. > # This is line 3994 of a file with a large header. > # This is line 3995 of a file with a large header. > # This is line 3996 of a file with a large header. > # This is line 3997 of a file with a large header. > # This is line 3998 of a file with a large header. > # This is line 3999 of a file with a large header. > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t45...\c 0a1,4002 > # This is line 0 of a file with a large header. > # This is line 1 of a file with a large header. > # This is line 2 of a file with a large header. > # This is line 3 of a file with a large header. > # This is line 4 of a file with a large header. > # This is line 5 of a file with a large header. > # This is line 6 of a file with a large header. > # This is line 7 of a file with a large header. > # This is line 8 of a file with a large header. > # This is line 9 of a file with a large header. > # This is line 10 of a file with a large header. > # This is line 11 of a file with a large header. > # This is line 12 of a file with a large header. > # This is line 13 of a file with a large header. > # This is line 14 of a file with a large header. > # This is line 15 of a file with a large header. > # This is line 16 of a file with a large header. > # This is line 17 of a file with a large header. > # This is line 18 of a file with a large header. > # This is line 19 of a file with a large header. > # This is line 20 of a file with a large header. > # This is line 21 of a file with a large header. > # This is line 22 of a file with a large header. > # This is line 23 of a file with a large header. > # This is line 24 of a file with a large header. > # This is line 25 of a file with a large header. > # This is line 26 of a file with a large header. > # This is line 27 of a file with a large header. > # This is line 28 of a file with a large header. > # This is line 29 of a file with a large header. > # This is line 30 of a file with a large header. > # This is line 31 of a file with a large header. > # This is line 32 of a file with a large header. > # This is line 33 of a file with a large header. > # This is line 34 of a file with a large header. > # This is line 35 of a file with a large header. > # This is line 36 of a file with a large header. > # This is line 37 of a file with a large header. > # This is line 38 of a file with a large header. > # This is line 39 of a file with a large header. > # This is line 40 of a file with a large header. > # This is line 41 of a file with a large header. > # This is line 42 of a file with a large header. > # This is line 43 of a file with a large header. > # This is line 44 of a file with a large header. > # This is line 45 of a file with a large header. > # This is line 46 of a file with a large header. > # This is line 47 of a file with a large header. > # This is line 48 of a file with a large header. > # This is line 49 of a file with a large header. > # This is line 50 of a file with a large header. > # This is line 51 of a file with a large header. > # This is line 52 of a file with a large header. > # This is line 53 of a file with a large header. > # This is line 54 of a file with a large header. > # This is line 55 of a file with a large header. > # This is line 56 of a file with a large header. > # This is line 57 of a file with a large header. > # This is line 58 of a file with a large header. > # This is line 59 of a file with a large header. > # This is line 60 of a file with a large header. > # This is line 61 of a file with a large header. > # This is line 62 of a file with a large header. > # This is line 63 of a file with a large header. > # This is line 64 of a file with a large header. > # This is line 65 of a file with a large header. > # This is line 66 of a file with a large header. > # This is line 67 of a file with a large header. > # This is line 68 of a file with a large header. > # This is line 69 of a file with a large header. > # This is line 70 of a file with a large header. > # This is line 71 of a file with a large header. > # This is line 72 of a file with a large header. > # This is line 73 of a file with a large header. > # This is line 74 of a file with a large header. > # This is line 75 of a file with a large header. > # This is line 76 of a file with a large header. > # This is line 77 of a file with a large header. > # This is line 78 of a file with a large header. > # This is line 79 of a file with a large header. > # This is line 80 of a file with a large header. > # This is line 81 of a file with a large header. > # This is line 82 of a file with a large header. > # This is line 83 of a file with a large header. > # This is line 84 of a file with a large header. > # This is line 85 of a file with a large header. > # This is line 86 of a file with a large header. > # This is line 87 of a file with a large header. > # This is line 88 of a file with a large header. > # This is line 89 of a file with a large header. > # This is line 90 of a file with a large header. > # This is line 91 of a file with a large header. > # This is line 92 of a file with a large header. > # This is line 93 of a file with a large header. > # This is line 94 of a file with a large header. > # This is line 95 of a file with a large header. > # This is line 96 of a file with a large header. > # This is line 97 of a file with a large header. > # This is line 98 of a file with a large header. > # This is line 99 of a file with a large header. > # This is line 100 of a file with a large header. > # This is line 101 of a file with a large header. > # This is line 102 of a file with a large header. > # This is line 103 of a file with a large header. > # This is line 104 of a file with a large header. > # This is line 105 of a file with a large header. > # This is line 106 of a file with a large header. > # This is line 107 of a file with a large header. > # This is line 108 of a file with a large header. > # This is line 109 of a file with a large header. > # This is line 110 of a file with a large header. > # This is line 111 of a file with a large header. > # This is line 112 of a file with a large header. > # This is line 113 of a file with a large header. > # This is line 114 of a file with a large header. > # This is line 115 of a file with a large header. > # This is line 116 of a file with a large header. > # This is line 117 of a file with a large header. > # This is line 118 of a file with a large header. > # This is line 119 of a file with a large header. > # This is line 120 of a file with a large header. > # This is line 121 of a file with a large header. > # This is line 122 of a file with a large header. > # This is line 123 of a file with a large header. > # This is line 124 of a file with a large header. > # This is line 125 of a file with a large header. > # This is line 126 of a file with a large header. > # This is line 127 of a file with a large header. > # This is line 128 of a file with a large header. > # This is line 129 of a file with a large header. > # This is line 130 of a file with a large header. > # This is line 131 of a file with a large header. > # This is line 132 of a file with a large header. > # This is line 133 of a file with a large header. > # This is line 134 of a file with a large header. > # This is line 135 of a file with a large header. > # This is line 136 of a file with a large header. > # This is line 137 of a file with a large header. > # This is line 138 of a file with a large header. > # This is line 139 of a file with a large header. > # This is line 140 of a file with a large header. > # This is line 141 of a file with a large header. > # This is line 142 of a file with a large header. > # This is line 143 of a file with a large header. > # This is line 144 of a file with a large header. > # This is line 145 of a file with a large header. > # This is line 146 of a file with a large header. > # This is line 147 of a file with a large header. > # This is line 148 of a file with a large header. > # This is line 149 of a file with a large header. > # This is line 150 of a file with a large header. > # This is line 151 of a file with a large header. > # This is line 152 of a file with a large header. > # This is line 153 of a file with a large header. > # This is line 154 of a file with a large header. > # This is line 155 of a file with a large header. > # This is line 156 of a file with a large header. > # This is line 157 of a file with a large header. > # This is line 158 of a file with a large header. > # This is line 159 of a file with a large header. > # This is line 160 of a file with a large header. > # This is line 161 of a file with a large header. > # This is line 162 of a file with a large header. > # This is line 163 of a file with a large header. > # This is line 164 of a file with a large header. > # This is line 165 of a file with a large header. > # This is line 166 of a file with a large header. > # This is line 167 of a file with a large header. > # This is line 168 of a file with a large header. > # This is line 169 of a file with a large header. > # This is line 170 of a file with a large header. > # This is line 171 of a file with a large header. > # This is line 172 of a file with a large header. > # This is line 173 of a file with a large header. > # This is line 174 of a file with a large header. > # This is line 175 of a file with a large header. > # This is line 176 of a file with a large header. > # This is line 177 of a file with a large header. > # This is line 178 of a file with a large header. > # This is line 179 of a file with a large header. > # This is line 180 of a file with a large header. > # This is line 181 of a file with a large header. > # This is line 182 of a file with a large header. > # This is line 183 of a file with a large header. > # This is line 184 of a file with a large header. > # This is line 185 of a file with a large header. > # This is line 186 of a file with a large header. > # This is line 187 of a file with a large header. > # This is line 188 of a file with a large header. > # This is line 189 of a file with a large header. > # This is line 190 of a file with a large header. > # This is line 191 of a file with a large header. > # This is line 192 of a file with a large header. > # This is line 193 of a file with a large header. > # This is line 194 of a file with a large header. > # This is line 195 of a file with a large header. > # This is line 196 of a file with a large header. > # This is line 197 of a file with a large header. > # This is line 198 of a file with a large header. > # This is line 199 of a file with a large header. > # This is line 200 of a file with a large header. > # This is line 201 of a file with a large header. > # This is line 202 of a file with a large header. > # This is line 203 of a file with a large header. > # This is line 204 of a file with a large header. > # This is line 205 of a file with a large header. > # This is line 206 of a file with a large header. > # This is line 207 of a file with a large header. > # This is line 208 of a file with a large header. > # This is line 209 of a file with a large header. > # This is line 210 of a file with a large header. > # This is line 211 of a file with a large header. > # This is line 212 of a file with a large header. > # This is line 213 of a file with a large header. > # This is line 214 of a file with a large header. > # This is line 215 of a file with a large header. > # This is line 216 of a file with a large header. > # This is line 217 of a file with a large header. > # This is line 218 of a file with a large header. > # This is line 219 of a file with a large header. > # This is line 220 of a file with a large header. > # This is line 221 of a file with a large header. > # This is line 222 of a file with a large header. > # This is line 223 of a file with a large header. > # This is line 224 of a file with a large header. > # This is line 225 of a file with a large header. > # This is line 226 of a file with a large header. > # This is line 227 of a file with a large header. > # This is line 228 of a file with a large header. > # This is line 229 of a file with a large header. > # This is line 230 of a file with a large header. > # This is line 231 of a file with a large header. > # This is line 232 of a file with a large header. > # This is line 233 of a file with a large header. > # This is line 234 of a file with a large header. > # This is line 235 of a file with a large header. > # This is line 236 of a file with a large header. > # This is line 237 of a file with a large header. > # This is line 238 of a file with a large header. > # This is line 239 of a file with a large header. > # This is line 240 of a file with a large header. > # This is line 241 of a file with a large header. > # This is line 242 of a file with a large header. > # This is line 243 of a file with a large header. > # This is line 244 of a file with a large header. > # This is line 245 of a file with a large header. > # This is line 246 of a file with a large header. > # This is line 247 of a file with a large header. > # This is line 248 of a file with a large header. > # This is line 249 of a file with a large header. > # This is line 250 of a file with a large header. > # This is line 251 of a file with a large header. > # This is line 252 of a file with a large header. > # This is line 253 of a file with a large header. > # This is line 254 of a file with a large header. > # This is line 255 of a file with a large header. > # This is line 256 of a file with a large header. > # This is line 257 of a file with a large header. > # This is line 258 of a file with a large header. > # This is line 259 of a file with a large header. > # This is line 260 of a file with a large header. > # This is line 261 of a file with a large header. > # This is line 262 of a file with a large header. > # This is line 263 of a file with a large header. > # This is line 264 of a file with a large header. > # This is line 265 of a file with a large header. > # This is line 266 of a file with a large header. > # This is line 267 of a file with a large header. > # This is line 268 of a file with a large header. > # This is line 269 of a file with a large header. > # This is line 270 of a file with a large header. > # This is line 271 of a file with a large header. > # This is line 272 of a file with a large header. > # This is line 273 of a file with a large header. > # This is line 274 of a file with a large header. > # This is line 275 of a file with a large header. > # This is line 276 of a file with a large header. > # This is line 277 of a file with a large header. > # This is line 278 of a file with a large header. > # This is line 279 of a file with a large header. > # This is line 280 of a file with a large header. > # This is line 281 of a file with a large header. > # This is line 282 of a file with a large header. > # This is line 283 of a file with a large header. > # This is line 284 of a file with a large header. > # This is line 285 of a file with a large header. > # This is line 286 of a file with a large header. > # This is line 287 of a file with a large header. > # This is line 288 of a file with a large header. > # This is line 289 of a file with a large header. > # This is line 290 of a file with a large header. > # This is line 291 of a file with a large header. > # This is line 292 of a file with a large header. > # This is line 293 of a file with a large header. > # This is line 294 of a file with a large header. > # This is line 295 of a file with a large header. > # This is line 296 of a file with a large header. > # This is line 297 of a file with a large header. > # This is line 298 of a file with a large header. > # This is line 299 of a file with a large header. > # This is line 300 of a file with a large header. > # This is line 301 of a file with a large header. > # This is line 302 of a file with a large header. > # This is line 303 of a file with a large header. > # This is line 304 of a file with a large header. > # This is line 305 of a file with a large header. > # This is line 306 of a file with a large header. > # This is line 307 of a file with a large header. > # This is line 308 of a file with a large header. > # This is line 309 of a file with a large header. > # This is line 310 of a file with a large header. > # This is line 311 of a file with a large header. > # This is line 312 of a file with a large header. > # This is line 313 of a file with a large header. > # This is line 314 of a file with a large header. > # This is line 315 of a file with a large header. > # This is line 316 of a file with a large header. > # This is line 317 of a file with a large header. > # This is line 318 of a file with a large header. > # This is line 319 of a file with a large header. > # This is line 320 of a file with a large header. > # This is line 321 of a file with a large header. > # This is line 322 of a file with a large header. > # This is line 323 of a file with a large header. > # This is line 324 of a file with a large header. > # This is line 325 of a file with a large header. > # This is line 326 of a file with a large header. > # This is line 327 of a file with a large header. > # This is line 328 of a file with a large header. > # This is line 329 of a file with a large header. > # This is line 330 of a file with a large header. > # This is line 331 of a file with a large header. > # This is line 332 of a file with a large header. > # This is line 333 of a file with a large header. > # This is line 334 of a file with a large header. > # This is line 335 of a file with a large header. > # This is line 336 of a file with a large header. > # This is line 337 of a file with a large header. > # This is line 338 of a file with a large header. > # This is line 339 of a file with a large header. > # This is line 340 of a file with a large header. > # This is line 341 of a file with a large header. > # This is line 342 of a file with a large header. > # This is line 343 of a file with a large header. > # This is line 344 of a file with a large header. > # This is line 345 of a file with a large header. > # This is line 346 of a file with a large header. > # This is line 347 of a file with a large header. > # This is line 348 of a file with a large header. > # This is line 349 of a file with a large header. > # This is line 350 of a file with a large header. > # This is line 351 of a file with a large header. > # This is line 352 of a file with a large header. > # This is line 353 of a file with a large header. > # This is line 354 of a file with a large header. > # This is line 355 of a file with a large header. > # This is line 356 of a file with a large header. > # This is line 357 of a file with a large header. > # This is line 358 of a file with a large header. > # This is line 359 of a file with a large header. > # This is line 360 of a file with a large header. > # This is line 361 of a file with a large header. > # This is line 362 of a file with a large header. > # This is line 363 of a file with a large header. > # This is line 364 of a file with a large header. > # This is line 365 of a file with a large header. > # This is line 366 of a file with a large header. > # This is line 367 of a file with a large header. > # This is line 368 of a file with a large header. > # This is line 369 of a file with a large header. > # This is line 370 of a file with a large header. > # This is line 371 of a file with a large header. > # This is line 372 of a file with a large header. > # This is line 373 of a file with a large header. > # This is line 374 of a file with a large header. > # This is line 375 of a file with a large header. > # This is line 376 of a file with a large header. > # This is line 377 of a file with a large header. > # This is line 378 of a file with a large header. > # This is line 379 of a file with a large header. > # This is line 380 of a file with a large header. > # This is line 381 of a file with a large header. > # This is line 382 of a file with a large header. > # This is line 383 of a file with a large header. > # This is line 384 of a file with a large header. > # This is line 385 of a file with a large header. > # This is line 386 of a file with a large header. > # This is line 387 of a file with a large header. > # This is line 388 of a file with a large header. > # This is line 389 of a file with a large header. > # This is line 390 of a file with a large header. > # This is line 391 of a file with a large header. > # This is line 392 of a file with a large header. > # This is line 393 of a file with a large header. > # This is line 394 of a file with a large header. > # This is line 395 of a file with a large header. > # This is line 396 of a file with a large header. > # This is line 397 of a file with a large header. > # This is line 398 of a file with a large header. > # This is line 399 of a file with a large header. > # This is line 400 of a file with a large header. > # This is line 401 of a file with a large header. > # This is line 402 of a file with a large header. > # This is line 403 of a file with a large header. > # This is line 404 of a file with a large header. > # This is line 405 of a file with a large header. > # This is line 406 of a file with a large header. > # This is line 407 of a file with a large header. > # This is line 408 of a file with a large header. > # This is line 409 of a file with a large header. > # This is line 410 of a file with a large header. > # This is line 411 of a file with a large header. > # This is line 412 of a file with a large header. > # This is line 413 of a file with a large header. > # This is line 414 of a file with a large header. > # This is line 415 of a file with a large header. > # This is line 416 of a file with a large header. > # This is line 417 of a file with a large header. > # This is line 418 of a file with a large header. > # This is line 419 of a file with a large header. > # This is line 420 of a file with a large header. > # This is line 421 of a file with a large header. > # This is line 422 of a file with a large header. > # This is line 423 of a file with a large header. > # This is line 424 of a file with a large header. > # This is line 425 of a file with a large header. > # This is line 426 of a file with a large header. > # This is line 427 of a file with a large header. > # This is line 428 of a file with a large header. > # This is line 429 of a file with a large header. > # This is line 430 of a file with a large header. > # This is line 431 of a file with a large header. > # This is line 432 of a file with a large header. > # This is line 433 of a file with a large header. > # This is line 434 of a file with a large header. > # This is line 435 of a file with a large header. > # This is line 436 of a file with a large header. > # This is line 437 of a file with a large header. > # This is line 438 of a file with a large header. > # This is line 439 of a file with a large header. > # This is line 440 of a file with a large header. > # This is line 441 of a file with a large header. > # This is line 442 of a file with a large header. > # This is line 443 of a file with a large header. > # This is line 444 of a file with a large header. > # This is line 445 of a file with a large header. > # This is line 446 of a file with a large header. > # This is line 447 of a file with a large header. > # This is line 448 of a file with a large header. > # This is line 449 of a file with a large header. > # This is line 450 of a file with a large header. > # This is line 451 of a file with a large header. > # This is line 452 of a file with a large header. > # This is line 453 of a file with a large header. > # This is line 454 of a file with a large header. > # This is line 455 of a file with a large header. > # This is line 456 of a file with a large header. > # This is line 457 of a file with a large header. > # This is line 458 of a file with a large header. > # This is line 459 of a file with a large header. > # This is line 460 of a file with a large header. > # This is line 461 of a file with a large header. > # This is line 462 of a file with a large header. > # This is line 463 of a file with a large header. > # This is line 464 of a file with a large header. > # This is line 465 of a file with a large header. > # This is line 466 of a file with a large header. > # This is line 467 of a file with a large header. > # This is line 468 of a file with a large header. > # This is line 469 of a file with a large header. > # This is line 470 of a file with a large header. > # This is line 471 of a file with a large header. > # This is line 472 of a file with a large header. > # This is line 473 of a file with a large header. > # This is line 474 of a file with a large header. > # This is line 475 of a file with a large header. > # This is line 476 of a file with a large header. > # This is line 477 of a file with a large header. > # This is line 478 of a file with a large header. > # This is line 479 of a file with a large header. > # This is line 480 of a file with a large header. > # This is line 481 of a file with a large header. > # This is line 482 of a file with a large header. > # This is line 483 of a file with a large header. > # This is line 484 of a file with a large header. > # This is line 485 of a file with a large header. > # This is line 486 of a file with a large header. > # This is line 487 of a file with a large header. > # This is line 488 of a file with a large header. > # This is line 489 of a file with a large header. > # This is line 490 of a file with a large header. > # This is line 491 of a file with a large header. > # This is line 492 of a file with a large header. > # This is line 493 of a file with a large header. > # This is line 494 of a file with a large header. > # This is line 495 of a file with a large header. > # This is line 496 of a file with a large header. > # This is line 497 of a file with a large header. > # This is line 498 of a file with a large header. > # This is line 499 of a file with a large header. > # This is line 500 of a file with a large header. > # This is line 501 of a file with a large header. > # This is line 502 of a file with a large header. > # This is line 503 of a file with a large header. > # This is line 504 of a file with a large header. > # This is line 505 of a file with a large header. > # This is line 506 of a file with a large header. > # This is line 507 of a file with a large header. > # This is line 508 of a file with a large header. > # This is line 509 of a file with a large header. > # This is line 510 of a file with a large header. > # This is line 511 of a file with a large header. > # This is line 512 of a file with a large header. > # This is line 513 of a file with a large header. > # This is line 514 of a file with a large header. > # This is line 515 of a file with a large header. > # This is line 516 of a file with a large header. > # This is line 517 of a file with a large header. > # This is line 518 of a file with a large header. > # This is line 519 of a file with a large header. > # This is line 520 of a file with a large header. > # This is line 521 of a file with a large header. > # This is line 522 of a file with a large header. > # This is line 523 of a file with a large header. > # This is line 524 of a file with a large header. > # This is line 525 of a file with a large header. > # This is line 526 of a file with a large header. > # This is line 527 of a file with a large header. > # This is line 528 of a file with a large header. > # This is line 529 of a file with a large header. > # This is line 530 of a file with a large header. > # This is line 531 of a file with a large header. > # This is line 532 of a file with a large header. > # This is line 533 of a file with a large header. > # This is line 534 of a file with a large header. > # This is line 535 of a file with a large header. > # This is line 536 of a file with a large header. > # This is line 537 of a file with a large header. > # This is line 538 of a file with a large header. > # This is line 539 of a file with a large header. > # This is line 540 of a file with a large header. > # This is line 541 of a file with a large header. > # This is line 542 of a file with a large header. > # This is line 543 of a file with a large header. > # This is line 544 of a file with a large header. > # This is line 545 of a file with a large header. > # This is line 546 of a file with a large header. > # This is line 547 of a file with a large header. > # This is line 548 of a file with a large header. > # This is line 549 of a file with a large header. > # This is line 550 of a file with a large header. > # This is line 551 of a file with a large header. > # This is line 552 of a file with a large header. > # This is line 553 of a file with a large header. > # This is line 554 of a file with a large header. > # This is line 555 of a file with a large header. > # This is line 556 of a file with a large header. > # This is line 557 of a file with a large header. > # This is line 558 of a file with a large header. > # This is line 559 of a file with a large header. > # This is line 560 of a file with a large header. > # This is line 561 of a file with a large header. > # This is line 562 of a file with a large header. > # This is line 563 of a file with a large header. > # This is line 564 of a file with a large header. > # This is line 565 of a file with a large header. > # This is line 566 of a file with a large header. > # This is line 567 of a file with a large header. > # This is line 568 of a file with a large header. > # This is line 569 of a file with a large header. > # This is line 570 of a file with a large header. > # This is line 571 of a file with a large header. > # This is line 572 of a file with a large header. > # This is line 573 of a file with a large header. > # This is line 574 of a file with a large header. > # This is line 575 of a file with a large header. > # This is line 576 of a file with a large header. > # This is line 577 of a file with a large header. > # This is line 578 of a file with a large header. > # This is line 579 of a file with a large header. > # This is line 580 of a file with a large header. > # This is line 581 of a file with a large header. > # This is line 582 of a file with a large header. > # This is line 583 of a file with a large header. > # This is line 584 of a file with a large header. > # This is line 585 of a file with a large header. > # This is line 586 of a file with a large header. > # This is line 587 of a file with a large header. > # This is line 588 of a file with a large header. > # This is line 589 of a file with a large header. > # This is line 590 of a file with a large header. > # This is line 591 of a file with a large header. > # This is line 592 of a file with a large header. > # This is line 593 of a file with a large header. > # This is line 594 of a file with a large header. > # This is line 595 of a file with a large header. > # This is line 596 of a file with a large header. > # This is line 597 of a file with a large header. > # This is line 598 of a file with a large header. > # This is line 599 of a file with a large header. > # This is line 600 of a file with a large header. > # This is line 601 of a file with a large header. > # This is line 602 of a file with a large header. > # This is line 603 of a file with a large header. > # This is line 604 of a file with a large header. > # This is line 605 of a file with a large header. > # This is line 606 of a file with a large header. > # This is line 607 of a file with a large header. > # This is line 608 of a file with a large header. > # This is line 609 of a file with a large header. > # This is line 610 of a file with a large header. > # This is line 611 of a file with a large header. > # This is line 612 of a file with a large header. > # This is line 613 of a file with a large header. > # This is line 614 of a file with a large header. > # This is line 615 of a file with a large header. > # This is line 616 of a file with a large header. > # This is line 617 of a file with a large header. > # This is line 618 of a file with a large header. > # This is line 619 of a file with a large header. > # This is line 620 of a file with a large header. > # This is line 621 of a file with a large header. > # This is line 622 of a file with a large header. > # This is line 623 of a file with a large header. > # This is line 624 of a file with a large header. > # This is line 625 of a file with a large header. > # This is line 626 of a file with a large header. > # This is line 627 of a file with a large header. > # This is line 628 of a file with a large header. > # This is line 629 of a file with a large header. > # This is line 630 of a file with a large header. > # This is line 631 of a file with a large header. > # This is line 632 of a file with a large header. > # This is line 633 of a file with a large header. > # This is line 634 of a file with a large header. > # This is line 635 of a file with a large header. > # This is line 636 of a file with a large header. > # This is line 637 of a file with a large header. > # This is line 638 of a file with a large header. > # This is line 639 of a file with a large header. > # This is line 640 of a file with a large header. > # This is line 641 of a file with a large header. > # This is line 642 of a file with a large header. > # This is line 643 of a file with a large header. > # This is line 644 of a file with a large header. > # This is line 645 of a file with a large header. > # This is line 646 of a file with a large header. > # This is line 647 of a file with a large header. > # This is line 648 of a file with a large header. > # This is line 649 of a file with a large header. > # This is line 650 of a file with a large header. > # This is line 651 of a file with a large header. > # This is line 652 of a file with a large header. > # This is line 653 of a file with a large header. > # This is line 654 of a file with a large header. > # This is line 655 of a file with a large header. > # This is line 656 of a file with a large header. > # This is line 657 of a file with a large header. > # This is line 658 of a file with a large header. > # This is line 659 of a file with a large header. > # This is line 660 of a file with a large header. > # This is line 661 of a file with a large header. > # This is line 662 of a file with a large header. > # This is line 663 of a file with a large header. > # This is line 664 of a file with a large header. > # This is line 665 of a file with a large header. > # This is line 666 of a file with a large header. > # This is line 667 of a file with a large header. > # This is line 668 of a file with a large header. > # This is line 669 of a file with a large header. > # This is line 670 of a file with a large header. > # This is line 671 of a file with a large header. > # This is line 672 of a file with a large header. > # This is line 673 of a file with a large header. > # This is line 674 of a file with a large header. > # This is line 675 of a file with a large header. > # This is line 676 of a file with a large header. > # This is line 677 of a file with a large header. > # This is line 678 of a file with a large header. > # This is line 679 of a file with a large header. > # This is line 680 of a file with a large header. > # This is line 681 of a file with a large header. > # This is line 682 of a file with a large header. > # This is line 683 of a file with a large header. > # This is line 684 of a file with a large header. > # This is line 685 of a file with a large header. > # This is line 686 of a file with a large header. > # This is line 687 of a file with a large header. > # This is line 688 of a file with a large header. > # This is line 689 of a file with a large header. > # This is line 690 of a file with a large header. > # This is line 691 of a file with a large header. > # This is line 692 of a file with a large header. > # This is line 693 of a file with a large header. > # This is line 694 of a file with a large header. > # This is line 695 of a file with a large header. > # This is line 696 of a file with a large header. > # This is line 697 of a file with a large header. > # This is line 698 of a file with a large header. > # This is line 699 of a file with a large header. > # This is line 700 of a file with a large header. > # This is line 701 of a file with a large header. > # This is line 702 of a file with a large header. > # This is line 703 of a file with a large header. > # This is line 704 of a file with a large header. > # This is line 705 of a file with a large header. > # This is line 706 of a file with a large header. > # This is line 707 of a file with a large header. > # This is line 708 of a file with a large header. > # This is line 709 of a file with a large header. > # This is line 710 of a file with a large header. > # This is line 711 of a file with a large header. > # This is line 712 of a file with a large header. > # This is line 713 of a file with a large header. > # This is line 714 of a file with a large header. > # This is line 715 of a file with a large header. > # This is line 716 of a file with a large header. > # This is line 717 of a file with a large header. > # This is line 718 of a file with a large header. > # This is line 719 of a file with a large header. > # This is line 720 of a file with a large header. > # This is line 721 of a file with a large header. > # This is line 722 of a file with a large header. > # This is line 723 of a file with a large header. > # This is line 724 of a file with a large header. > # This is line 725 of a file with a large header. > # This is line 726 of a file with a large header. > # This is line 727 of a file with a large header. > # This is line 728 of a file with a large header. > # This is line 729 of a file with a large header. > # This is line 730 of a file with a large header. > # This is line 731 of a file with a large header. > # This is line 732 of a file with a large header. > # This is line 733 of a file with a large header. > # This is line 734 of a file with a large header. > # This is line 735 of a file with a large header. > # This is line 736 of a file with a large header. > # This is line 737 of a file with a large header. > # This is line 738 of a file with a large header. > # This is line 739 of a file with a large header. > # This is line 740 of a file with a large header. > # This is line 741 of a file with a large header. > # This is line 742 of a file with a large header. > # This is line 743 of a file with a large header. > # This is line 744 of a file with a large header. > # This is line 745 of a file with a large header. > # This is line 746 of a file with a large header. > # This is line 747 of a file with a large header. > # This is line 748 of a file with a large header. > # This is line 749 of a file with a large header. > # This is line 750 of a file with a large header. > # This is line 751 of a file with a large header. > # This is line 752 of a file with a large header. > # This is line 753 of a file with a large header. > # This is line 754 of a file with a large header. > # This is line 755 of a file with a large header. > # This is line 756 of a file with a large header. > # This is line 757 of a file with a large header. > # This is line 758 of a file with a large header. > # This is line 759 of a file with a large header. > # This is line 760 of a file with a large header. > # This is line 761 of a file with a large header. > # This is line 762 of a file with a large header. > # This is line 763 of a file with a large header. > # This is line 764 of a file with a large header. > # This is line 765 of a file with a large header. > # This is line 766 of a file with a large header. > # This is line 767 of a file with a large header. > # This is line 768 of a file with a large header. > # This is line 769 of a file with a large header. > # This is line 770 of a file with a large header. > # This is line 771 of a file with a large header. > # This is line 772 of a file with a large header. > # This is line 773 of a file with a large header. > # This is line 774 of a file with a large header. > # This is line 775 of a file with a large header. > # This is line 776 of a file with a large header. > # This is line 777 of a file with a large header. > # This is line 778 of a file with a large header. > # This is line 779 of a file with a large header. > # This is line 780 of a file with a large header. > # This is line 781 of a file with a large header. > # This is line 782 of a file with a large header. > # This is line 783 of a file with a large header. > # This is line 784 of a file with a large header. > # This is line 785 of a file with a large header. > # This is line 786 of a file with a large header. > # This is line 787 of a file with a large header. > # This is line 788 of a file with a large header. > # This is line 789 of a file with a large header. > # This is line 790 of a file with a large header. > # This is line 791 of a file with a large header. > # This is line 792 of a file with a large header. > # This is line 793 of a file with a large header. > # This is line 794 of a file with a large header. > # This is line 795 of a file with a large header. > # This is line 796 of a file with a large header. > # This is line 797 of a file with a large header. > # This is line 798 of a file with a large header. > # This is line 799 of a file with a large header. > # This is line 800 of a file with a large header. > # This is line 801 of a file with a large header. > # This is line 802 of a file with a large header. > # This is line 803 of a file with a large header. > # This is line 804 of a file with a large header. > # This is line 805 of a file with a large header. > # This is line 806 of a file with a large header. > # This is line 807 of a file with a large header. > # This is line 808 of a file with a large header. > # This is line 809 of a file with a large header. > # This is line 810 of a file with a large header. > # This is line 811 of a file with a large header. > # This is line 812 of a file with a large header. > # This is line 813 of a file with a large header. > # This is line 814 of a file with a large header. > # This is line 815 of a file with a large header. > # This is line 816 of a file with a large header. > # This is line 817 of a file with a large header. > # This is line 818 of a file with a large header. > # This is line 819 of a file with a large header. > # This is line 820 of a file with a large header. > # This is line 821 of a file with a large header. > # This is line 822 of a file with a large header. > # This is line 823 of a file with a large header. > # This is line 824 of a file with a large header. > # This is line 825 of a file with a large header. > # This is line 826 of a file with a large header. > # This is line 827 of a file with a large header. > # This is line 828 of a file with a large header. > # This is line 829 of a file with a large header. > # This is line 830 of a file with a large header. > # This is line 831 of a file with a large header. > # This is line 832 of a file with a large header. > # This is line 833 of a file with a large header. > # This is line 834 of a file with a large header. > # This is line 835 of a file with a large header. > # This is line 836 of a file with a large header. > # This is line 837 of a file with a large header. > # This is line 838 of a file with a large header. > # This is line 839 of a file with a large header. > # This is line 840 of a file with a large header. > # This is line 841 of a file with a large header. > # This is line 842 of a file with a large header. > # This is line 843 of a file with a large header. > # This is line 844 of a file with a large header. > # This is line 845 of a file with a large header. > # This is line 846 of a file with a large header. > # This is line 847 of a file with a large header. > # This is line 848 of a file with a large header. > # This is line 849 of a file with a large header. > # This is line 850 of a file with a large header. > # This is line 851 of a file with a large header. > # This is line 852 of a file with a large header. > # This is line 853 of a file with a large header. > # This is line 854 of a file with a large header. > # This is line 855 of a file with a large header. > # This is line 856 of a file with a large header. > # This is line 857 of a file with a large header. > # This is line 858 of a file with a large header. > # This is line 859 of a file with a large header. > # This is line 860 of a file with a large header. > # This is line 861 of a file with a large header. > # This is line 862 of a file with a large header. > # This is line 863 of a file with a large header. > # This is line 864 of a file with a large header. > # This is line 865 of a file with a large header. > # This is line 866 of a file with a large header. > # This is line 867 of a file with a large header. > # This is line 868 of a file with a large header. > # This is line 869 of a file with a large header. > # This is line 870 of a file with a large header. > # This is line 871 of a file with a large header. > # This is line 872 of a file with a large header. > # This is line 873 of a file with a large header. > # This is line 874 of a file with a large header. > # This is line 875 of a file with a large header. > # This is line 876 of a file with a large header. > # This is line 877 of a file with a large header. > # This is line 878 of a file with a large header. > # This is line 879 of a file with a large header. > # This is line 880 of a file with a large header. > # This is line 881 of a file with a large header. > # This is line 882 of a file with a large header. > # This is line 883 of a file with a large header. > # This is line 884 of a file with a large header. > # This is line 885 of a file with a large header. > # This is line 886 of a file with a large header. > # This is line 887 of a file with a large header. > # This is line 888 of a file with a large header. > # This is line 889 of a file with a large header. > # This is line 890 of a file with a large header. > # This is line 891 of a file with a large header. > # This is line 892 of a file with a large header. > # This is line 893 of a file with a large header. > # This is line 894 of a file with a large header. > # This is line 895 of a file with a large header. > # This is line 896 of a file with a large header. > # This is line 897 of a file with a large header. > # This is line 898 of a file with a large header. > # This is line 899 of a file with a large header. > # This is line 900 of a file with a large header. > # This is line 901 of a file with a large header. > # This is line 902 of a file with a large header. > # This is line 903 of a file with a large header. > # This is line 904 of a file with a large header. > # This is line 905 of a file with a large header. > # This is line 906 of a file with a large header. > # This is line 907 of a file with a large header. > # This is line 908 of a file with a large header. > # This is line 909 of a file with a large header. > # This is line 910 of a file with a large header. > # This is line 911 of a file with a large header. > # This is line 912 of a file with a large header. > # This is line 913 of a file with a large header. > # This is line 914 of a file with a large header. > # This is line 915 of a file with a large header. > # This is line 916 of a file with a large header. > # This is line 917 of a file with a large header. > # This is line 918 of a file with a large header. > # This is line 919 of a file with a large header. > # This is line 920 of a file with a large header. > # This is line 921 of a file with a large header. > # This is line 922 of a file with a large header. > # This is line 923 of a file with a large header. > # This is line 924 of a file with a large header. > # This is line 925 of a file with a large header. > # This is line 926 of a file with a large header. > # This is line 927 of a file with a large header. > # This is line 928 of a file with a large header. > # This is line 929 of a file with a large header. > # This is line 930 of a file with a large header. > # This is line 931 of a file with a large header. > # This is line 932 of a file with a large header. > # This is line 933 of a file with a large header. > # This is line 934 of a file with a large header. > # This is line 935 of a file with a large header. > # This is line 936 of a file with a large header. > # This is line 937 of a file with a large header. > # This is line 938 of a file with a large header. > # This is line 939 of a file with a large header. > # This is line 940 of a file with a large header. > # This is line 941 of a file with a large header. > # This is line 942 of a file with a large header. > # This is line 943 of a file with a large header. > # This is line 944 of a file with a large header. > # This is line 945 of a file with a large header. > # This is line 946 of a file with a large header. > # This is line 947 of a file with a large header. > # This is line 948 of a file with a large header. > # This is line 949 of a file with a large header. > # This is line 950 of a file with a large header. > # This is line 951 of a file with a large header. > # This is line 952 of a file with a large header. > # This is line 953 of a file with a large header. > # This is line 954 of a file with a large header. > # This is line 955 of a file with a large header. > # This is line 956 of a file with a large header. > # This is line 957 of a file with a large header. > # This is line 958 of a file with a large header. > # This is line 959 of a file with a large header. > # This is line 960 of a file with a large header. > # This is line 961 of a file with a large header. > # This is line 962 of a file with a large header. > # This is line 963 of a file with a large header. > # This is line 964 of a file with a large header. > # This is line 965 of a file with a large header. > # This is line 966 of a file with a large header. > # This is line 967 of a file with a large header. > # This is line 968 of a file with a large header. > # This is line 969 of a file with a large header. > # This is line 970 of a file with a large header. > # This is line 971 of a file with a large header. > # This is line 972 of a file with a large header. > # This is line 973 of a file with a large header. > # This is line 974 of a file with a large header. > # This is line 975 of a file with a large header. > # This is line 976 of a file with a large header. > # This is line 977 of a file with a large header. > # This is line 978 of a file with a large header. > # This is line 979 of a file with a large header. > # This is line 980 of a file with a large header. > # This is line 981 of a file with a large header. > # This is line 982 of a file with a large header. > # This is line 983 of a file with a large header. > # This is line 984 of a file with a large header. > # This is line 985 of a file with a large header. > # This is line 986 of a file with a large header. > # This is line 987 of a file with a large header. > # This is line 988 of a file with a large header. > # This is line 989 of a file with a large header. > # This is line 990 of a file with a large header. > # This is line 991 of a file with a large header. > # This is line 992 of a file with a large header. > # This is line 993 of a file with a large header. > # This is line 994 of a file with a large header. > # This is line 995 of a file with a large header. > # This is line 996 of a file with a large header. > # This is line 997 of a file with a large header. > # This is line 998 of a file with a large header. > # This is line 999 of a file with a large header. > # This is line 1000 of a file with a large header. > # This is line 1001 of a file with a large header. > # This is line 1002 of a file with a large header. > # This is line 1003 of a file with a large header. > # This is line 1004 of a file with a large header. > # This is line 1005 of a file with a large header. > # This is line 1006 of a file with a large header. > # This is line 1007 of a file with a large header. > # This is line 1008 of a file with a large header. > # This is line 1009 of a file with a large header. > # This is line 1010 of a file with a large header. > # This is line 1011 of a file with a large header. > # This is line 1012 of a file with a large header. > # This is line 1013 of a file with a large header. > # This is line 1014 of a file with a large header. > # This is line 1015 of a file with a large header. > # This is line 1016 of a file with a large header. > # This is line 1017 of a file with a large header. > # This is line 1018 of a file with a large header. > # This is line 1019 of a file with a large header. > # This is line 1020 of a file with a large header. > # This is line 1021 of a file with a large header. > # This is line 1022 of a file with a large header. > # This is line 1023 of a file with a large header. > # This is line 1024 of a file with a large header. > # This is line 1025 of a file with a large header. > # This is line 1026 of a file with a large header. > # This is line 1027 of a file with a large header. > # This is line 1028 of a file with a large header. > # This is line 1029 of a file with a large header. > # This is line 1030 of a file with a large header. > # This is line 1031 of a file with a large header. > # This is line 1032 of a file with a large header. > # This is line 1033 of a file with a large header. > # This is line 1034 of a file with a large header. > # This is line 1035 of a file with a large header. > # This is line 1036 of a file with a large header. > # This is line 1037 of a file with a large header. > # This is line 1038 of a file with a large header. > # This is line 1039 of a file with a large header. > # This is line 1040 of a file with a large header. > # This is line 1041 of a file with a large header. > # This is line 1042 of a file with a large header. > # This is line 1043 of a file with a large header. > # This is line 1044 of a file with a large header. > # This is line 1045 of a file with a large header. > # This is line 1046 of a file with a large header. > # This is line 1047 of a file with a large header. > # This is line 1048 of a file with a large header. > # This is line 1049 of a file with a large header. > # This is line 1050 of a file with a large header. > # This is line 1051 of a file with a large header. > # This is line 1052 of a file with a large header. > # This is line 1053 of a file with a large header. > # This is line 1054 of a file with a large header. > # This is line 1055 of a file with a large header. > # This is line 1056 of a file with a large header. > # This is line 1057 of a file with a large header. > # This is line 1058 of a file with a large header. > # This is line 1059 of a file with a large header. > # This is line 1060 of a file with a large header. > # This is line 1061 of a file with a large header. > # This is line 1062 of a file with a large header. > # This is line 1063 of a file with a large header. > # This is line 1064 of a file with a large header. > # This is line 1065 of a file with a large header. > # This is line 1066 of a file with a large header. > # This is line 1067 of a file with a large header. > # This is line 1068 of a file with a large header. > # This is line 1069 of a file with a large header. > # This is line 1070 of a file with a large header. > # This is line 1071 of a file with a large header. > # This is line 1072 of a file with a large header. > # This is line 1073 of a file with a large header. > # This is line 1074 of a file with a large header. > # This is line 1075 of a file with a large header. > # This is line 1076 of a file with a large header. > # This is line 1077 of a file with a large header. > # This is line 1078 of a file with a large header. > # This is line 1079 of a file with a large header. > # This is line 1080 of a file with a large header. > # This is line 1081 of a file with a large header. > # This is line 1082 of a file with a large header. > # This is line 1083 of a file with a large header. > # This is line 1084 of a file with a large header. > # This is line 1085 of a file with a large header. > # This is line 1086 of a file with a large header. > # This is line 1087 of a file with a large header. > # This is line 1088 of a file with a large header. > # This is line 1089 of a file with a large header. > # This is line 1090 of a file with a large header. > # This is line 1091 of a file with a large header. > # This is line 1092 of a file with a large header. > # This is line 1093 of a file with a large header. > # This is line 1094 of a file with a large header. > # This is line 1095 of a file with a large header. > # This is line 1096 of a file with a large header. > # This is line 1097 of a file with a large header. > # This is line 1098 of a file with a large header. > # This is line 1099 of a file with a large header. > # This is line 1100 of a file with a large header. > # This is line 1101 of a file with a large header. > # This is line 1102 of a file with a large header. > # This is line 1103 of a file with a large header. > # This is line 1104 of a file with a large header. > # This is line 1105 of a file with a large header. > # This is line 1106 of a file with a large header. > # This is line 1107 of a file with a large header. > # This is line 1108 of a file with a large header. > # This is line 1109 of a file with a large header. > # This is line 1110 of a file with a large header. > # This is line 1111 of a file with a large header. > # This is line 1112 of a file with a large header. > # This is line 1113 of a file with a large header. > # This is line 1114 of a file with a large header. > # This is line 1115 of a file with a large header. > # This is line 1116 of a file with a large header. > # This is line 1117 of a file with a large header. > # This is line 1118 of a file with a large header. > # This is line 1119 of a file with a large header. > # This is line 1120 of a file with a large header. > # This is line 1121 of a file with a large header. > # This is line 1122 of a file with a large header. > # This is line 1123 of a file with a large header. > # This is line 1124 of a file with a large header. > # This is line 1125 of a file with a large header. > # This is line 1126 of a file with a large header. > # This is line 1127 of a file with a large header. > # This is line 1128 of a file with a large header. > # This is line 1129 of a file with a large header. > # This is line 1130 of a file with a large header. > # This is line 1131 of a file with a large header. > # This is line 1132 of a file with a large header. > # This is line 1133 of a file with a large header. > # This is line 1134 of a file with a large header. > # This is line 1135 of a file with a large header. > # This is line 1136 of a file with a large header. > # This is line 1137 of a file with a large header. > # This is line 1138 of a file with a large header. > # This is line 1139 of a file with a large header. > # This is line 1140 of a file with a large header. > # This is line 1141 of a file with a large header. > # This is line 1142 of a file with a large header. > # This is line 1143 of a file with a large header. > # This is line 1144 of a file with a large header. > # This is line 1145 of a file with a large header. > # This is line 1146 of a file with a large header. > # This is line 1147 of a file with a large header. > # This is line 1148 of a file with a large header. > # This is line 1149 of a file with a large header. > # This is line 1150 of a file with a large header. > # This is line 1151 of a file with a large header. > # This is line 1152 of a file with a large header. > # This is line 1153 of a file with a large header. > # This is line 1154 of a file with a large header. > # This is line 1155 of a file with a large header. > # This is line 1156 of a file with a large header. > # This is line 1157 of a file with a large header. > # This is line 1158 of a file with a large header. > # This is line 1159 of a file with a large header. > # This is line 1160 of a file with a large header. > # This is line 1161 of a file with a large header. > # This is line 1162 of a file with a large header. > # This is line 1163 of a file with a large header. > # This is line 1164 of a file with a large header. > # This is line 1165 of a file with a large header. > # This is line 1166 of a file with a large header. > # This is line 1167 of a file with a large header. > # This is line 1168 of a file with a large header. > # This is line 1169 of a file with a large header. > # This is line 1170 of a file with a large header. > # This is line 1171 of a file with a large header. > # This is line 1172 of a file with a large header. > # This is line 1173 of a file with a large header. > # This is line 1174 of a file with a large header. > # This is line 1175 of a file with a large header. > # This is line 1176 of a file with a large header. > # This is line 1177 of a file with a large header. > # This is line 1178 of a file with a large header. > # This is line 1179 of a file with a large header. > # This is line 1180 of a file with a large header. > # This is line 1181 of a file with a large header. > # This is line 1182 of a file with a large header. > # This is line 1183 of a file with a large header. > # This is line 1184 of a file with a large header. > # This is line 1185 of a file with a large header. > # This is line 1186 of a file with a large header. > # This is line 1187 of a file with a large header. > # This is line 1188 of a file with a large header. > # This is line 1189 of a file with a large header. > # This is line 1190 of a file with a large header. > # This is line 1191 of a file with a large header. > # This is line 1192 of a file with a large header. > # This is line 1193 of a file with a large header. > # This is line 1194 of a file with a large header. > # This is line 1195 of a file with a large header. > # This is line 1196 of a file with a large header. > # This is line 1197 of a file with a large header. > # This is line 1198 of a file with a large header. > # This is line 1199 of a file with a large header. > # This is line 1200 of a file with a large header. > # This is line 1201 of a file with a large header. > # This is line 1202 of a file with a large header. > # This is line 1203 of a file with a large header. > # This is line 1204 of a file with a large header. > # This is line 1205 of a file with a large header. > # This is line 1206 of a file with a large header. > # This is line 1207 of a file with a large header. > # This is line 1208 of a file with a large header. > # This is line 1209 of a file with a large header. > # This is line 1210 of a file with a large header. > # This is line 1211 of a file with a large header. > # This is line 1212 of a file with a large header. > # This is line 1213 of a file with a large header. > # This is line 1214 of a file with a large header. > # This is line 1215 of a file with a large header. > # This is line 1216 of a file with a large header. > # This is line 1217 of a file with a large header. > # This is line 1218 of a file with a large header. > # This is line 1219 of a file with a large header. > # This is line 1220 of a file with a large header. > # This is line 1221 of a file with a large header. > # This is line 1222 of a file with a large header. > # This is line 1223 of a file with a large header. > # This is line 1224 of a file with a large header. > # This is line 1225 of a file with a large header. > # This is line 1226 of a file with a large header. > # This is line 1227 of a file with a large header. > # This is line 1228 of a file with a large header. > # This is line 1229 of a file with a large header. > # This is line 1230 of a file with a large header. > # This is line 1231 of a file with a large header. > # This is line 1232 of a file with a large header. > # This is line 1233 of a file with a large header. > # This is line 1234 of a file with a large header. > # This is line 1235 of a file with a large header. > # This is line 1236 of a file with a large header. > # This is line 1237 of a file with a large header. > # This is line 1238 of a file with a large header. > # This is line 1239 of a file with a large header. > # This is line 1240 of a file with a large header. > # This is line 1241 of a file with a large header. > # This is line 1242 of a file with a large header. > # This is line 1243 of a file with a large header. > # This is line 1244 of a file with a large header. > # This is line 1245 of a file with a large header. > # This is line 1246 of a file with a large header. > # This is line 1247 of a file with a large header. > # This is line 1248 of a file with a large header. > # This is line 1249 of a file with a large header. > # This is line 1250 of a file with a large header. > # This is line 1251 of a file with a large header. > # This is line 1252 of a file with a large header. > # This is line 1253 of a file with a large header. > # This is line 1254 of a file with a large header. > # This is line 1255 of a file with a large header. > # This is line 1256 of a file with a large header. > # This is line 1257 of a file with a large header. > # This is line 1258 of a file with a large header. > # This is line 1259 of a file with a large header. > # This is line 1260 of a file with a large header. > # This is line 1261 of a file with a large header. > # This is line 1262 of a file with a large header. > # This is line 1263 of a file with a large header. > # This is line 1264 of a file with a large header. > # This is line 1265 of a file with a large header. > # This is line 1266 of a file with a large header. > # This is line 1267 of a file with a large header. > # This is line 1268 of a file with a large header. > # This is line 1269 of a file with a large header. > # This is line 1270 of a file with a large header. > # This is line 1271 of a file with a large header. > # This is line 1272 of a file with a large header. > # This is line 1273 of a file with a large header. > # This is line 1274 of a file with a large header. > # This is line 1275 of a file with a large header. > # This is line 1276 of a file with a large header. > # This is line 1277 of a file with a large header. > # This is line 1278 of a file with a large header. > # This is line 1279 of a file with a large header. > # This is line 1280 of a file with a large header. > # This is line 1281 of a file with a large header. > # This is line 1282 of a file with a large header. > # This is line 1283 of a file with a large header. > # This is line 1284 of a file with a large header. > # This is line 1285 of a file with a large header. > # This is line 1286 of a file with a large header. > # This is line 1287 of a file with a large header. > # This is line 1288 of a file with a large header. > # This is line 1289 of a file with a large header. > # This is line 1290 of a file with a large header. > # This is line 1291 of a file with a large header. > # This is line 1292 of a file with a large header. > # This is line 1293 of a file with a large header. > # This is line 1294 of a file with a large header. > # This is line 1295 of a file with a large header. > # This is line 1296 of a file with a large header. > # This is line 1297 of a file with a large header. > # This is line 1298 of a file with a large header. > # This is line 1299 of a file with a large header. > # This is line 1300 of a file with a large header. > # This is line 1301 of a file with a large header. > # This is line 1302 of a file with a large header. > # This is line 1303 of a file with a large header. > # This is line 1304 of a file with a large header. > # This is line 1305 of a file with a large header. > # This is line 1306 of a file with a large header. > # This is line 1307 of a file with a large header. > # This is line 1308 of a file with a large header. > # This is line 1309 of a file with a large header. > # This is line 1310 of a file with a large header. > # This is line 1311 of a file with a large header. > # This is line 1312 of a file with a large header. > # This is line 1313 of a file with a large header. > # This is line 1314 of a file with a large header. > # This is line 1315 of a file with a large header. > # This is line 1316 of a file with a large header. > # This is line 1317 of a file with a large header. > # This is line 1318 of a file with a large header. > # This is line 1319 of a file with a large header. > # This is line 1320 of a file with a large header. > # This is line 1321 of a file with a large header. > # This is line 1322 of a file with a large header. > # This is line 1323 of a file with a large header. > # This is line 1324 of a file with a large header. > # This is line 1325 of a file with a large header. > # This is line 1326 of a file with a large header. > # This is line 1327 of a file with a large header. > # This is line 1328 of a file with a large header. > # This is line 1329 of a file with a large header. > # This is line 1330 of a file with a large header. > # This is line 1331 of a file with a large header. > # This is line 1332 of a file with a large header. > # This is line 1333 of a file with a large header. > # This is line 1334 of a file with a large header. > # This is line 1335 of a file with a large header. > # This is line 1336 of a file with a large header. > # This is line 1337 of a file with a large header. > # This is line 1338 of a file with a large header. > # This is line 1339 of a file with a large header. > # This is line 1340 of a file with a large header. > # This is line 1341 of a file with a large header. > # This is line 1342 of a file with a large header. > # This is line 1343 of a file with a large header. > # This is line 1344 of a file with a large header. > # This is line 1345 of a file with a large header. > # This is line 1346 of a file with a large header. > # This is line 1347 of a file with a large header. > # This is line 1348 of a file with a large header. > # This is line 1349 of a file with a large header. > # This is line 1350 of a file with a large header. > # This is line 1351 of a file with a large header. > # This is line 1352 of a file with a large header. > # This is line 1353 of a file with a large header. > # This is line 1354 of a file with a large header. > # This is line 1355 of a file with a large header. > # This is line 1356 of a file with a large header. > # This is line 1357 of a file with a large header. > # This is line 1358 of a file with a large header. > # This is line 1359 of a file with a large header. > # This is line 1360 of a file with a large header. > # This is line 1361 of a file with a large header. > # This is line 1362 of a file with a large header. > # This is line 1363 of a file with a large header. > # This is line 1364 of a file with a large header. > # This is line 1365 of a file with a large header. > # This is line 1366 of a file with a large header. > # This is line 1367 of a file with a large header. > # This is line 1368 of a file with a large header. > # This is line 1369 of a file with a large header. > # This is line 1370 of a file with a large header. > # This is line 1371 of a file with a large header. > # This is line 1372 of a file with a large header. > # This is line 1373 of a file with a large header. > # This is line 1374 of a file with a large header. > # This is line 1375 of a file with a large header. > # This is line 1376 of a file with a large header. > # This is line 1377 of a file with a large header. > # This is line 1378 of a file with a large header. > # This is line 1379 of a file with a large header. > # This is line 1380 of a file with a large header. > # This is line 1381 of a file with a large header. > # This is line 1382 of a file with a large header. > # This is line 1383 of a file with a large header. > # This is line 1384 of a file with a large header. > # This is line 1385 of a file with a large header. > # This is line 1386 of a file with a large header. > # This is line 1387 of a file with a large header. > # This is line 1388 of a file with a large header. > # This is line 1389 of a file with a large header. > # This is line 1390 of a file with a large header. > # This is line 1391 of a file with a large header. > # This is line 1392 of a file with a large header. > # This is line 1393 of a file with a large header. > # This is line 1394 of a file with a large header. > # This is line 1395 of a file with a large header. > # This is line 1396 of a file with a large header. > # This is line 1397 of a file with a large header. > # This is line 1398 of a file with a large header. > # This is line 1399 of a file with a large header. > # This is line 1400 of a file with a large header. > # This is line 1401 of a file with a large header. > # This is line 1402 of a file with a large header. > # This is line 1403 of a file with a large header. > # This is line 1404 of a file with a large header. > # This is line 1405 of a file with a large header. > # This is line 1406 of a file with a large header. > # This is line 1407 of a file with a large header. > # This is line 1408 of a file with a large header. > # This is line 1409 of a file with a large header. > # This is line 1410 of a file with a large header. > # This is line 1411 of a file with a large header. > # This is line 1412 of a file with a large header. > # This is line 1413 of a file with a large header. > # This is line 1414 of a file with a large header. > # This is line 1415 of a file with a large header. > # This is line 1416 of a file with a large header. > # This is line 1417 of a file with a large header. > # This is line 1418 of a file with a large header. > # This is line 1419 of a file with a large header. > # This is line 1420 of a file with a large header. > # This is line 1421 of a file with a large header. > # This is line 1422 of a file with a large header. > # This is line 1423 of a file with a large header. > # This is line 1424 of a file with a large header. > # This is line 1425 of a file with a large header. > # This is line 1426 of a file with a large header. > # This is line 1427 of a file with a large header. > # This is line 1428 of a file with a large header. > # This is line 1429 of a file with a large header. > # This is line 1430 of a file with a large header. > # This is line 1431 of a file with a large header. > # This is line 1432 of a file with a large header. > # This is line 1433 of a file with a large header. > # This is line 1434 of a file with a large header. > # This is line 1435 of a file with a large header. > # This is line 1436 of a file with a large header. > # This is line 1437 of a file with a large header. > # This is line 1438 of a file with a large header. > # This is line 1439 of a file with a large header. > # This is line 1440 of a file with a large header. > # This is line 1441 of a file with a large header. > # This is line 1442 of a file with a large header. > # This is line 1443 of a file with a large header. > # This is line 1444 of a file with a large header. > # This is line 1445 of a file with a large header. > # This is line 1446 of a file with a large header. > # This is line 1447 of a file with a large header. > # This is line 1448 of a file with a large header. > # This is line 1449 of a file with a large header. > # This is line 1450 of a file with a large header. > # This is line 1451 of a file with a large header. > # This is line 1452 of a file with a large header. > # This is line 1453 of a file with a large header. > # This is line 1454 of a file with a large header. > # This is line 1455 of a file with a large header. > # This is line 1456 of a file with a large header. > # This is line 1457 of a file with a large header. > # This is line 1458 of a file with a large header. > # This is line 1459 of a file with a large header. > # This is line 1460 of a file with a large header. > # This is line 1461 of a file with a large header. > # This is line 1462 of a file with a large header. > # This is line 1463 of a file with a large header. > # This is line 1464 of a file with a large header. > # This is line 1465 of a file with a large header. > # This is line 1466 of a file with a large header. > # This is line 1467 of a file with a large header. > # This is line 1468 of a file with a large header. > # This is line 1469 of a file with a large header. > # This is line 1470 of a file with a large header. > # This is line 1471 of a file with a large header. > # This is line 1472 of a file with a large header. > # This is line 1473 of a file with a large header. > # This is line 1474 of a file with a large header. > # This is line 1475 of a file with a large header. > # This is line 1476 of a file with a large header. > # This is line 1477 of a file with a large header. > # This is line 1478 of a file with a large header. > # This is line 1479 of a file with a large header. > # This is line 1480 of a file with a large header. > # This is line 1481 of a file with a large header. > # This is line 1482 of a file with a large header. > # This is line 1483 of a file with a large header. > # This is line 1484 of a file with a large header. > # This is line 1485 of a file with a large header. > # This is line 1486 of a file with a large header. > # This is line 1487 of a file with a large header. > # This is line 1488 of a file with a large header. > # This is line 1489 of a file with a large header. > # This is line 1490 of a file with a large header. > # This is line 1491 of a file with a large header. > # This is line 1492 of a file with a large header. > # This is line 1493 of a file with a large header. > # This is line 1494 of a file with a large header. > # This is line 1495 of a file with a large header. > # This is line 1496 of a file with a large header. > # This is line 1497 of a file with a large header. > # This is line 1498 of a file with a large header. > # This is line 1499 of a file with a large header. > # This is line 1500 of a file with a large header. > # This is line 1501 of a file with a large header. > # This is line 1502 of a file with a large header. > # This is line 1503 of a file with a large header. > # This is line 1504 of a file with a large header. > # This is line 1505 of a file with a large header. > # This is line 1506 of a file with a large header. > # This is line 1507 of a file with a large header. > # This is line 1508 of a file with a large header. > # This is line 1509 of a file with a large header. > # This is line 1510 of a file with a large header. > # This is line 1511 of a file with a large header. > # This is line 1512 of a file with a large header. > # This is line 1513 of a file with a large header. > # This is line 1514 of a file with a large header. > # This is line 1515 of a file with a large header. > # This is line 1516 of a file with a large header. > # This is line 1517 of a file with a large header. > # This is line 1518 of a file with a large header. > # This is line 1519 of a file with a large header. > # This is line 1520 of a file with a large header. > # This is line 1521 of a file with a large header. > # This is line 1522 of a file with a large header. > # This is line 1523 of a file with a large header. > # This is line 1524 of a file with a large header. > # This is line 1525 of a file with a large header. > # This is line 1526 of a file with a large header. > # This is line 1527 of a file with a large header. > # This is line 1528 of a file with a large header. > # This is line 1529 of a file with a large header. > # This is line 1530 of a file with a large header. > # This is line 1531 of a file with a large header. > # This is line 1532 of a file with a large header. > # This is line 1533 of a file with a large header. > # This is line 1534 of a file with a large header. > # This is line 1535 of a file with a large header. > # This is line 1536 of a file with a large header. > # This is line 1537 of a file with a large header. > # This is line 1538 of a file with a large header. > # This is line 1539 of a file with a large header. > # This is line 1540 of a file with a large header. > # This is line 1541 of a file with a large header. > # This is line 1542 of a file with a large header. > # This is line 1543 of a file with a large header. > # This is line 1544 of a file with a large header. > # This is line 1545 of a file with a large header. > # This is line 1546 of a file with a large header. > # This is line 1547 of a file with a large header. > # This is line 1548 of a file with a large header. > # This is line 1549 of a file with a large header. > # This is line 1550 of a file with a large header. > # This is line 1551 of a file with a large header. > # This is line 1552 of a file with a large header. > # This is line 1553 of a file with a large header. > # This is line 1554 of a file with a large header. > # This is line 1555 of a file with a large header. > # This is line 1556 of a file with a large header. > # This is line 1557 of a file with a large header. > # This is line 1558 of a file with a large header. > # This is line 1559 of a file with a large header. > # This is line 1560 of a file with a large header. > # This is line 1561 of a file with a large header. > # This is line 1562 of a file with a large header. > # This is line 1563 of a file with a large header. > # This is line 1564 of a file with a large header. > # This is line 1565 of a file with a large header. > # This is line 1566 of a file with a large header. > # This is line 1567 of a file with a large header. > # This is line 1568 of a file with a large header. > # This is line 1569 of a file with a large header. > # This is line 1570 of a file with a large header. > # This is line 1571 of a file with a large header. > # This is line 1572 of a file with a large header. > # This is line 1573 of a file with a large header. > # This is line 1574 of a file with a large header. > # This is line 1575 of a file with a large header. > # This is line 1576 of a file with a large header. > # This is line 1577 of a file with a large header. > # This is line 1578 of a file with a large header. > # This is line 1579 of a file with a large header. > # This is line 1580 of a file with a large header. > # This is line 1581 of a file with a large header. > # This is line 1582 of a file with a large header. > # This is line 1583 of a file with a large header. > # This is line 1584 of a file with a large header. > # This is line 1585 of a file with a large header. > # This is line 1586 of a file with a large header. > # This is line 1587 of a file with a large header. > # This is line 1588 of a file with a large header. > # This is line 1589 of a file with a large header. > # This is line 1590 of a file with a large header. > # This is line 1591 of a file with a large header. > # This is line 1592 of a file with a large header. > # This is line 1593 of a file with a large header. > # This is line 1594 of a file with a large header. > # This is line 1595 of a file with a large header. > # This is line 1596 of a file with a large header. > # This is line 1597 of a file with a large header. > # This is line 1598 of a file with a large header. > # This is line 1599 of a file with a large header. > # This is line 1600 of a file with a large header. > # This is line 1601 of a file with a large header. > # This is line 1602 of a file with a large header. > # This is line 1603 of a file with a large header. > # This is line 1604 of a file with a large header. > # This is line 1605 of a file with a large header. > # This is line 1606 of a file with a large header. > # This is line 1607 of a file with a large header. > # This is line 1608 of a file with a large header. > # This is line 1609 of a file with a large header. > # This is line 1610 of a file with a large header. > # This is line 1611 of a file with a large header. > # This is line 1612 of a file with a large header. > # This is line 1613 of a file with a large header. > # This is line 1614 of a file with a large header. > # This is line 1615 of a file with a large header. > # This is line 1616 of a file with a large header. > # This is line 1617 of a file with a large header. > # This is line 1618 of a file with a large header. > # This is line 1619 of a file with a large header. > # This is line 1620 of a file with a large header. > # This is line 1621 of a file with a large header. > # This is line 1622 of a file with a large header. > # This is line 1623 of a file with a large header. > # This is line 1624 of a file with a large header. > # This is line 1625 of a file with a large header. > # This is line 1626 of a file with a large header. > # This is line 1627 of a file with a large header. > # This is line 1628 of a file with a large header. > # This is line 1629 of a file with a large header. > # This is line 1630 of a file with a large header. > # This is line 1631 of a file with a large header. > # This is line 1632 of a file with a large header. > # This is line 1633 of a file with a large header. > # This is line 1634 of a file with a large header. > # This is line 1635 of a file with a large header. > # This is line 1636 of a file with a large header. > # This is line 1637 of a file with a large header. > # This is line 1638 of a file with a large header. > # This is line 1639 of a file with a large header. > # This is line 1640 of a file with a large header. > # This is line 1641 of a file with a large header. > # This is line 1642 of a file with a large header. > # This is line 1643 of a file with a large header. > # This is line 1644 of a file with a large header. > # This is line 1645 of a file with a large header. > # This is line 1646 of a file with a large header. > # This is line 1647 of a file with a large header. > # This is line 1648 of a file with a large header. > # This is line 1649 of a file with a large header. > # This is line 1650 of a file with a large header. > # This is line 1651 of a file with a large header. > # This is line 1652 of a file with a large header. > # This is line 1653 of a file with a large header. > # This is line 1654 of a file with a large header. > # This is line 1655 of a file with a large header. > # This is line 1656 of a file with a large header. > # This is line 1657 of a file with a large header. > # This is line 1658 of a file with a large header. > # This is line 1659 of a file with a large header. > # This is line 1660 of a file with a large header. > # This is line 1661 of a file with a large header. > # This is line 1662 of a file with a large header. > # This is line 1663 of a file with a large header. > # This is line 1664 of a file with a large header. > # This is line 1665 of a file with a large header. > # This is line 1666 of a file with a large header. > # This is line 1667 of a file with a large header. > # This is line 1668 of a file with a large header. > # This is line 1669 of a file with a large header. > # This is line 1670 of a file with a large header. > # This is line 1671 of a file with a large header. > # This is line 1672 of a file with a large header. > # This is line 1673 of a file with a large header. > # This is line 1674 of a file with a large header. > # This is line 1675 of a file with a large header. > # This is line 1676 of a file with a large header. > # This is line 1677 of a file with a large header. > # This is line 1678 of a file with a large header. > # This is line 1679 of a file with a large header. > # This is line 1680 of a file with a large header. > # This is line 1681 of a file with a large header. > # This is line 1682 of a file with a large header. > # This is line 1683 of a file with a large header. > # This is line 1684 of a file with a large header. > # This is line 1685 of a file with a large header. > # This is line 1686 of a file with a large header. > # This is line 1687 of a file with a large header. > # This is line 1688 of a file with a large header. > # This is line 1689 of a file with a large header. > # This is line 1690 of a file with a large header. > # This is line 1691 of a file with a large header. > # This is line 1692 of a file with a large header. > # This is line 1693 of a file with a large header. > # This is line 1694 of a file with a large header. > # This is line 1695 of a file with a large header. > # This is line 1696 of a file with a large header. > # This is line 1697 of a file with a large header. > # This is line 1698 of a file with a large header. > # This is line 1699 of a file with a large header. > # This is line 1700 of a file with a large header. > # This is line 1701 of a file with a large header. > # This is line 1702 of a file with a large header. > # This is line 1703 of a file with a large header. > # This is line 1704 of a file with a large header. > # This is line 1705 of a file with a large header. > # This is line 1706 of a file with a large header. > # This is line 1707 of a file with a large header. > # This is line 1708 of a file with a large header. > # This is line 1709 of a file with a large header. > # This is line 1710 of a file with a large header. > # This is line 1711 of a file with a large header. > # This is line 1712 of a file with a large header. > # This is line 1713 of a file with a large header. > # This is line 1714 of a file with a large header. > # This is line 1715 of a file with a large header. > # This is line 1716 of a file with a large header. > # This is line 1717 of a file with a large header. > # This is line 1718 of a file with a large header. > # This is line 1719 of a file with a large header. > # This is line 1720 of a file with a large header. > # This is line 1721 of a file with a large header. > # This is line 1722 of a file with a large header. > # This is line 1723 of a file with a large header. > # This is line 1724 of a file with a large header. > # This is line 1725 of a file with a large header. > # This is line 1726 of a file with a large header. > # This is line 1727 of a file with a large header. > # This is line 1728 of a file with a large header. > # This is line 1729 of a file with a large header. > # This is line 1730 of a file with a large header. > # This is line 1731 of a file with a large header. > # This is line 1732 of a file with a large header. > # This is line 1733 of a file with a large header. > # This is line 1734 of a file with a large header. > # This is line 1735 of a file with a large header. > # This is line 1736 of a file with a large header. > # This is line 1737 of a file with a large header. > # This is line 1738 of a file with a large header. > # This is line 1739 of a file with a large header. > # This is line 1740 of a file with a large header. > # This is line 1741 of a file with a large header. > # This is line 1742 of a file with a large header. > # This is line 1743 of a file with a large header. > # This is line 1744 of a file with a large header. > # This is line 1745 of a file with a large header. > # This is line 1746 of a file with a large header. > # This is line 1747 of a file with a large header. > # This is line 1748 of a file with a large header. > # This is line 1749 of a file with a large header. > # This is line 1750 of a file with a large header. > # This is line 1751 of a file with a large header. > # This is line 1752 of a file with a large header. > # This is line 1753 of a file with a large header. > # This is line 1754 of a file with a large header. > # This is line 1755 of a file with a large header. > # This is line 1756 of a file with a large header. > # This is line 1757 of a file with a large header. > # This is line 1758 of a file with a large header. > # This is line 1759 of a file with a large header. > # This is line 1760 of a file with a large header. > # This is line 1761 of a file with a large header. > # This is line 1762 of a file with a large header. > # This is line 1763 of a file with a large header. > # This is line 1764 of a file with a large header. > # This is line 1765 of a file with a large header. > # This is line 1766 of a file with a large header. > # This is line 1767 of a file with a large header. > # This is line 1768 of a file with a large header. > # This is line 1769 of a file with a large header. > # This is line 1770 of a file with a large header. > # This is line 1771 of a file with a large header. > # This is line 1772 of a file with a large header. > # This is line 1773 of a file with a large header. > # This is line 1774 of a file with a large header. > # This is line 1775 of a file with a large header. > # This is line 1776 of a file with a large header. > # This is line 1777 of a file with a large header. > # This is line 1778 of a file with a large header. > # This is line 1779 of a file with a large header. > # This is line 1780 of a file with a large header. > # This is line 1781 of a file with a large header. > # This is line 1782 of a file with a large header. > # This is line 1783 of a file with a large header. > # This is line 1784 of a file with a large header. > # This is line 1785 of a file with a large header. > # This is line 1786 of a file with a large header. > # This is line 1787 of a file with a large header. > # This is line 1788 of a file with a large header. > # This is line 1789 of a file with a large header. > # This is line 1790 of a file with a large header. > # This is line 1791 of a file with a large header. > # This is line 1792 of a file with a large header. > # This is line 1793 of a file with a large header. > # This is line 1794 of a file with a large header. > # This is line 1795 of a file with a large header. > # This is line 1796 of a file with a large header. > # This is line 1797 of a file with a large header. > # This is line 1798 of a file with a large header. > # This is line 1799 of a file with a large header. > # This is line 1800 of a file with a large header. > # This is line 1801 of a file with a large header. > # This is line 1802 of a file with a large header. > # This is line 1803 of a file with a large header. > # This is line 1804 of a file with a large header. > # This is line 1805 of a file with a large header. > # This is line 1806 of a file with a large header. > # This is line 1807 of a file with a large header. > # This is line 1808 of a file with a large header. > # This is line 1809 of a file with a large header. > # This is line 1810 of a file with a large header. > # This is line 1811 of a file with a large header. > # This is line 1812 of a file with a large header. > # This is line 1813 of a file with a large header. > # This is line 1814 of a file with a large header. > # This is line 1815 of a file with a large header. > # This is line 1816 of a file with a large header. > # This is line 1817 of a file with a large header. > # This is line 1818 of a file with a large header. > # This is line 1819 of a file with a large header. > # This is line 1820 of a file with a large header. > # This is line 1821 of a file with a large header. > # This is line 1822 of a file with a large header. > # This is line 1823 of a file with a large header. > # This is line 1824 of a file with a large header. > # This is line 1825 of a file with a large header. > # This is line 1826 of a file with a large header. > # This is line 1827 of a file with a large header. > # This is line 1828 of a file with a large header. > # This is line 1829 of a file with a large header. > # This is line 1830 of a file with a large header. > # This is line 1831 of a file with a large header. > # This is line 1832 of a file with a large header. > # This is line 1833 of a file with a large header. > # This is line 1834 of a file with a large header. > # This is line 1835 of a file with a large header. > # This is line 1836 of a file with a large header. > # This is line 1837 of a file with a large header. > # This is line 1838 of a file with a large header. > # This is line 1839 of a file with a large header. > # This is line 1840 of a file with a large header. > # This is line 1841 of a file with a large header. > # This is line 1842 of a file with a large header. > # This is line 1843 of a file with a large header. > # This is line 1844 of a file with a large header. > # This is line 1845 of a file with a large header. > # This is line 1846 of a file with a large header. > # This is line 1847 of a file with a large header. > # This is line 1848 of a file with a large header. > # This is line 1849 of a file with a large header. > # This is line 1850 of a file with a large header. > # This is line 1851 of a file with a large header. > # This is line 1852 of a file with a large header. > # This is line 1853 of a file with a large header. > # This is line 1854 of a file with a large header. > # This is line 1855 of a file with a large header. > # This is line 1856 of a file with a large header. > # This is line 1857 of a file with a large header. > # This is line 1858 of a file with a large header. > # This is line 1859 of a file with a large header. > # This is line 1860 of a file with a large header. > # This is line 1861 of a file with a large header. > # This is line 1862 of a file with a large header. > # This is line 1863 of a file with a large header. > # This is line 1864 of a file with a large header. > # This is line 1865 of a file with a large header. > # This is line 1866 of a file with a large header. > # This is line 1867 of a file with a large header. > # This is line 1868 of a file with a large header. > # This is line 1869 of a file with a large header. > # This is line 1870 of a file with a large header. > # This is line 1871 of a file with a large header. > # This is line 1872 of a file with a large header. > # This is line 1873 of a file with a large header. > # This is line 1874 of a file with a large header. > # This is line 1875 of a file with a large header. > # This is line 1876 of a file with a large header. > # This is line 1877 of a file with a large header. > # This is line 1878 of a file with a large header. > # This is line 1879 of a file with a large header. > # This is line 1880 of a file with a large header. > # This is line 1881 of a file with a large header. > # This is line 1882 of a file with a large header. > # This is line 1883 of a file with a large header. > # This is line 1884 of a file with a large header. > # This is line 1885 of a file with a large header. > # This is line 1886 of a file with a large header. > # This is line 1887 of a file with a large header. > # This is line 1888 of a file with a large header. > # This is line 1889 of a file with a large header. > # This is line 1890 of a file with a large header. > # This is line 1891 of a file with a large header. > # This is line 1892 of a file with a large header. > # This is line 1893 of a file with a large header. > # This is line 1894 of a file with a large header. > # This is line 1895 of a file with a large header. > # This is line 1896 of a file with a large header. > # This is line 1897 of a file with a large header. > # This is line 1898 of a file with a large header. > # This is line 1899 of a file with a large header. > # This is line 1900 of a file with a large header. > # This is line 1901 of a file with a large header. > # This is line 1902 of a file with a large header. > # This is line 1903 of a file with a large header. > # This is line 1904 of a file with a large header. > # This is line 1905 of a file with a large header. > # This is line 1906 of a file with a large header. > # This is line 1907 of a file with a large header. > # This is line 1908 of a file with a large header. > # This is line 1909 of a file with a large header. > # This is line 1910 of a file with a large header. > # This is line 1911 of a file with a large header. > # This is line 1912 of a file with a large header. > # This is line 1913 of a file with a large header. > # This is line 1914 of a file with a large header. > # This is line 1915 of a file with a large header. > # This is line 1916 of a file with a large header. > # This is line 1917 of a file with a large header. > # This is line 1918 of a file with a large header. > # This is line 1919 of a file with a large header. > # This is line 1920 of a file with a large header. > # This is line 1921 of a file with a large header. > # This is line 1922 of a file with a large header. > # This is line 1923 of a file with a large header. > # This is line 1924 of a file with a large header. > # This is line 1925 of a file with a large header. > # This is line 1926 of a file with a large header. > # This is line 1927 of a file with a large header. > # This is line 1928 of a file with a large header. > # This is line 1929 of a file with a large header. > # This is line 1930 of a file with a large header. > # This is line 1931 of a file with a large header. > # This is line 1932 of a file with a large header. > # This is line 1933 of a file with a large header. > # This is line 1934 of a file with a large header. > # This is line 1935 of a file with a large header. > # This is line 1936 of a file with a large header. > # This is line 1937 of a file with a large header. > # This is line 1938 of a file with a large header. > # This is line 1939 of a file with a large header. > # This is line 1940 of a file with a large header. > # This is line 1941 of a file with a large header. > # This is line 1942 of a file with a large header. > # This is line 1943 of a file with a large header. > # This is line 1944 of a file with a large header. > # This is line 1945 of a file with a large header. > # This is line 1946 of a file with a large header. > # This is line 1947 of a file with a large header. > # This is line 1948 of a file with a large header. > # This is line 1949 of a file with a large header. > # This is line 1950 of a file with a large header. > # This is line 1951 of a file with a large header. > # This is line 1952 of a file with a large header. > # This is line 1953 of a file with a large header. > # This is line 1954 of a file with a large header. > # This is line 1955 of a file with a large header. > # This is line 1956 of a file with a large header. > # This is line 1957 of a file with a large header. > # This is line 1958 of a file with a large header. > # This is line 1959 of a file with a large header. > # This is line 1960 of a file with a large header. > # This is line 1961 of a file with a large header. > # This is line 1962 of a file with a large header. > # This is line 1963 of a file with a large header. > # This is line 1964 of a file with a large header. > # This is line 1965 of a file with a large header. > # This is line 1966 of a file with a large header. > # This is line 1967 of a file with a large header. > # This is line 1968 of a file with a large header. > # This is line 1969 of a file with a large header. > # This is line 1970 of a file with a large header. > # This is line 1971 of a file with a large header. > # This is line 1972 of a file with a large header. > # This is line 1973 of a file with a large header. > # This is line 1974 of a file with a large header. > # This is line 1975 of a file with a large header. > # This is line 1976 of a file with a large header. > # This is line 1977 of a file with a large header. > # This is line 1978 of a file with a large header. > # This is line 1979 of a file with a large header. > # This is line 1980 of a file with a large header. > # This is line 1981 of a file with a large header. > # This is line 1982 of a file with a large header. > # This is line 1983 of a file with a large header. > # This is line 1984 of a file with a large header. > # This is line 1985 of a file with a large header. > # This is line 1986 of a file with a large header. > # This is line 1987 of a file with a large header. > # This is line 1988 of a file with a large header. > # This is line 1989 of a file with a large header. > # This is line 1990 of a file with a large header. > # This is line 1991 of a file with a large header. > # This is line 1992 of a file with a large header. > # This is line 1993 of a file with a large header. > # This is line 1994 of a file with a large header. > # This is line 1995 of a file with a large header. > # This is line 1996 of a file with a large header. > # This is line 1997 of a file with a large header. > # This is line 1998 of a file with a large header. > # This is line 1999 of a file with a large header. > # This is line 2000 of a file with a large header. > # This is line 2001 of a file with a large header. > # This is line 2002 of a file with a large header. > # This is line 2003 of a file with a large header. > # This is line 2004 of a file with a large header. > # This is line 2005 of a file with a large header. > # This is line 2006 of a file with a large header. > # This is line 2007 of a file with a large header. > # This is line 2008 of a file with a large header. > # This is line 2009 of a file with a large header. > # This is line 2010 of a file with a large header. > # This is line 2011 of a file with a large header. > # This is line 2012 of a file with a large header. > # This is line 2013 of a file with a large header. > # This is line 2014 of a file with a large header. > # This is line 2015 of a file with a large header. > # This is line 2016 of a file with a large header. > # This is line 2017 of a file with a large header. > # This is line 2018 of a file with a large header. > # This is line 2019 of a file with a large header. > # This is line 2020 of a file with a large header. > # This is line 2021 of a file with a large header. > # This is line 2022 of a file with a large header. > # This is line 2023 of a file with a large header. > # This is line 2024 of a file with a large header. > # This is line 2025 of a file with a large header. > # This is line 2026 of a file with a large header. > # This is line 2027 of a file with a large header. > # This is line 2028 of a file with a large header. > # This is line 2029 of a file with a large header. > # This is line 2030 of a file with a large header. > # This is line 2031 of a file with a large header. > # This is line 2032 of a file with a large header. > # This is line 2033 of a file with a large header. > # This is line 2034 of a file with a large header. > # This is line 2035 of a file with a large header. > # This is line 2036 of a file with a large header. > # This is line 2037 of a file with a large header. > # This is line 2038 of a file with a large header. > # This is line 2039 of a file with a large header. > # This is line 2040 of a file with a large header. > # This is line 2041 of a file with a large header. > # This is line 2042 of a file with a large header. > # This is line 2043 of a file with a large header. > # This is line 2044 of a file with a large header. > # This is line 2045 of a file with a large header. > # This is line 2046 of a file with a large header. > # This is line 2047 of a file with a large header. > # This is line 2048 of a file with a large header. > # This is line 2049 of a file with a large header. > # This is line 2050 of a file with a large header. > # This is line 2051 of a file with a large header. > # This is line 2052 of a file with a large header. > # This is line 2053 of a file with a large header. > # This is line 2054 of a file with a large header. > # This is line 2055 of a file with a large header. > # This is line 2056 of a file with a large header. > # This is line 2057 of a file with a large header. > # This is line 2058 of a file with a large header. > # This is line 2059 of a file with a large header. > # This is line 2060 of a file with a large header. > # This is line 2061 of a file with a large header. > # This is line 2062 of a file with a large header. > # This is line 2063 of a file with a large header. > # This is line 2064 of a file with a large header. > # This is line 2065 of a file with a large header. > # This is line 2066 of a file with a large header. > # This is line 2067 of a file with a large header. > # This is line 2068 of a file with a large header. > # This is line 2069 of a file with a large header. > # This is line 2070 of a file with a large header. > # This is line 2071 of a file with a large header. > # This is line 2072 of a file with a large header. > # This is line 2073 of a file with a large header. > # This is line 2074 of a file with a large header. > # This is line 2075 of a file with a large header. > # This is line 2076 of a file with a large header. > # This is line 2077 of a file with a large header. > # This is line 2078 of a file with a large header. > # This is line 2079 of a file with a large header. > # This is line 2080 of a file with a large header. > # This is line 2081 of a file with a large header. > # This is line 2082 of a file with a large header. > # This is line 2083 of a file with a large header. > # This is line 2084 of a file with a large header. > # This is line 2085 of a file with a large header. > # This is line 2086 of a file with a large header. > # This is line 2087 of a file with a large header. > # This is line 2088 of a file with a large header. > # This is line 2089 of a file with a large header. > # This is line 2090 of a file with a large header. > # This is line 2091 of a file with a large header. > # This is line 2092 of a file with a large header. > # This is line 2093 of a file with a large header. > # This is line 2094 of a file with a large header. > # This is line 2095 of a file with a large header. > # This is line 2096 of a file with a large header. > # This is line 2097 of a file with a large header. > # This is line 2098 of a file with a large header. > # This is line 2099 of a file with a large header. > # This is line 2100 of a file with a large header. > # This is line 2101 of a file with a large header. > # This is line 2102 of a file with a large header. > # This is line 2103 of a file with a large header. > # This is line 2104 of a file with a large header. > # This is line 2105 of a file with a large header. > # This is line 2106 of a file with a large header. > # This is line 2107 of a file with a large header. > # This is line 2108 of a file with a large header. > # This is line 2109 of a file with a large header. > # This is line 2110 of a file with a large header. > # This is line 2111 of a file with a large header. > # This is line 2112 of a file with a large header. > # This is line 2113 of a file with a large header. > # This is line 2114 of a file with a large header. > # This is line 2115 of a file with a large header. > # This is line 2116 of a file with a large header. > # This is line 2117 of a file with a large header. > # This is line 2118 of a file with a large header. > # This is line 2119 of a file with a large header. > # This is line 2120 of a file with a large header. > # This is line 2121 of a file with a large header. > # This is line 2122 of a file with a large header. > # This is line 2123 of a file with a large header. > # This is line 2124 of a file with a large header. > # This is line 2125 of a file with a large header. > # This is line 2126 of a file with a large header. > # This is line 2127 of a file with a large header. > # This is line 2128 of a file with a large header. > # This is line 2129 of a file with a large header. > # This is line 2130 of a file with a large header. > # This is line 2131 of a file with a large header. > # This is line 2132 of a file with a large header. > # This is line 2133 of a file with a large header. > # This is line 2134 of a file with a large header. > # This is line 2135 of a file with a large header. > # This is line 2136 of a file with a large header. > # This is line 2137 of a file with a large header. > # This is line 2138 of a file with a large header. > # This is line 2139 of a file with a large header. > # This is line 2140 of a file with a large header. > # This is line 2141 of a file with a large header. > # This is line 2142 of a file with a large header. > # This is line 2143 of a file with a large header. > # This is line 2144 of a file with a large header. > # This is line 2145 of a file with a large header. > # This is line 2146 of a file with a large header. > # This is line 2147 of a file with a large header. > # This is line 2148 of a file with a large header. > # This is line 2149 of a file with a large header. > # This is line 2150 of a file with a large header. > # This is line 2151 of a file with a large header. > # This is line 2152 of a file with a large header. > # This is line 2153 of a file with a large header. > # This is line 2154 of a file with a large header. > # This is line 2155 of a file with a large header. > # This is line 2156 of a file with a large header. > # This is line 2157 of a file with a large header. > # This is line 2158 of a file with a large header. > # This is line 2159 of a file with a large header. > # This is line 2160 of a file with a large header. > # This is line 2161 of a file with a large header. > # This is line 2162 of a file with a large header. > # This is line 2163 of a file with a large header. > # This is line 2164 of a file with a large header. > # This is line 2165 of a file with a large header. > # This is line 2166 of a file with a large header. > # This is line 2167 of a file with a large header. > # This is line 2168 of a file with a large header. > # This is line 2169 of a file with a large header. > # This is line 2170 of a file with a large header. > # This is line 2171 of a file with a large header. > # This is line 2172 of a file with a large header. > # This is line 2173 of a file with a large header. > # This is line 2174 of a file with a large header. > # This is line 2175 of a file with a large header. > # This is line 2176 of a file with a large header. > # This is line 2177 of a file with a large header. > # This is line 2178 of a file with a large header. > # This is line 2179 of a file with a large header. > # This is line 2180 of a file with a large header. > # This is line 2181 of a file with a large header. > # This is line 2182 of a file with a large header. > # This is line 2183 of a file with a large header. > # This is line 2184 of a file with a large header. > # This is line 2185 of a file with a large header. > # This is line 2186 of a file with a large header. > # This is line 2187 of a file with a large header. > # This is line 2188 of a file with a large header. > # This is line 2189 of a file with a large header. > # This is line 2190 of a file with a large header. > # This is line 2191 of a file with a large header. > # This is line 2192 of a file with a large header. > # This is line 2193 of a file with a large header. > # This is line 2194 of a file with a large header. > # This is line 2195 of a file with a large header. > # This is line 2196 of a file with a large header. > # This is line 2197 of a file with a large header. > # This is line 2198 of a file with a large header. > # This is line 2199 of a file with a large header. > # This is line 2200 of a file with a large header. > # This is line 2201 of a file with a large header. > # This is line 2202 of a file with a large header. > # This is line 2203 of a file with a large header. > # This is line 2204 of a file with a large header. > # This is line 2205 of a file with a large header. > # This is line 2206 of a file with a large header. > # This is line 2207 of a file with a large header. > # This is line 2208 of a file with a large header. > # This is line 2209 of a file with a large header. > # This is line 2210 of a file with a large header. > # This is line 2211 of a file with a large header. > # This is line 2212 of a file with a large header. > # This is line 2213 of a file with a large header. > # This is line 2214 of a file with a large header. > # This is line 2215 of a file with a large header. > # This is line 2216 of a file with a large header. > # This is line 2217 of a file with a large header. > # This is line 2218 of a file with a large header. > # This is line 2219 of a file with a large header. > # This is line 2220 of a file with a large header. > # This is line 2221 of a file with a large header. > # This is line 2222 of a file with a large header. > # This is line 2223 of a file with a large header. > # This is line 2224 of a file with a large header. > # This is line 2225 of a file with a large header. > # This is line 2226 of a file with a large header. > # This is line 2227 of a file with a large header. > # This is line 2228 of a file with a large header. > # This is line 2229 of a file with a large header. > # This is line 2230 of a file with a large header. > # This is line 2231 of a file with a large header. > # This is line 2232 of a file with a large header. > # This is line 2233 of a file with a large header. > # This is line 2234 of a file with a large header. > # This is line 2235 of a file with a large header. > # This is line 2236 of a file with a large header. > # This is line 2237 of a file with a large header. > # This is line 2238 of a file with a large header. > # This is line 2239 of a file with a large header. > # This is line 2240 of a file with a large header. > # This is line 2241 of a file with a large header. > # This is line 2242 of a file with a large header. > # This is line 2243 of a file with a large header. > # This is line 2244 of a file with a large header. > # This is line 2245 of a file with a large header. > # This is line 2246 of a file with a large header. > # This is line 2247 of a file with a large header. > # This is line 2248 of a file with a large header. > # This is line 2249 of a file with a large header. > # This is line 2250 of a file with a large header. > # This is line 2251 of a file with a large header. > # This is line 2252 of a file with a large header. > # This is line 2253 of a file with a large header. > # This is line 2254 of a file with a large header. > # This is line 2255 of a file with a large header. > # This is line 2256 of a file with a large header. > # This is line 2257 of a file with a large header. > # This is line 2258 of a file with a large header. > # This is line 2259 of a file with a large header. > # This is line 2260 of a file with a large header. > # This is line 2261 of a file with a large header. > # This is line 2262 of a file with a large header. > # This is line 2263 of a file with a large header. > # This is line 2264 of a file with a large header. > # This is line 2265 of a file with a large header. > # This is line 2266 of a file with a large header. > # This is line 2267 of a file with a large header. > # This is line 2268 of a file with a large header. > # This is line 2269 of a file with a large header. > # This is line 2270 of a file with a large header. > # This is line 2271 of a file with a large header. > # This is line 2272 of a file with a large header. > # This is line 2273 of a file with a large header. > # This is line 2274 of a file with a large header. > # This is line 2275 of a file with a large header. > # This is line 2276 of a file with a large header. > # This is line 2277 of a file with a large header. > # This is line 2278 of a file with a large header. > # This is line 2279 of a file with a large header. > # This is line 2280 of a file with a large header. > # This is line 2281 of a file with a large header. > # This is line 2282 of a file with a large header. > # This is line 2283 of a file with a large header. > # This is line 2284 of a file with a large header. > # This is line 2285 of a file with a large header. > # This is line 2286 of a file with a large header. > # This is line 2287 of a file with a large header. > # This is line 2288 of a file with a large header. > # This is line 2289 of a file with a large header. > # This is line 2290 of a file with a large header. > # This is line 2291 of a file with a large header. > # This is line 2292 of a file with a large header. > # This is line 2293 of a file with a large header. > # This is line 2294 of a file with a large header. > # This is line 2295 of a file with a large header. > # This is line 2296 of a file with a large header. > # This is line 2297 of a file with a large header. > # This is line 2298 of a file with a large header. > # This is line 2299 of a file with a large header. > # This is line 2300 of a file with a large header. > # This is line 2301 of a file with a large header. > # This is line 2302 of a file with a large header. > # This is line 2303 of a file with a large header. > # This is line 2304 of a file with a large header. > # This is line 2305 of a file with a large header. > # This is line 2306 of a file with a large header. > # This is line 2307 of a file with a large header. > # This is line 2308 of a file with a large header. > # This is line 2309 of a file with a large header. > # This is line 2310 of a file with a large header. > # This is line 2311 of a file with a large header. > # This is line 2312 of a file with a large header. > # This is line 2313 of a file with a large header. > # This is line 2314 of a file with a large header. > # This is line 2315 of a file with a large header. > # This is line 2316 of a file with a large header. > # This is line 2317 of a file with a large header. > # This is line 2318 of a file with a large header. > # This is line 2319 of a file with a large header. > # This is line 2320 of a file with a large header. > # This is line 2321 of a file with a large header. > # This is line 2322 of a file with a large header. > # This is line 2323 of a file with a large header. > # This is line 2324 of a file with a large header. > # This is line 2325 of a file with a large header. > # This is line 2326 of a file with a large header. > # This is line 2327 of a file with a large header. > # This is line 2328 of a file with a large header. > # This is line 2329 of a file with a large header. > # This is line 2330 of a file with a large header. > # This is line 2331 of a file with a large header. > # This is line 2332 of a file with a large header. > # This is line 2333 of a file with a large header. > # This is line 2334 of a file with a large header. > # This is line 2335 of a file with a large header. > # This is line 2336 of a file with a large header. > # This is line 2337 of a file with a large header. > # This is line 2338 of a file with a large header. > # This is line 2339 of a file with a large header. > # This is line 2340 of a file with a large header. > # This is line 2341 of a file with a large header. > # This is line 2342 of a file with a large header. > # This is line 2343 of a file with a large header. > # This is line 2344 of a file with a large header. > # This is line 2345 of a file with a large header. > # This is line 2346 of a file with a large header. > # This is line 2347 of a file with a large header. > # This is line 2348 of a file with a large header. > # This is line 2349 of a file with a large header. > # This is line 2350 of a file with a large header. > # This is line 2351 of a file with a large header. > # This is line 2352 of a file with a large header. > # This is line 2353 of a file with a large header. > # This is line 2354 of a file with a large header. > # This is line 2355 of a file with a large header. > # This is line 2356 of a file with a large header. > # This is line 2357 of a file with a large header. > # This is line 2358 of a file with a large header. > # This is line 2359 of a file with a large header. > # This is line 2360 of a file with a large header. > # This is line 2361 of a file with a large header. > # This is line 2362 of a file with a large header. > # This is line 2363 of a file with a large header. > # This is line 2364 of a file with a large header. > # This is line 2365 of a file with a large header. > # This is line 2366 of a file with a large header. > # This is line 2367 of a file with a large header. > # This is line 2368 of a file with a large header. > # This is line 2369 of a file with a large header. > # This is line 2370 of a file with a large header. > # This is line 2371 of a file with a large header. > # This is line 2372 of a file with a large header. > # This is line 2373 of a file with a large header. > # This is line 2374 of a file with a large header. > # This is line 2375 of a file with a large header. > # This is line 2376 of a file with a large header. > # This is line 2377 of a file with a large header. > # This is line 2378 of a file with a large header. > # This is line 2379 of a file with a large header. > # This is line 2380 of a file with a large header. > # This is line 2381 of a file with a large header. > # This is line 2382 of a file with a large header. > # This is line 2383 of a file with a large header. > # This is line 2384 of a file with a large header. > # This is line 2385 of a file with a large header. > # This is line 2386 of a file with a large header. > # This is line 2387 of a file with a large header. > # This is line 2388 of a file with a large header. > # This is line 2389 of a file with a large header. > # This is line 2390 of a file with a large header. > # This is line 2391 of a file with a large header. > # This is line 2392 of a file with a large header. > # This is line 2393 of a file with a large header. > # This is line 2394 of a file with a large header. > # This is line 2395 of a file with a large header. > # This is line 2396 of a file with a large header. > # This is line 2397 of a file with a large header. > # This is line 2398 of a file with a large header. > # This is line 2399 of a file with a large header. > # This is line 2400 of a file with a large header. > # This is line 2401 of a file with a large header. > # This is line 2402 of a file with a large header. > # This is line 2403 of a file with a large header. > # This is line 2404 of a file with a large header. > # This is line 2405 of a file with a large header. > # This is line 2406 of a file with a large header. > # This is line 2407 of a file with a large header. > # This is line 2408 of a file with a large header. > # This is line 2409 of a file with a large header. > # This is line 2410 of a file with a large header. > # This is line 2411 of a file with a large header. > # This is line 2412 of a file with a large header. > # This is line 2413 of a file with a large header. > # This is line 2414 of a file with a large header. > # This is line 2415 of a file with a large header. > # This is line 2416 of a file with a large header. > # This is line 2417 of a file with a large header. > # This is line 2418 of a file with a large header. > # This is line 2419 of a file with a large header. > # This is line 2420 of a file with a large header. > # This is line 2421 of a file with a large header. > # This is line 2422 of a file with a large header. > # This is line 2423 of a file with a large header. > # This is line 2424 of a file with a large header. > # This is line 2425 of a file with a large header. > # This is line 2426 of a file with a large header. > # This is line 2427 of a file with a large header. > # This is line 2428 of a file with a large header. > # This is line 2429 of a file with a large header. > # This is line 2430 of a file with a large header. > # This is line 2431 of a file with a large header. > # This is line 2432 of a file with a large header. > # This is line 2433 of a file with a large header. > # This is line 2434 of a file with a large header. > # This is line 2435 of a file with a large header. > # This is line 2436 of a file with a large header. > # This is line 2437 of a file with a large header. > # This is line 2438 of a file with a large header. > # This is line 2439 of a file with a large header. > # This is line 2440 of a file with a large header. > # This is line 2441 of a file with a large header. > # This is line 2442 of a file with a large header. > # This is line 2443 of a file with a large header. > # This is line 2444 of a file with a large header. > # This is line 2445 of a file with a large header. > # This is line 2446 of a file with a large header. > # This is line 2447 of a file with a large header. > # This is line 2448 of a file with a large header. > # This is line 2449 of a file with a large header. > # This is line 2450 of a file with a large header. > # This is line 2451 of a file with a large header. > # This is line 2452 of a file with a large header. > # This is line 2453 of a file with a large header. > # This is line 2454 of a file with a large header. > # This is line 2455 of a file with a large header. > # This is line 2456 of a file with a large header. > # This is line 2457 of a file with a large header. > # This is line 2458 of a file with a large header. > # This is line 2459 of a file with a large header. > # This is line 2460 of a file with a large header. > # This is line 2461 of a file with a large header. > # This is line 2462 of a file with a large header. > # This is line 2463 of a file with a large header. > # This is line 2464 of a file with a large header. > # This is line 2465 of a file with a large header. > # This is line 2466 of a file with a large header. > # This is line 2467 of a file with a large header. > # This is line 2468 of a file with a large header. > # This is line 2469 of a file with a large header. > # This is line 2470 of a file with a large header. > # This is line 2471 of a file with a large header. > # This is line 2472 of a file with a large header. > # This is line 2473 of a file with a large header. > # This is line 2474 of a file with a large header. > # This is line 2475 of a file with a large header. > # This is line 2476 of a file with a large header. > # This is line 2477 of a file with a large header. > # This is line 2478 of a file with a large header. > # This is line 2479 of a file with a large header. > # This is line 2480 of a file with a large header. > # This is line 2481 of a file with a large header. > # This is line 2482 of a file with a large header. > # This is line 2483 of a file with a large header. > # This is line 2484 of a file with a large header. > # This is line 2485 of a file with a large header. > # This is line 2486 of a file with a large header. > # This is line 2487 of a file with a large header. > # This is line 2488 of a file with a large header. > # This is line 2489 of a file with a large header. > # This is line 2490 of a file with a large header. > # This is line 2491 of a file with a large header. > # This is line 2492 of a file with a large header. > # This is line 2493 of a file with a large header. > # This is line 2494 of a file with a large header. > # This is line 2495 of a file with a large header. > # This is line 2496 of a file with a large header. > # This is line 2497 of a file with a large header. > # This is line 2498 of a file with a large header. > # This is line 2499 of a file with a large header. > # This is line 2500 of a file with a large header. > # This is line 2501 of a file with a large header. > # This is line 2502 of a file with a large header. > # This is line 2503 of a file with a large header. > # This is line 2504 of a file with a large header. > # This is line 2505 of a file with a large header. > # This is line 2506 of a file with a large header. > # This is line 2507 of a file with a large header. > # This is line 2508 of a file with a large header. > # This is line 2509 of a file with a large header. > # This is line 2510 of a file with a large header. > # This is line 2511 of a file with a large header. > # This is line 2512 of a file with a large header. > # This is line 2513 of a file with a large header. > # This is line 2514 of a file with a large header. > # This is line 2515 of a file with a large header. > # This is line 2516 of a file with a large header. > # This is line 2517 of a file with a large header. > # This is line 2518 of a file with a large header. > # This is line 2519 of a file with a large header. > # This is line 2520 of a file with a large header. > # This is line 2521 of a file with a large header. > # This is line 2522 of a file with a large header. > # This is line 2523 of a file with a large header. > # This is line 2524 of a file with a large header. > # This is line 2525 of a file with a large header. > # This is line 2526 of a file with a large header. > # This is line 2527 of a file with a large header. > # This is line 2528 of a file with a large header. > # This is line 2529 of a file with a large header. > # This is line 2530 of a file with a large header. > # This is line 2531 of a file with a large header. > # This is line 2532 of a file with a large header. > # This is line 2533 of a file with a large header. > # This is line 2534 of a file with a large header. > # This is line 2535 of a file with a large header. > # This is line 2536 of a file with a large header. > # This is line 2537 of a file with a large header. > # This is line 2538 of a file with a large header. > # This is line 2539 of a file with a large header. > # This is line 2540 of a file with a large header. > # This is line 2541 of a file with a large header. > # This is line 2542 of a file with a large header. > # This is line 2543 of a file with a large header. > # This is line 2544 of a file with a large header. > # This is line 2545 of a file with a large header. > # This is line 2546 of a file with a large header. > # This is line 2547 of a file with a large header. > # This is line 2548 of a file with a large header. > # This is line 2549 of a file with a large header. > # This is line 2550 of a file with a large header. > # This is line 2551 of a file with a large header. > # This is line 2552 of a file with a large header. > # This is line 2553 of a file with a large header. > # This is line 2554 of a file with a large header. > # This is line 2555 of a file with a large header. > # This is line 2556 of a file with a large header. > # This is line 2557 of a file with a large header. > # This is line 2558 of a file with a large header. > # This is line 2559 of a file with a large header. > # This is line 2560 of a file with a large header. > # This is line 2561 of a file with a large header. > # This is line 2562 of a file with a large header. > # This is line 2563 of a file with a large header. > # This is line 2564 of a file with a large header. > # This is line 2565 of a file with a large header. > # This is line 2566 of a file with a large header. > # This is line 2567 of a file with a large header. > # This is line 2568 of a file with a large header. > # This is line 2569 of a file with a large header. > # This is line 2570 of a file with a large header. > # This is line 2571 of a file with a large header. > # This is line 2572 of a file with a large header. > # This is line 2573 of a file with a large header. > # This is line 2574 of a file with a large header. > # This is line 2575 of a file with a large header. > # This is line 2576 of a file with a large header. > # This is line 2577 of a file with a large header. > # This is line 2578 of a file with a large header. > # This is line 2579 of a file with a large header. > # This is line 2580 of a file with a large header. > # This is line 2581 of a file with a large header. > # This is line 2582 of a file with a large header. > # This is line 2583 of a file with a large header. > # This is line 2584 of a file with a large header. > # This is line 2585 of a file with a large header. > # This is line 2586 of a file with a large header. > # This is line 2587 of a file with a large header. > # This is line 2588 of a file with a large header. > # This is line 2589 of a file with a large header. > # This is line 2590 of a file with a large header. > # This is line 2591 of a file with a large header. > # This is line 2592 of a file with a large header. > # This is line 2593 of a file with a large header. > # This is line 2594 of a file with a large header. > # This is line 2595 of a file with a large header. > # This is line 2596 of a file with a large header. > # This is line 2597 of a file with a large header. > # This is line 2598 of a file with a large header. > # This is line 2599 of a file with a large header. > # This is line 2600 of a file with a large header. > # This is line 2601 of a file with a large header. > # This is line 2602 of a file with a large header. > # This is line 2603 of a file with a large header. > # This is line 2604 of a file with a large header. > # This is line 2605 of a file with a large header. > # This is line 2606 of a file with a large header. > # This is line 2607 of a file with a large header. > # This is line 2608 of a file with a large header. > # This is line 2609 of a file with a large header. > # This is line 2610 of a file with a large header. > # This is line 2611 of a file with a large header. > # This is line 2612 of a file with a large header. > # This is line 2613 of a file with a large header. > # This is line 2614 of a file with a large header. > # This is line 2615 of a file with a large header. > # This is line 2616 of a file with a large header. > # This is line 2617 of a file with a large header. > # This is line 2618 of a file with a large header. > # This is line 2619 of a file with a large header. > # This is line 2620 of a file with a large header. > # This is line 2621 of a file with a large header. > # This is line 2622 of a file with a large header. > # This is line 2623 of a file with a large header. > # This is line 2624 of a file with a large header. > # This is line 2625 of a file with a large header. > # This is line 2626 of a file with a large header. > # This is line 2627 of a file with a large header. > # This is line 2628 of a file with a large header. > # This is line 2629 of a file with a large header. > # This is line 2630 of a file with a large header. > # This is line 2631 of a file with a large header. > # This is line 2632 of a file with a large header. > # This is line 2633 of a file with a large header. > # This is line 2634 of a file with a large header. > # This is line 2635 of a file with a large header. > # This is line 2636 of a file with a large header. > # This is line 2637 of a file with a large header. > # This is line 2638 of a file with a large header. > # This is line 2639 of a file with a large header. > # This is line 2640 of a file with a large header. > # This is line 2641 of a file with a large header. > # This is line 2642 of a file with a large header. > # This is line 2643 of a file with a large header. > # This is line 2644 of a file with a large header. > # This is line 2645 of a file with a large header. > # This is line 2646 of a file with a large header. > # This is line 2647 of a file with a large header. > # This is line 2648 of a file with a large header. > # This is line 2649 of a file with a large header. > # This is line 2650 of a file with a large header. > # This is line 2651 of a file with a large header. > # This is line 2652 of a file with a large header. > # This is line 2653 of a file with a large header. > # This is line 2654 of a file with a large header. > # This is line 2655 of a file with a large header. > # This is line 2656 of a file with a large header. > # This is line 2657 of a file with a large header. > # This is line 2658 of a file with a large header. > # This is line 2659 of a file with a large header. > # This is line 2660 of a file with a large header. > # This is line 2661 of a file with a large header. > # This is line 2662 of a file with a large header. > # This is line 2663 of a file with a large header. > # This is line 2664 of a file with a large header. > # This is line 2665 of a file with a large header. > # This is line 2666 of a file with a large header. > # This is line 2667 of a file with a large header. > # This is line 2668 of a file with a large header. > # This is line 2669 of a file with a large header. > # This is line 2670 of a file with a large header. > # This is line 2671 of a file with a large header. > # This is line 2672 of a file with a large header. > # This is line 2673 of a file with a large header. > # This is line 2674 of a file with a large header. > # This is line 2675 of a file with a large header. > # This is line 2676 of a file with a large header. > # This is line 2677 of a file with a large header. > # This is line 2678 of a file with a large header. > # This is line 2679 of a file with a large header. > # This is line 2680 of a file with a large header. > # This is line 2681 of a file with a large header. > # This is line 2682 of a file with a large header. > # This is line 2683 of a file with a large header. > # This is line 2684 of a file with a large header. > # This is line 2685 of a file with a large header. > # This is line 2686 of a file with a large header. > # This is line 2687 of a file with a large header. > # This is line 2688 of a file with a large header. > # This is line 2689 of a file with a large header. > # This is line 2690 of a file with a large header. > # This is line 2691 of a file with a large header. > # This is line 2692 of a file with a large header. > # This is line 2693 of a file with a large header. > # This is line 2694 of a file with a large header. > # This is line 2695 of a file with a large header. > # This is line 2696 of a file with a large header. > # This is line 2697 of a file with a large header. > # This is line 2698 of a file with a large header. > # This is line 2699 of a file with a large header. > # This is line 2700 of a file with a large header. > # This is line 2701 of a file with a large header. > # This is line 2702 of a file with a large header. > # This is line 2703 of a file with a large header. > # This is line 2704 of a file with a large header. > # This is line 2705 of a file with a large header. > # This is line 2706 of a file with a large header. > # This is line 2707 of a file with a large header. > # This is line 2708 of a file with a large header. > # This is line 2709 of a file with a large header. > # This is line 2710 of a file with a large header. > # This is line 2711 of a file with a large header. > # This is line 2712 of a file with a large header. > # This is line 2713 of a file with a large header. > # This is line 2714 of a file with a large header. > # This is line 2715 of a file with a large header. > # This is line 2716 of a file with a large header. > # This is line 2717 of a file with a large header. > # This is line 2718 of a file with a large header. > # This is line 2719 of a file with a large header. > # This is line 2720 of a file with a large header. > # This is line 2721 of a file with a large header. > # This is line 2722 of a file with a large header. > # This is line 2723 of a file with a large header. > # This is line 2724 of a file with a large header. > # This is line 2725 of a file with a large header. > # This is line 2726 of a file with a large header. > # This is line 2727 of a file with a large header. > # This is line 2728 of a file with a large header. > # This is line 2729 of a file with a large header. > # This is line 2730 of a file with a large header. > # This is line 2731 of a file with a large header. > # This is line 2732 of a file with a large header. > # This is line 2733 of a file with a large header. > # This is line 2734 of a file with a large header. > # This is line 2735 of a file with a large header. > # This is line 2736 of a file with a large header. > # This is line 2737 of a file with a large header. > # This is line 2738 of a file with a large header. > # This is line 2739 of a file with a large header. > # This is line 2740 of a file with a large header. > # This is line 2741 of a file with a large header. > # This is line 2742 of a file with a large header. > # This is line 2743 of a file with a large header. > # This is line 2744 of a file with a large header. > # This is line 2745 of a file with a large header. > # This is line 2746 of a file with a large header. > # This is line 2747 of a file with a large header. > # This is line 2748 of a file with a large header. > # This is line 2749 of a file with a large header. > # This is line 2750 of a file with a large header. > # This is line 2751 of a file with a large header. > # This is line 2752 of a file with a large header. > # This is line 2753 of a file with a large header. > # This is line 2754 of a file with a large header. > # This is line 2755 of a file with a large header. > # This is line 2756 of a file with a large header. > # This is line 2757 of a file with a large header. > # This is line 2758 of a file with a large header. > # This is line 2759 of a file with a large header. > # This is line 2760 of a file with a large header. > # This is line 2761 of a file with a large header. > # This is line 2762 of a file with a large header. > # This is line 2763 of a file with a large header. > # This is line 2764 of a file with a large header. > # This is line 2765 of a file with a large header. > # This is line 2766 of a file with a large header. > # This is line 2767 of a file with a large header. > # This is line 2768 of a file with a large header. > # This is line 2769 of a file with a large header. > # This is line 2770 of a file with a large header. > # This is line 2771 of a file with a large header. > # This is line 2772 of a file with a large header. > # This is line 2773 of a file with a large header. > # This is line 2774 of a file with a large header. > # This is line 2775 of a file with a large header. > # This is line 2776 of a file with a large header. > # This is line 2777 of a file with a large header. > # This is line 2778 of a file with a large header. > # This is line 2779 of a file with a large header. > # This is line 2780 of a file with a large header. > # This is line 2781 of a file with a large header. > # This is line 2782 of a file with a large header. > # This is line 2783 of a file with a large header. > # This is line 2784 of a file with a large header. > # This is line 2785 of a file with a large header. > # This is line 2786 of a file with a large header. > # This is line 2787 of a file with a large header. > # This is line 2788 of a file with a large header. > # This is line 2789 of a file with a large header. > # This is line 2790 of a file with a large header. > # This is line 2791 of a file with a large header. > # This is line 2792 of a file with a large header. > # This is line 2793 of a file with a large header. > # This is line 2794 of a file with a large header. > # This is line 2795 of a file with a large header. > # This is line 2796 of a file with a large header. > # This is line 2797 of a file with a large header. > # This is line 2798 of a file with a large header. > # This is line 2799 of a file with a large header. > # This is line 2800 of a file with a large header. > # This is line 2801 of a file with a large header. > # This is line 2802 of a file with a large header. > # This is line 2803 of a file with a large header. > # This is line 2804 of a file with a large header. > # This is line 2805 of a file with a large header. > # This is line 2806 of a file with a large header. > # This is line 2807 of a file with a large header. > # This is line 2808 of a file with a large header. > # This is line 2809 of a file with a large header. > # This is line 2810 of a file with a large header. > # This is line 2811 of a file with a large header. > # This is line 2812 of a file with a large header. > # This is line 2813 of a file with a large header. > # This is line 2814 of a file with a large header. > # This is line 2815 of a file with a large header. > # This is line 2816 of a file with a large header. > # This is line 2817 of a file with a large header. > # This is line 2818 of a file with a large header. > # This is line 2819 of a file with a large header. > # This is line 2820 of a file with a large header. > # This is line 2821 of a file with a large header. > # This is line 2822 of a file with a large header. > # This is line 2823 of a file with a large header. > # This is line 2824 of a file with a large header. > # This is line 2825 of a file with a large header. > # This is line 2826 of a file with a large header. > # This is line 2827 of a file with a large header. > # This is line 2828 of a file with a large header. > # This is line 2829 of a file with a large header. > # This is line 2830 of a file with a large header. > # This is line 2831 of a file with a large header. > # This is line 2832 of a file with a large header. > # This is line 2833 of a file with a large header. > # This is line 2834 of a file with a large header. > # This is line 2835 of a file with a large header. > # This is line 2836 of a file with a large header. > # This is line 2837 of a file with a large header. > # This is line 2838 of a file with a large header. > # This is line 2839 of a file with a large header. > # This is line 2840 of a file with a large header. > # This is line 2841 of a file with a large header. > # This is line 2842 of a file with a large header. > # This is line 2843 of a file with a large header. > # This is line 2844 of a file with a large header. > # This is line 2845 of a file with a large header. > # This is line 2846 of a file with a large header. > # This is line 2847 of a file with a large header. > # This is line 2848 of a file with a large header. > # This is line 2849 of a file with a large header. > # This is line 2850 of a file with a large header. > # This is line 2851 of a file with a large header. > # This is line 2852 of a file with a large header. > # This is line 2853 of a file with a large header. > # This is line 2854 of a file with a large header. > # This is line 2855 of a file with a large header. > # This is line 2856 of a file with a large header. > # This is line 2857 of a file with a large header. > # This is line 2858 of a file with a large header. > # This is line 2859 of a file with a large header. > # This is line 2860 of a file with a large header. > # This is line 2861 of a file with a large header. > # This is line 2862 of a file with a large header. > # This is line 2863 of a file with a large header. > # This is line 2864 of a file with a large header. > # This is line 2865 of a file with a large header. > # This is line 2866 of a file with a large header. > # This is line 2867 of a file with a large header. > # This is line 2868 of a file with a large header. > # This is line 2869 of a file with a large header. > # This is line 2870 of a file with a large header. > # This is line 2871 of a file with a large header. > # This is line 2872 of a file with a large header. > # This is line 2873 of a file with a large header. > # This is line 2874 of a file with a large header. > # This is line 2875 of a file with a large header. > # This is line 2876 of a file with a large header. > # This is line 2877 of a file with a large header. > # This is line 2878 of a file with a large header. > # This is line 2879 of a file with a large header. > # This is line 2880 of a file with a large header. > # This is line 2881 of a file with a large header. > # This is line 2882 of a file with a large header. > # This is line 2883 of a file with a large header. > # This is line 2884 of a file with a large header. > # This is line 2885 of a file with a large header. > # This is line 2886 of a file with a large header. > # This is line 2887 of a file with a large header. > # This is line 2888 of a file with a large header. > # This is line 2889 of a file with a large header. > # This is line 2890 of a file with a large header. > # This is line 2891 of a file with a large header. > # This is line 2892 of a file with a large header. > # This is line 2893 of a file with a large header. > # This is line 2894 of a file with a large header. > # This is line 2895 of a file with a large header. > # This is line 2896 of a file with a large header. > # This is line 2897 of a file with a large header. > # This is line 2898 of a file with a large header. > # This is line 2899 of a file with a large header. > # This is line 2900 of a file with a large header. > # This is line 2901 of a file with a large header. > # This is line 2902 of a file with a large header. > # This is line 2903 of a file with a large header. > # This is line 2904 of a file with a large header. > # This is line 2905 of a file with a large header. > # This is line 2906 of a file with a large header. > # This is line 2907 of a file with a large header. > # This is line 2908 of a file with a large header. > # This is line 2909 of a file with a large header. > # This is line 2910 of a file with a large header. > # This is line 2911 of a file with a large header. > # This is line 2912 of a file with a large header. > # This is line 2913 of a file with a large header. > # This is line 2914 of a file with a large header. > # This is line 2915 of a file with a large header. > # This is line 2916 of a file with a large header. > # This is line 2917 of a file with a large header. > # This is line 2918 of a file with a large header. > # This is line 2919 of a file with a large header. > # This is line 2920 of a file with a large header. > # This is line 2921 of a file with a large header. > # This is line 2922 of a file with a large header. > # This is line 2923 of a file with a large header. > # This is line 2924 of a file with a large header. > # This is line 2925 of a file with a large header. > # This is line 2926 of a file with a large header. > # This is line 2927 of a file with a large header. > # This is line 2928 of a file with a large header. > # This is line 2929 of a file with a large header. > # This is line 2930 of a file with a large header. > # This is line 2931 of a file with a large header. > # This is line 2932 of a file with a large header. > # This is line 2933 of a file with a large header. > # This is line 2934 of a file with a large header. > # This is line 2935 of a file with a large header. > # This is line 2936 of a file with a large header. > # This is line 2937 of a file with a large header. > # This is line 2938 of a file with a large header. > # This is line 2939 of a file with a large header. > # This is line 2940 of a file with a large header. > # This is line 2941 of a file with a large header. > # This is line 2942 of a file with a large header. > # This is line 2943 of a file with a large header. > # This is line 2944 of a file with a large header. > # This is line 2945 of a file with a large header. > # This is line 2946 of a file with a large header. > # This is line 2947 of a file with a large header. > # This is line 2948 of a file with a large header. > # This is line 2949 of a file with a large header. > # This is line 2950 of a file with a large header. > # This is line 2951 of a file with a large header. > # This is line 2952 of a file with a large header. > # This is line 2953 of a file with a large header. > # This is line 2954 of a file with a large header. > # This is line 2955 of a file with a large header. > # This is line 2956 of a file with a large header. > # This is line 2957 of a file with a large header. > # This is line 2958 of a file with a large header. > # This is line 2959 of a file with a large header. > # This is line 2960 of a file with a large header. > # This is line 2961 of a file with a large header. > # This is line 2962 of a file with a large header. > # This is line 2963 of a file with a large header. > # This is line 2964 of a file with a large header. > # This is line 2965 of a file with a large header. > # This is line 2966 of a file with a large header. > # This is line 2967 of a file with a large header. > # This is line 2968 of a file with a large header. > # This is line 2969 of a file with a large header. > # This is line 2970 of a file with a large header. > # This is line 2971 of a file with a large header. > # This is line 2972 of a file with a large header. > # This is line 2973 of a file with a large header. > # This is line 2974 of a file with a large header. > # This is line 2975 of a file with a large header. > # This is line 2976 of a file with a large header. > # This is line 2977 of a file with a large header. > # This is line 2978 of a file with a large header. > # This is line 2979 of a file with a large header. > # This is line 2980 of a file with a large header. > # This is line 2981 of a file with a large header. > # This is line 2982 of a file with a large header. > # This is line 2983 of a file with a large header. > # This is line 2984 of a file with a large header. > # This is line 2985 of a file with a large header. > # This is line 2986 of a file with a large header. > # This is line 2987 of a file with a large header. > # This is line 2988 of a file with a large header. > # This is line 2989 of a file with a large header. > # This is line 2990 of a file with a large header. > # This is line 2991 of a file with a large header. > # This is line 2992 of a file with a large header. > # This is line 2993 of a file with a large header. > # This is line 2994 of a file with a large header. > # This is line 2995 of a file with a large header. > # This is line 2996 of a file with a large header. > # This is line 2997 of a file with a large header. > # This is line 2998 of a file with a large header. > # This is line 2999 of a file with a large header. > # This is line 3000 of a file with a large header. > # This is line 3001 of a file with a large header. > # This is line 3002 of a file with a large header. > # This is line 3003 of a file with a large header. > # This is line 3004 of a file with a large header. > # This is line 3005 of a file with a large header. > # This is line 3006 of a file with a large header. > # This is line 3007 of a file with a large header. > # This is line 3008 of a file with a large header. > # This is line 3009 of a file with a large header. > # This is line 3010 of a file with a large header. > # This is line 3011 of a file with a large header. > # This is line 3012 of a file with a large header. > # This is line 3013 of a file with a large header. > # This is line 3014 of a file with a large header. > # This is line 3015 of a file with a large header. > # This is line 3016 of a file with a large header. > # This is line 3017 of a file with a large header. > # This is line 3018 of a file with a large header. > # This is line 3019 of a file with a large header. > # This is line 3020 of a file with a large header. > # This is line 3021 of a file with a large header. > # This is line 3022 of a file with a large header. > # This is line 3023 of a file with a large header. > # This is line 3024 of a file with a large header. > # This is line 3025 of a file with a large header. > # This is line 3026 of a file with a large header. > # This is line 3027 of a file with a large header. > # This is line 3028 of a file with a large header. > # This is line 3029 of a file with a large header. > # This is line 3030 of a file with a large header. > # This is line 3031 of a file with a large header. > # This is line 3032 of a file with a large header. > # This is line 3033 of a file with a large header. > # This is line 3034 of a file with a large header. > # This is line 3035 of a file with a large header. > # This is line 3036 of a file with a large header. > # This is line 3037 of a file with a large header. > # This is line 3038 of a file with a large header. > # This is line 3039 of a file with a large header. > # This is line 3040 of a file with a large header. > # This is line 3041 of a file with a large header. > # This is line 3042 of a file with a large header. > # This is line 3043 of a file with a large header. > # This is line 3044 of a file with a large header. > # This is line 3045 of a file with a large header. > # This is line 3046 of a file with a large header. > # This is line 3047 of a file with a large header. > # This is line 3048 of a file with a large header. > # This is line 3049 of a file with a large header. > # This is line 3050 of a file with a large header. > # This is line 3051 of a file with a large header. > # This is line 3052 of a file with a large header. > # This is line 3053 of a file with a large header. > # This is line 3054 of a file with a large header. > # This is line 3055 of a file with a large header. > # This is line 3056 of a file with a large header. > # This is line 3057 of a file with a large header. > # This is line 3058 of a file with a large header. > # This is line 3059 of a file with a large header. > # This is line 3060 of a file with a large header. > # This is line 3061 of a file with a large header. > # This is line 3062 of a file with a large header. > # This is line 3063 of a file with a large header. > # This is line 3064 of a file with a large header. > # This is line 3065 of a file with a large header. > # This is line 3066 of a file with a large header. > # This is line 3067 of a file with a large header. > # This is line 3068 of a file with a large header. > # This is line 3069 of a file with a large header. > # This is line 3070 of a file with a large header. > # This is line 3071 of a file with a large header. > # This is line 3072 of a file with a large header. > # This is line 3073 of a file with a large header. > # This is line 3074 of a file with a large header. > # This is line 3075 of a file with a large header. > # This is line 3076 of a file with a large header. > # This is line 3077 of a file with a large header. > # This is line 3078 of a file with a large header. > # This is line 3079 of a file with a large header. > # This is line 3080 of a file with a large header. > # This is line 3081 of a file with a large header. > # This is line 3082 of a file with a large header. > # This is line 3083 of a file with a large header. > # This is line 3084 of a file with a large header. > # This is line 3085 of a file with a large header. > # This is line 3086 of a file with a large header. > # This is line 3087 of a file with a large header. > # This is line 3088 of a file with a large header. > # This is line 3089 of a file with a large header. > # This is line 3090 of a file with a large header. > # This is line 3091 of a file with a large header. > # This is line 3092 of a file with a large header. > # This is line 3093 of a file with a large header. > # This is line 3094 of a file with a large header. > # This is line 3095 of a file with a large header. > # This is line 3096 of a file with a large header. > # This is line 3097 of a file with a large header. > # This is line 3098 of a file with a large header. > # This is line 3099 of a file with a large header. > # This is line 3100 of a file with a large header. > # This is line 3101 of a file with a large header. > # This is line 3102 of a file with a large header. > # This is line 3103 of a file with a large header. > # This is line 3104 of a file with a large header. > # This is line 3105 of a file with a large header. > # This is line 3106 of a file with a large header. > # This is line 3107 of a file with a large header. > # This is line 3108 of a file with a large header. > # This is line 3109 of a file with a large header. > # This is line 3110 of a file with a large header. > # This is line 3111 of a file with a large header. > # This is line 3112 of a file with a large header. > # This is line 3113 of a file with a large header. > # This is line 3114 of a file with a large header. > # This is line 3115 of a file with a large header. > # This is line 3116 of a file with a large header. > # This is line 3117 of a file with a large header. > # This is line 3118 of a file with a large header. > # This is line 3119 of a file with a large header. > # This is line 3120 of a file with a large header. > # This is line 3121 of a file with a large header. > # This is line 3122 of a file with a large header. > # This is line 3123 of a file with a large header. > # This is line 3124 of a file with a large header. > # This is line 3125 of a file with a large header. > # This is line 3126 of a file with a large header. > # This is line 3127 of a file with a large header. > # This is line 3128 of a file with a large header. > # This is line 3129 of a file with a large header. > # This is line 3130 of a file with a large header. > # This is line 3131 of a file with a large header. > # This is line 3132 of a file with a large header. > # This is line 3133 of a file with a large header. > # This is line 3134 of a file with a large header. > # This is line 3135 of a file with a large header. > # This is line 3136 of a file with a large header. > # This is line 3137 of a file with a large header. > # This is line 3138 of a file with a large header. > # This is line 3139 of a file with a large header. > # This is line 3140 of a file with a large header. > # This is line 3141 of a file with a large header. > # This is line 3142 of a file with a large header. > # This is line 3143 of a file with a large header. > # This is line 3144 of a file with a large header. > # This is line 3145 of a file with a large header. > # This is line 3146 of a file with a large header. > # This is line 3147 of a file with a large header. > # This is line 3148 of a file with a large header. > # This is line 3149 of a file with a large header. > # This is line 3150 of a file with a large header. > # This is line 3151 of a file with a large header. > # This is line 3152 of a file with a large header. > # This is line 3153 of a file with a large header. > # This is line 3154 of a file with a large header. > # This is line 3155 of a file with a large header. > # This is line 3156 of a file with a large header. > # This is line 3157 of a file with a large header. > # This is line 3158 of a file with a large header. > # This is line 3159 of a file with a large header. > # This is line 3160 of a file with a large header. > # This is line 3161 of a file with a large header. > # This is line 3162 of a file with a large header. > # This is line 3163 of a file with a large header. > # This is line 3164 of a file with a large header. > # This is line 3165 of a file with a large header. > # This is line 3166 of a file with a large header. > # This is line 3167 of a file with a large header. > # This is line 3168 of a file with a large header. > # This is line 3169 of a file with a large header. > # This is line 3170 of a file with a large header. > # This is line 3171 of a file with a large header. > # This is line 3172 of a file with a large header. > # This is line 3173 of a file with a large header. > # This is line 3174 of a file with a large header. > # This is line 3175 of a file with a large header. > # This is line 3176 of a file with a large header. > # This is line 3177 of a file with a large header. > # This is line 3178 of a file with a large header. > # This is line 3179 of a file with a large header. > # This is line 3180 of a file with a large header. > # This is line 3181 of a file with a large header. > # This is line 3182 of a file with a large header. > # This is line 3183 of a file with a large header. > # This is line 3184 of a file with a large header. > # This is line 3185 of a file with a large header. > # This is line 3186 of a file with a large header. > # This is line 3187 of a file with a large header. > # This is line 3188 of a file with a large header. > # This is line 3189 of a file with a large header. > # This is line 3190 of a file with a large header. > # This is line 3191 of a file with a large header. terminate called after throwing an instance of 'BamTools::Internal::BamException' > # This is line 3192 of a file with a large header. > # This is line 3193 of a file with a large header. > # This is line 3194 of a file with a large header. > # This is line 3195 of a file with a large header. > # This is line 3196 of a file with a large header. > # This is line 3197 of a file with a large header. > # This is line 3198 of a file with a large header. what(): BgzfStream::ReadBlock: invalid block header contents > # This is line 3199 of a file with a large header. > # This is line 3200 of a file with a large header. > # This is line 3201 of a file with a large header. > # This is line 3202 of a file with a large header. > # This is line 3203 of a file with a large header. > # This is line 3204 of a file with a large header. > # This is line 3205 of a file with a large header. > # This is line 3206 of a file with a large header. > # This is line 3207 of a file with a large header. > # This is line 3208 of a file with a large header. > # This is line 3209 of a file with a large header. > # This is line 3210 of a file with a large header. > # This is line 3211 of a file with a large header. > # This is line 3212 of a file with a large header. > # This is line 3213 of a file with a large header. > # This is line 3214 of a file with a large header. > # This is line 3215 of a file with a large header. > # This is line 3216 of a file with a large header. > # This is line 3217 of a file with a large header. > # This is line 3218 of a file with a large header. > # This is line 3219 of a file with a large header. > # This is line 3220 of a file with a large header. > # This is line 3221 of a file with a large header. > # This is line 3222 of a file with a large header. > # This is line 3223 of a file with a large header. > # This is line 3224 of a file with a large header. > # This is line 3225 of a file with a large header. > # This is line 3226 of a file with a large header. > # This is line 3227 of a file with a large header. > # This is line 3228 of a file with a large header. > # This is line 3229 of a file with a large header. > # This is line 3230 of a file with a large header. > # This is line 3231 of a file with a large header. > # This is line 3232 of a file with a large header. > # This is line 3233 of a file with a large header. > # This is line 3234 of a file with a large header. > # This is line 3235 of a file with a large header. > # This is line 3236 of a file with a large header. > # This is line 3237 of a file with a large header. > # This is line 3238 of a file with a large header. > # This is line 3239 of a file with a large header. > # This is line 3240 of a file with a large header. > # This is line 3241 of a file with a large header. > # This is line 3242 of a file with a large header. > # This is line 3243 of a file with a large header. > # This is line 3244 of a file with a large header. > # This is line 3245 of a file with a large header. > # This is line 3246 of a file with a large header. > # This is line 3247 of a file with a large header. > # This is line 3248 of a file with a large header. > # This is line 3249 of a file with a large header. > # This is line 3250 of a file with a large header. > # This is line 3251 of a file with a large header. > # This is line 3252 of a file with a large header. > # This is line 3253 of a file with a large header. > # This is line 3254 of a file with a large header. > # This is line 3255 of a file with a large header. > # This is line 3256 of a file with a large header. > # This is line 3257 of a file with a large header. > # This is line 3258 of a file with a large header. > # This is line 3259 of a file with a large header. > # This is line 3260 of a file with a large header. > # This is line 3261 of a file with a large header. > # This is line 3262 of a file with a large header. > # This is line 3263 of a file with a large header. > # This is line 3264 of a file with a large header. > # This is line 3265 of a file with a large header. > # This is line 3266 of a file with a large header. > # This is line 3267 of a file with a large header. new_test-intersect.sh: line 568: 15647 Done cat a_withLargeHeader_bgzipped.bed.gz 15648 Aborted | $BT intersect -a - -b b.bed -header > obs > # This is line 3268 of a file with a large header. > # This is line 3269 of a file with a large header. > # This is line 3270 of a file with a large header. > # This is line 3271 of a file with a large header. > # This is line 3272 of a file with a large header. > # This is line 3273 of a file with a large header. > # This is line 3274 of a file with a large header. > # This is line 3275 of a file with a large header. > # This is line 3276 of a file with a large header. > # This is line 3277 of a file with a large header. > # This is line 3278 of a file with a large header. > # This is line 3279 of a file with a large header. > # This is line 3280 of a file with a large header. > # This is line 3281 of a file with a large header. > # This is line 3282 of a file with a large header. > # This is line 3283 of a file with a large header. > # This is line 3284 of a file with a large header. > # This is line 3285 of a file with a large header. > # This is line 3286 of a file with a large header. > # This is line 3287 of a file with a large header. > # This is line 3288 of a file with a large header. > # This is line 3289 of a file with a large header. > # This is line 3290 of a file with a large header. > # This is line 3291 of a file with a large header. > # This is line 3292 of a file with a large header. > # This is line 3293 of a file with a large header. > # This is line 3294 of a file with a large header. > # This is line 3295 of a file with a large header. > # This is line 3296 of a file with a large header. > # This is line 3297 of a file with a large header. > # This is line 3298 of a file with a large header. > # This is line 3299 of a file with a large header. > # This is line 3300 of a file with a large header. > # This is line 3301 of a file with a large header. > # This is line 3302 of a file with a large header. > # This is line 3303 of a file with a large header. > # This is line 3304 of a file with a large header. > # This is line 3305 of a file with a large header. > # This is line 3306 of a file with a large header. > # This is line 3307 of a file with a large header. > # This is line 3308 of a file with a large header. > # This is line 3309 of a file with a large header. > # This is line 3310 of a file with a large header. > # This is line 3311 of a file with a large header. > # This is line 3312 of a file with a large header. > # This is line 3313 of a file with a large header. > # This is line 3314 of a file with a large header. > # This is line 3315 of a file with a large header. > # This is line 3316 of a file with a large header. > # This is line 3317 of a file with a large header. > # This is line 3318 of a file with a large header. > # This is line 3319 of a file with a large header. > # This is line 3320 of a file with a large header. > # This is line 3321 of a file with a large header. > # This is line 3322 of a file with a large header. > # This is line 3323 of a file with a large header. > # This is line 3324 of a file with a large header. > # This is line 3325 of a file with a large header. > # This is line 3326 of a file with a large header. > # This is line 3327 of a file with a large header. > # This is line 3328 of a file with a large header. > # This is line 3329 of a file with a large header. > # This is line 3330 of a file with a large header. > # This is line 3331 of a file with a large header. > # This is line 3332 of a file with a large header. > # This is line 3333 of a file with a large header. > # This is line 3334 of a file with a large header. > # This is line 3335 of a file with a large header. > # This is line 3336 of a file with a large header. > # This is line 3337 of a file with a large header. > # This is line 3338 of a file with a large header. > # This is line 3339 of a file with a large header. > # This is line 3340 of a file with a large header. > # This is line 3341 of a file with a large header. > # This is line 3342 of a file with a large header. > # This is line 3343 of a file with a large header. > # This is line 3344 of a file with a large header. > # This is line 3345 of a file with a large header. > # This is line 3346 of a file with a large header. > # This is line 3347 of a file with a large header. > # This is line 3348 of a file with a large header. > # This is line 3349 of a file with a large header. > # This is line 3350 of a file with a large header. > # This is line 3351 of a file with a large header. > # This is line 3352 of a file with a large header. > # This is line 3353 of a file with a large header. > # This is line 3354 of a file with a large header. > # This is line 3355 of a file with a large header. > # This is line 3356 of a file with a large header. > # This is line 3357 of a file with a large header. > # This is line 3358 of a file with a large header. > # This is line 3359 of a file with a large header. > # This is line 3360 of a file with a large header. > # This is line 3361 of a file with a large header. > # This is line 3362 of a file with a large header. > # This is line 3363 of a file with a large header. > # This is line 3364 of a file with a large header. > # This is line 3365 of a file with a large header. > # This is line 3366 of a file with a large header. > # This is line 3367 of a file with a large header. > # This is line 3368 of a file with a large header. > # This is line 3369 of a file with a large header. > # This is line 3370 of a file with a large header. > # This is line 3371 of a file with a large header. > # This is line 3372 of a file with a large header. > # This is line 3373 of a file with a large header. > # This is line 3374 of a file with a large header. > # This is line 3375 of a file with a large header. > # This is line 3376 of a file with a large header. > # This is line 3377 of a file with a large header. > # This is line 3378 of a file with a large header. > # This is line 3379 of a file with a large header. > # This is line 3380 of a file with a large header. > # This is line 3381 of a file with a large header. > # This is line 3382 of a file with a large header. > # This is line 3383 of a file with a large header. > # This is line 3384 of a file with a large header. > # This is line 3385 of a file with a large header. > # This is line 3386 of a file with a large header. > # This is line 3387 of a file with a large header. > # This is line 3388 of a file with a large header. > # This is line 3389 of a file with a large header. > # This is line 3390 of a file with a large header. > # This is line 3391 of a file with a large header. > # This is line 3392 of a file with a large header. > # This is line 3393 of a file with a large header. > # This is line 3394 of a file with a large header. > # This is line 3395 of a file with a large header. > # This is line 3396 of a file with a large header. > # This is line 3397 of a file with a large header. > # This is line 3398 of a file with a large header. > # This is line 3399 of a file with a large header. > # This is line 3400 of a file with a large header. > # This is line 3401 of a file with a large header. > # This is line 3402 of a file with a large header. > # This is line 3403 of a file with a large header. > # This is line 3404 of a file with a large header. > # This is line 3405 of a file with a large header. > # This is line 3406 of a file with a large header. > # This is line 3407 of a file with a large header. > # This is line 3408 of a file with a large header. > # This is line 3409 of a file with a large header. > # This is line 3410 of a file with a large header. > # This is line 3411 of a file with a large header. > # This is line 3412 of a file with a large header. > # This is line 3413 of a file with a large header. > # This is line 3414 of a file with a large header. > # This is line 3415 of a file with a large header. > # This is line 3416 of a file with a large header. > # This is line 3417 of a file with a large header. > # This is line 3418 of a file with a large header. > # This is line 3419 of a file with a large header. > # This is line 3420 of a file with a large header. > # This is line 3421 of a file with a large header. > # This is line 3422 of a file with a large header. > # This is line 3423 of a file with a large header. > # This is line 3424 of a file with a large header. > # This is line 3425 of a file with a large header. > # This is line 3426 of a file with a large header. > # This is line 3427 of a file with a large header. > # This is line 3428 of a file with a large header. > # This is line 3429 of a file with a large header. > # This is line 3430 of a file with a large header. > # This is line 3431 of a file with a large header. > # This is line 3432 of a file with a large header. > # This is line 3433 of a file with a large header. > # This is line 3434 of a file with a large header. > # This is line 3435 of a file with a large header. > # This is line 3436 of a file with a large header. > # This is line 3437 of a file with a large header. > # This is line 3438 of a file with a large header. > # This is line 3439 of a file with a large header. > # This is line 3440 of a file with a large header. > # This is line 3441 of a file with a large header. > # This is line 3442 of a file with a large header. > # This is line 3443 of a file with a large header. > # This is line 3444 of a file with a large header. > # This is line 3445 of a file with a large header. > # This is line 3446 of a file with a large header. > # This is line 3447 of a file with a large header. > # This is line 3448 of a file with a large header. > # This is line 3449 of a file with a large header. > # This is line 3450 of a file with a large header. > # This is line 3451 of a file with a large header. > # This is line 3452 of a file with a large header. > # This is line 3453 of a file with a large header. > # This is line 3454 of a file with a large header. > # This is line 3455 of a file with a large header. > # This is line 3456 of a file with a large header. > # This is line 3457 of a file with a large header. > # This is line 3458 of a file with a large header. > # This is line 3459 of a file with a large header. > # This is line 3460 of a file with a large header. > # This is line 3461 of a file with a large header. > # This is line 3462 of a file with a large header. > # This is line 3463 of a file with a large header. > # This is line 3464 of a file with a large header. > # This is line 3465 of a file with a large header. > # This is line 3466 of a file with a large header. > # This is line 3467 of a file with a large header. > # This is line 3468 of a file with a large header. > # This is line 3469 of a file with a large header. > # This is line 3470 of a file with a large header. > # This is line 3471 of a file with a large header. > # This is line 3472 of a file with a large header. > # This is line 3473 of a file with a large header. > # This is line 3474 of a file with a large header. > # This is line 3475 of a file with a large header. > # This is line 3476 of a file with a large header. > # This is line 3477 of a file with a large header. > # This is line 3478 of a file with a large header. > # This is line 3479 of a file with a large header. > # This is line 3480 of a file with a large header. > # This is line 3481 of a file with a large header. > # This is line 3482 of a file with a large header. > # This is line 3483 of a file with a large header. > # This is line 3484 of a file with a large header. > # This is line 3485 of a file with a large header. > # This is line 3486 of a file with a large header. > # This is line 3487 of a file with a large header. > # This is line 3488 of a file with a large header. > # This is line 3489 of a file with a large header. > # This is line 3490 of a file with a large header. > # This is line 3491 of a file with a large header. > # This is line 3492 of a file with a large header. > # This is line 3493 of a file with a large header. > # This is line 3494 of a file with a large header. > # This is line 3495 of a file with a large header. > # This is line 3496 of a file with a large header. > # This is line 3497 of a file with a large header. > # This is line 3498 of a file with a large header. > # This is line 3499 of a file with a large header. > # This is line 3500 of a file with a large header. > # This is line 3501 of a file with a large header. > # This is line 3502 of a file with a large header. > # This is line 3503 of a file with a large header. > # This is line 3504 of a file with a large header. > # This is line 3505 of a file with a large header. > # This is line 3506 of a file with a large header. > # This is line 3507 of a file with a large header. > # This is line 3508 of a file with a large header. > # This is line 3509 of a file with a large header. > # This is line 3510 of a file with a large header. > # This is line 3511 of a file with a large header. > # This is line 3512 of a file with a large header. > # This is line 3513 of a file with a large header. > # This is line 3514 of a file with a large header. > # This is line 3515 of a file with a large header. > # This is line 3516 of a file with a large header. > # This is line 3517 of a file with a large header. > # This is line 3518 of a file with a large header. > # This is line 3519 of a file with a large header. > # This is line 3520 of a file with a large header. > # This is line 3521 of a file with a large header. > # This is line 3522 of a file with a large header. > # This is line 3523 of a file with a large header. > # This is line 3524 of a file with a large header. > # This is line 3525 of a file with a large header. > # This is line 3526 of a file with a large header. > # This is line 3527 of a file with a large header. > # This is line 3528 of a file with a large header. > # This is line 3529 of a file with a large header. > # This is line 3530 of a file with a large header. > # This is line 3531 of a file with a large header. > # This is line 3532 of a file with a large header. > # This is line 3533 of a file with a large header. > # This is line 3534 of a file with a large header. > # This is line 3535 of a file with a large header. > # This is line 3536 of a file with a large header. > # This is line 3537 of a file with a large header. > # This is line 3538 of a file with a large header. > # This is line 3539 of a file with a large header. > # This is line 3540 of a file with a large header. > # This is line 3541 of a file with a large header. > # This is line 3542 of a file with a large header. > # This is line 3543 of a file with a large header. > # This is line 3544 of a file with a large header. > # This is line 3545 of a file with a large header. > # This is line 3546 of a file with a large header. > # This is line 3547 of a file with a large header. > # This is line 3548 of a file with a large header. > # This is line 3549 of a file with a large header. > # This is line 3550 of a file with a large header. > # This is line 3551 of a file with a large header. > # This is line 3552 of a file with a large header. > # This is line 3553 of a file with a large header. > # This is line 3554 of a file with a large header. > # This is line 3555 of a file with a large header. > # This is line 3556 of a file with a large header. > # This is line 3557 of a file with a large header. > # This is line 3558 of a file with a large header. > # This is line 3559 of a file with a large header. > # This is line 3560 of a file with a large header. > # This is line 3561 of a file with a large header. > # This is line 3562 of a file with a large header. > # This is line 3563 of a file with a large header. > # This is line 3564 of a file with a large header. > # This is line 3565 of a file with a large header. > # This is line 3566 of a file with a large header. > # This is line 3567 of a file with a large header. > # This is line 3568 of a file with a large header. > # This is line 3569 of a file with a large header. > # This is line 3570 of a file with a large header. > # This is line 3571 of a file with a large header. > # This is line 3572 of a file with a large header. > # This is line 3573 of a file with a large header. > # This is line 3574 of a file with a large header. > # This is line 3575 of a file with a large header. > # This is line 3576 of a file with a large header. > # This is line 3577 of a file with a large header. > # This is line 3578 of a file with a large header. > # This is line 3579 of a file with a large header. > # This is line 3580 of a file with a large header. > # This is line 3581 of a file with a large header. > # This is line 3582 of a file with a large header. > # This is line 3583 of a file with a large header. > # This is line 3584 of a file with a large header. > # This is line 3585 of a file with a large header. > # This is line 3586 of a file with a large header. > # This is line 3587 of a file with a large header. > # This is line 3588 of a file with a large header. > # This is line 3589 of a file with a large header. > # This is line 3590 of a file with a large header. > # This is line 3591 of a file with a large header. > # This is line 3592 of a file with a large header. > # This is line 3593 of a file with a large header. > # This is line 3594 of a file with a large header. > # This is line 3595 of a file with a large header. > # This is line 3596 of a file with a large header. > # This is line 3597 of a file with a large header. > # This is line 3598 of a file with a large header. > # This is line 3599 of a file with a large header. > # This is line 3600 of a file with a large header. > # This is line 3601 of a file with a large header. > # This is line 3602 of a file with a large header. > # This is line 3603 of a file with a large header. > # This is line 3604 of a file with a large header. > # This is line 3605 of a file with a large header. > # This is line 3606 of a file with a large header. > # This is line 3607 of a file with a large header. > # This is line 3608 of a file with a large header. > # This is line 3609 of a file with a large header. > # This is line 3610 of a file with a large header. > # This is line 3611 of a file with a large header. > # This is line 3612 of a file with a large header. > # This is line 3613 of a file with a large header. > # This is line 3614 of a file with a large header. > # This is line 3615 of a file with a large header. > # This is line 3616 of a file with a large header. > # This is line 3617 of a file with a large header. > # This is line 3618 of a file with a large header. > # This is line 3619 of a file with a large header. > # This is line 3620 of a file with a large header. > # This is line 3621 of a file with a large header. > # This is line 3622 of a file with a large header. > # This is line 3623 of a file with a large header. > # This is line 3624 of a file with a large header. > # This is line 3625 of a file with a large header. > # This is line 3626 of a file with a large header. > # This is line 3627 of a file with a large header. > # This is line 3628 of a file with a large header. > # This is line 3629 of a file with a large header. > # This is line 3630 of a file with a large header. > # This is line 3631 of a file with a large header. > # This is line 3632 of a file with a large header. > # This is line 3633 of a file with a large header. > # This is line 3634 of a file with a large header. > # This is line 3635 of a file with a large header. > # This is line 3636 of a file with a large header. > # This is line 3637 of a file with a large header. > # This is line 3638 of a file with a large header. > # This is line 3639 of a file with a large header. > # This is line 3640 of a file with a large header. > # This is line 3641 of a file with a large header. > # This is line 3642 of a file with a large header. > # This is line 3643 of a file with a large header. > # This is line 3644 of a file with a large header. > # This is line 3645 of a file with a large header. > # This is line 3646 of a file with a large header. > # This is line 3647 of a file with a large header. > # This is line 3648 of a file with a large header. > # This is line 3649 of a file with a large header. > # This is line 3650 of a file with a large header. > # This is line 3651 of a file with a large header. > # This is line 3652 of a file with a large header. > # This is line 3653 of a file with a large header. > # This is line 3654 of a file with a large header. > # This is line 3655 of a file with a large header. > # This is line 3656 of a file with a large header. > # This is line 3657 of a file with a large header. > # This is line 3658 of a file with a large header. > # This is line 3659 of a file with a large header. > # This is line 3660 of a file with a large header. > # This is line 3661 of a file with a large header. > # This is line 3662 of a file with a large header. > # This is line 3663 of a file with a large header. > # This is line 3664 of a file with a large header. > # This is line 3665 of a file with a large header. > # This is line 3666 of a file with a large header. > # This is line 3667 of a file with a large header. > # This is line 3668 of a file with a large header. > # This is line 3669 of a file with a large header. > # This is line 3670 of a file with a large header. > # This is line 3671 of a file with a large header. > # This is line 3672 of a file with a large header. > # This is line 3673 of a file with a large header. > # This is line 3674 of a file with a large header. > # This is line 3675 of a file with a large header. > # This is line 3676 of a file with a large header. > # This is line 3677 of a file with a large header. > # This is line 3678 of a file with a large header. > # This is line 3679 of a file with a large header. > # This is line 3680 of a file with a large header. > # This is line 3681 of a file with a large header. > # This is line 3682 of a file with a large header. > # This is line 3683 of a file with a large header. > # This is line 3684 of a file with a large header. > # This is line 3685 of a file with a large header. > # This is line 3686 of a file with a large header. > # This is line 3687 of a file with a large header. > # This is line 3688 of a file with a large header. > # This is line 3689 of a file with a large header. > # This is line 3690 of a file with a large header. > # This is line 3691 of a file with a large header. > # This is line 3692 of a file with a large header. > # This is line 3693 of a file with a large header. > # This is line 3694 of a file with a large header. > # This is line 3695 of a file with a large header. > # This is line 3696 of a file with a large header. > # This is line 3697 of a file with a large header. > # This is line 3698 of a file with a large header. > # This is line 3699 of a file with a large header. > # This is line 3700 of a file with a large header. > # This is line 3701 of a file with a large header. > # This is line 3702 of a file with a large header. > # This is line 3703 of a file with a large header. > # This is line 3704 of a file with a large header. > # This is line 3705 of a file with a large header. > # This is line 3706 of a file with a large header. > # This is line 3707 of a file with a large header. > # This is line 3708 of a file with a large header. > # This is line 3709 of a file with a large header. > # This is line 3710 of a file with a large header. > # This is line 3711 of a file with a large header. > # This is line 3712 of a file with a large header. > # This is line 3713 of a file with a large header. > # This is line 3714 of a file with a large header. > # This is line 3715 of a file with a large header. > # This is line 3716 of a file with a large header. > # This is line 3717 of a file with a large header. > # This is line 3718 of a file with a large header. > # This is line 3719 of a file with a large header. > # This is line 3720 of a file with a large header. > # This is line 3721 of a file with a large header. > # This is line 3722 of a file with a large header. > # This is line 3723 of a file with a large header. > # This is line 3724 of a file with a large header. > # This is line 3725 of a file with a large header. > # This is line 3726 of a file with a large header. > # This is line 3727 of a file with a large header. > # This is line 3728 of a file with a large header. > # This is line 3729 of a file with a large header. > # This is line 3730 of a file with a large header. > # This is line 3731 of a file with a large header. > # This is line 3732 of a file with a large header. > # This is line 3733 of a file with a large header. > # This is line 3734 of a file with a large header. > # This is line 3735 of a file with a large header. > # This is line 3736 of a file with a large header. > # This is line 3737 of a file with a large header. > # This is line 3738 of a file with a large header. > # This is line 3739 of a file with a large header. > # This is line 3740 of a file with a large header. > # This is line 3741 of a file with a large header. > # This is line 3742 of a file with a large header. > # This is line 3743 of a file with a large header. > # This is line 3744 of a file with a large header. > # This is line 3745 of a file with a large header. > # This is line 3746 of a file with a large header. > # This is line 3747 of a file with a large header. > # This is line 3748 of a file with a large header. > # This is line 3749 of a file with a large header. > # This is line 3750 of a file with a large header. > # This is line 3751 of a file with a large header. > # This is line 3752 of a file with a large header. > # This is line 3753 of a file with a large header. > # This is line 3754 of a file with a large header. > # This is line 3755 of a file with a large header. > # This is line 3756 of a file with a large header. > # This is line 3757 of a file with a large header. > # This is line 3758 of a file with a large header. > # This is line 3759 of a file with a large header. > # This is line 3760 of a file with a large header. > # This is line 3761 of a file with a large header. > # This is line 3762 of a file with a large header. > # This is line 3763 of a file with a large header. > # This is line 3764 of a file with a large header. > # This is line 3765 of a file with a large header. > # This is line 3766 of a file with a large header. > # This is line 3767 of a file with a large header. > # This is line 3768 of a file with a large header. > # This is line 3769 of a file with a large header. > # This is line 3770 of a file with a large header. > # This is line 3771 of a file with a large header. > # This is line 3772 of a file with a large header. > # This is line 3773 of a file with a large header. > # This is line 3774 of a file with a large header. > # This is line 3775 of a file with a large header. > # This is line 3776 of a file with a large header. > # This is line 3777 of a file with a large header. > # This is line 3778 of a file with a large header. > # This is line 3779 of a file with a large header. > # This is line 3780 of a file with a large header. > # This is line 3781 of a file with a large header. > # This is line 3782 of a file with a large header. > # This is line 3783 of a file with a large header. > # This is line 3784 of a file with a large header. > # This is line 3785 of a file with a large header. > # This is line 3786 of a file with a large header. > # This is line 3787 of a file with a large header. > # This is line 3788 of a file with a large header. > # This is line 3789 of a file with a large header. > # This is line 3790 of a file with a large header. > # This is line 3791 of a file with a large header. > # This is line 3792 of a file with a large header. > # This is line 3793 of a file with a large header. > # This is line 3794 of a file with a large header. > # This is line 3795 of a file with a large header. > # This is line 3796 of a file with a large header. > # This is line 3797 of a file with a large header. > # This is line 3798 of a file with a large header. > # This is line 3799 of a file with a large header. > # This is line 3800 of a file with a large header. > # This is line 3801 of a file with a large header. > # This is line 3802 of a file with a large header. > # This is line 3803 of a file with a large header. > # This is line 3804 of a file with a large header. > # This is line 3805 of a file with a large header. > # This is line 3806 of a file with a large header. > # This is line 3807 of a file with a large header. > # This is line 3808 of a file with a large header. > # This is line 3809 of a file with a large header. > # This is line 3810 of a file with a large header. > # This is line 3811 of a file with a large header. > # This is line 3812 of a file with a large header. > # This is line 3813 of a file with a large header. > # This is line 3814 of a file with a large header. > # This is line 3815 of a file with a large header. > # This is line 3816 of a file with a large header. > # This is line 3817 of a file with a large header. > # This is line 3818 of a file with a large header. > # This is line 3819 of a file with a large header. > # This is line 3820 of a file with a large header. > # This is line 3821 of a file with a large header. > # This is line 3822 of a file with a large header. > # This is line 3823 of a file with a large header. > # This is line 3824 of a file with a large header. > # This is line 3825 of a file with a large header. > # This is line 3826 of a file with a large header. > # This is line 3827 of a file with a large header. > # This is line 3828 of a file with a large header. > # This is line 3829 of a file with a large header. > # This is line 3830 of a file with a large header. > # This is line 3831 of a file with a large header. > # This is line 3832 of a file with a large header. > # This is line 3833 of a file with a large header. > # This is line 3834 of a file with a large header. > # This is line 3835 of a file with a large header. > # This is line 3836 of a file with a large header. > # This is line 3837 of a file with a large header. > # This is line 3838 of a file with a large header. > # This is line 3839 of a file with a large header. > # This is line 3840 of a file with a large header. > # This is line 3841 of a file with a large header. > # This is line 3842 of a file with a large header. > # This is line 3843 of a file with a large header. > # This is line 3844 of a file with a large header. > # This is line 3845 of a file with a large header. > # This is line 3846 of a file with a large header. > # This is line 3847 of a file with a large header. > # This is line 3848 of a file with a large header. > # This is line 3849 of a file with a large header. > # This is line 3850 of a file with a large header. > # This is line 3851 of a file with a large header. > # This is line 3852 of a file with a large header. > # This is line 3853 of a file with a large header. > # This is line 3854 of a file with a large header. > # This is line 3855 of a file with a large header. > # This is line 3856 of a file with a large header. > # This is line 3857 of a file with a large header. > # This is line 3858 of a file with a large header. > # This is line 3859 of a file with a large header. > # This is line 3860 of a file with a large header. > # This is line 3861 of a file with a large header. > # This is line 3862 of a file with a large header. > # This is line 3863 of a file with a large header. > # This is line 3864 of a file with a large header. > # This is line 3865 of a file with a large header. > # This is line 3866 of a file with a large header. > # This is line 3867 of a file with a large header. > # This is line 3868 of a file with a large header. > # This is line 3869 of a file with a large header. > # This is line 3870 of a file with a large header. > # This is line 3871 of a file with a large header. > # This is line 3872 of a file with a large header. > # This is line 3873 of a file with a large header. > # This is line 3874 of a file with a large header. > # This is line 3875 of a file with a large header. > # This is line 3876 of a file with a large header. > # This is line 3877 of a file with a large header. > # This is line 3878 of a file with a large header. > # This is line 3879 of a file with a large header. > # This is line 3880 of a file with a large header. > # This is line 3881 of a file with a large header. > # This is line 3882 of a file with a large header. > # This is line 3883 of a file with a large header. > # This is line 3884 of a file with a large header. > # This is line 3885 of a file with a large header. > # This is line 3886 of a file with a large header. > # This is line 3887 of a file with a large header. > # This is line 3888 of a file with a large header. > # This is line 3889 of a file with a large header. > # This is line 3890 of a file with a large header. > # This is line 3891 of a file with a large header. > # This is line 3892 of a file with a large header. > # This is line 3893 of a file with a large header. > # This is line 3894 of a file with a large header. > # This is line 3895 of a file with a large header. > # This is line 3896 of a file with a large header. > # This is line 3897 of a file with a large header. > # This is line 3898 of a file with a large header. > # This is line 3899 of a file with a large header. > # This is line 3900 of a file with a large header. > # This is line 3901 of a file with a large header. > # This is line 3902 of a file with a large header. > # This is line 3903 of a file with a large header. > # This is line 3904 of a file with a large header. > # This is line 3905 of a file with a large header. > # This is line 3906 of a file with a large header. > # This is line 3907 of a file with a large header. > # This is line 3908 of a file with a large header. > # This is line 3909 of a file with a large header. > # This is line 3910 of a file with a large header. > # This is line 3911 of a file with a large header. > # This is line 3912 of a file with a large header. > # This is line 3913 of a file with a large header. > # This is line 3914 of a file with a large header. > # This is line 3915 of a file with a large header. > # This is line 3916 of a file with a large header. > # This is line 3917 of a file with a large header. > # This is line 3918 of a file with a large header. > # This is line 3919 of a file with a large header. > # This is line 3920 of a file with a large header. > # This is line 3921 of a file with a large header. > # This is line 3922 of a file with a large header. > # This is line 3923 of a file with a large header. > # This is line 3924 of a file with a large header. > # This is line 3925 of a file with a large header. > # This is line 3926 of a file with a large header. > # This is line 3927 of a file with a large header. > # This is line 3928 of a file with a large header. > # This is line 3929 of a file with a large header. > # This is line 3930 of a file with a large header. > # This is line 3931 of a file with a large header. > # This is line 3932 of a file with a large header. > # This is line 3933 of a file with a large header. > # This is line 3934 of a file with a large header. > # This is line 3935 of a file with a large header. > # This is line 3936 of a file with a large header. > # This is line 3937 of a file with a large header. > # This is line 3938 of a file with a large header. > # This is line 3939 of a file with a large header. > # This is line 3940 of a file with a large header. > # This is line 3941 of a file with a large header. > # This is line 3942 of a file with a large header. > # This is line 3943 of a file with a large header. > # This is line 3944 of a file with a large header. > # This is line 3945 of a file with a large header. > # This is line 3946 of a file with a large header. > # This is line 3947 of a file with a large header. > # This is line 3948 of a file with a large header. > # This is line 3949 of a file with a large header. > # This is line 3950 of a file with a large header. > # This is line 3951 of a file with a large header. > # This is line 3952 of a file with a large header. > # This is line 3953 of a file with a large header. > # This is line 3954 of a file with a large header. > # This is line 3955 of a file with a large header. > # This is line 3956 of a file with a large header. > # This is line 3957 of a file with a large header. > # This is line 3958 of a file with a large header. > # This is line 3959 of a file with a large header. > # This is line 3960 of a file with a large header. > # This is line 3961 of a file with a large header. > # This is line 3962 of a file with a large header. > # This is line 3963 of a file with a large header. > # This is line 3964 of a file with a large header. > # This is line 3965 of a file with a large header. > # This is line 3966 of a file with a large header. > # This is line 3967 of a file with a large header. > # This is line 3968 of a file with a large header. > # This is line 3969 of a file with a large header. > # This is line 3970 of a file with a large header. > # This is line 3971 of a file with a large header. > # This is line 3972 of a file with a large header. > # This is line 3973 of a file with a large header. > # This is line 3974 of a file with a large header. > # This is line 3975 of a file with a large header. > # This is line 3976 of a file with a large header. > # This is line 3977 of a file with a large header. > # This is line 3978 of a file with a large header. > # This is line 3979 of a file with a large header. > # This is line 3980 of a file with a large header. > # This is line 3981 of a file with a large header. > # This is line 3982 of a file with a large header. > # This is line 3983 of a file with a large header. > # This is line 3984 of a file with a large header. > # This is line 3985 of a file with a large header. > # This is line 3986 of a file with a large header. > # This is line 3987 of a file with a large header. > # This is line 3988 of a file with a large header. > # This is line 3989 of a file with a large header. > # This is line 3990 of a file with a large header. > # This is line 3991 of a file with a large header. > # This is line 3992 of a file with a large header. > # This is line 3993 of a file with a large header. > # This is line 3994 of a file with a large header. > # This is line 3995 of a file with a large header. > # This is line 3996 of a file with a large header. > # This is line 3997 of a file with a large header. > # This is line 3998 of a file with a large header. > # This is line 3999 of a file with a large header. > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t46...\c 0a1,4002 > # This is line 0 of a file with a large header. > # This is line 1 of a file with a large header. > # This is line 2 of a file with a large header. > # This is line 3 of a file with a large header. > # This is line 4 of a file with a large header. > # This is line 5 of a file with a large header. > # This is line 6 of a file with a large header. > # This is line 7 of a file with a large header. > # This is line 8 of a file with a large header. > # This is line 9 of a file with a large header. > # This is line 10 of a file with a large header. > # This is line 11 of a file with a large header. > # This is line 12 of a file with a large header. > # This is line 13 of a file with a large header. > # This is line 14 of a file with a large header. > # This is line 15 of a file with a large header. > # This is line 16 of a file with a large header. > # This is line 17 of a file with a large header. > # This is line 18 of a file with a large header. > # This is line 19 of a file with a large header. > # This is line 20 of a file with a large header. > # This is line 21 of a file with a large header. > # This is line 22 of a file with a large header. > # This is line 23 of a file with a large header. > # This is line 24 of a file with a large header. > # This is line 25 of a file with a large header. > # This is line 26 of a file with a large header. > # This is line 27 of a file with a large header. > # This is line 28 of a file with a large header. > # This is line 29 of a file with a large header. > # This is line 30 of a file with a large header. > # This is line 31 of a file with a large header. > # This is line 32 of a file with a large header. > # This is line 33 of a file with a large header. > # This is line 34 of a file with a large header. > # This is line 35 of a file with a large header. > # This is line 36 of a file with a large header. > # This is line 37 of a file with a large header. > # This is line 38 of a file with a large header. > # This is line 39 of a file with a large header. > # This is line 40 of a file with a large header. > # This is line 41 of a file with a large header. > # This is line 42 of a file with a large header. > # This is line 43 of a file with a large header. > # This is line 44 of a file with a large header. > # This is line 45 of a file with a large header. > # This is line 46 of a file with a large header. > # This is line 47 of a file with a large header. > # This is line 48 of a file with a large header. > # This is line 49 of a file with a large header. > # This is line 50 of a file with a large header. > # This is line 51 of a file with a large header. > # This is line 52 of a file with a large header. > # This is line 53 of a file with a large header. > # This is line 54 of a file with a large header. > # This is line 55 of a file with a large header. > # This is line 56 of a file with a large header. > # This is line 57 of a file with a large header. > # This is line 58 of a file with a large header. > # This is line 59 of a file with a large header. > # This is line 60 of a file with a large header. > # This is line 61 of a file with a large header. > # This is line 62 of a file with a large header. > # This is line 63 of a file with a large header. > # This is line 64 of a file with a large header. > # This is line 65 of a file with a large header. > # This is line 66 of a file with a large header. > # This is line 67 of a file with a large header. > # This is line 68 of a file with a large header. > # This is line 69 of a file with a large header. > # This is line 70 of a file with a large header. > # This is line 71 of a file with a large header. > # This is line 72 of a file with a large header. > # This is line 73 of a file with a large header. > # This is line 74 of a file with a large header. > # This is line 75 of a file with a large header. > # This is line 76 of a file with a large header. > # This is line 77 of a file with a large header. > # This is line 78 of a file with a large header. > # This is line 79 of a file with a large header. > # This is line 80 of a file with a large header. > # This is line 81 of a file with a large header. > # This is line 82 of a file with a large header. > # This is line 83 of a file with a large header. > # This is line 84 of a file with a large header. > # This is line 85 of a file with a large header. > # This is line 86 of a file with a large header. > # This is line 87 of a file with a large header. > # This is line 88 of a file with a large header. > # This is line 89 of a file with a large header. > # This is line 90 of a file with a large header. > # This is line 91 of a file with a large header. > # This is line 92 of a file with a large header. > # This is line 93 of a file with a large header. > # This is line 94 of a file with a large header. > # This is line 95 of a file with a large header. > # This is line 96 of a file with a large header. > # This is line 97 of a file with a large header. > # This is line 98 of a file with a large header. > # This is line 99 of a file with a large header. > # This is line 100 of a file with a large header. > # This is line 101 of a file with a large header. > # This is line 102 of a file with a large header. > # This is line 103 of a file with a large header. > # This is line 104 of a file with a large header. > # This is line 105 of a file with a large header. > # This is line 106 of a file with a large header. > # This is line 107 of a file with a large header. > # This is line 108 of a file with a large header. > # This is line 109 of a file with a large header. > # This is line 110 of a file with a large header. > # This is line 111 of a file with a large header. > # This is line 112 of a file with a large header. > # This is line 113 of a file with a large header. > # This is line 114 of a file with a large header. > # This is line 115 of a file with a large header. > # This is line 116 of a file with a large header. > # This is line 117 of a file with a large header. > # This is line 118 of a file with a large header. > # This is line 119 of a file with a large header. > # This is line 120 of a file with a large header. > # This is line 121 of a file with a large header. > # This is line 122 of a file with a large header. > # This is line 123 of a file with a large header. > # This is line 124 of a file with a large header. > # This is line 125 of a file with a large header. > # This is line 126 of a file with a large header. > # This is line 127 of a file with a large header. > # This is line 128 of a file with a large header. > # This is line 129 of a file with a large header. > # This is line 130 of a file with a large header. > # This is line 131 of a file with a large header. > # This is line 132 of a file with a large header. > # This is line 133 of a file with a large header. > # This is line 134 of a file with a large header. > # This is line 135 of a file with a large header. > # This is line 136 of a file with a large header. > # This is line 137 of a file with a large header. > # This is line 138 of a file with a large header. > # This is line 139 of a file with a large header. > # This is line 140 of a file with a large header. > # This is line 141 of a file with a large header. > # This is line 142 of a file with a large header. > # This is line 143 of a file with a large header. > # This is line 144 of a file with a large header. > # This is line 145 of a file with a large header. > # This is line 146 of a file with a large header. > # This is line 147 of a file with a large header. > # This is line 148 of a file with a large header. > # This is line 149 of a file with a large header. > # This is line 150 of a file with a large header. > # This is line 151 of a file with a large header. > # This is line 152 of a file with a large header. > # This is line 153 of a file with a large header. > # This is line 154 of a file with a large header. > # This is line 155 of a file with a large header. > # This is line 156 of a file with a large header. > # This is line 157 of a file with a large header. > # This is line 158 of a file with a large header. > # This is line 159 of a file with a large header. > # This is line 160 of a file with a large header. > # This is line 161 of a file with a large header. > # This is line 162 of a file with a large header. > # This is line 163 of a file with a large header. > # This is line 164 of a file with a large header. > # This is line 165 of a file with a large header. > # This is line 166 of a file with a large header. > # This is line 167 of a file with a large header. > # This is line 168 of a file with a large header. > # This is line 169 of a file with a large header. > # This is line 170 of a file with a large header. > # This is line 171 of a file with a large header. > # This is line 172 of a file with a large header. > # This is line 173 of a file with a large header. > # This is line 174 of a file with a large header. > # This is line 175 of a file with a large header. > # This is line 176 of a file with a large header. > # This is line 177 of a file with a large header. > # This is line 178 of a file with a large header. > # This is line 179 of a file with a large header. > # This is line 180 of a file with a large header. > # This is line 181 of a file with a large header. > # This is line 182 of a file with a large header. > # This is line 183 of a file with a large header. > # This is line 184 of a file with a large header. > # This is line 185 of a file with a large header. > # This is line 186 of a file with a large header. > # This is line 187 of a file with a large header. > # This is line 188 of a file with a large header. > # This is line 189 of a file with a large header. > # This is line 190 of a file with a large header. > # This is line 191 of a file with a large header. > # This is line 192 of a file with a large header. > # This is line 193 of a file with a large header. > # This is line 194 of a file with a large header. > # This is line 195 of a file with a large header. > # This is line 196 of a file with a large header. > # This is line 197 of a file with a large header. > # This is line 198 of a file with a large header. > # This is line 199 of a file with a large header. > # This is line 200 of a file with a large header. > # This is line 201 of a file with a large header. > # This is line 202 of a file with a large header. > # This is line 203 of a file with a large header. > # This is line 204 of a file with a large header. > # This is line 205 of a file with a large header. > # This is line 206 of a file with a large header. > # This is line 207 of a file with a large header. > # This is line 208 of a file with a large header. > # This is line 209 of a file with a large header. > # This is line 210 of a file with a large header. > # This is line 211 of a file with a large header. > # This is line 212 of a file with a large header. > # This is line 213 of a file with a large header. > # This is line 214 of a file with a large header. > # This is line 215 of a file with a large header. > # This is line 216 of a file with a large header. > # This is line 217 of a file with a large header. > # This is line 218 of a file with a large header. > # This is line 219 of a file with a large header. > # This is line 220 of a file with a large header. > # This is line 221 of a file with a large header. > # This is line 222 of a file with a large header. > # This is line 223 of a file with a large header. > # This is line 224 of a file with a large header. > # This is line 225 of a file with a large header. > # This is line 226 of a file with a large header. > # This is line 227 of a file with a large header. > # This is line 228 of a file with a large header. > # This is line 229 of a file with a large header. > # This is line 230 of a file with a large header. > # This is line 231 of a file with a large header. > # This is line 232 of a file with a large header. > # This is line 233 of a file with a large header. > # This is line 234 of a file with a large header. > # This is line 235 of a file with a large header. > # This is line 236 of a file with a large header. > # This is line 237 of a file with a large header. > # This is line 238 of a file with a large header. > # This is line 239 of a file with a large header. > # This is line 240 of a file with a large header. > # This is line 241 of a file with a large header. > # This is line 242 of a file with a large header. > # This is line 243 of a file with a large header. > # This is line 244 of a file with a large header. > # This is line 245 of a file with a large header. > # This is line 246 of a file with a large header. > # This is line 247 of a file with a large header. > # This is line 248 of a file with a large header. > # This is line 249 of a file with a large header. > # This is line 250 of a file with a large header. > # This is line 251 of a file with a large header. > # This is line 252 of a file with a large header. > # This is line 253 of a file with a large header. > # This is line 254 of a file with a large header. > # This is line 255 of a file with a large header. > # This is line 256 of a file with a large header. > # This is line 257 of a file with a large header. > # This is line 258 of a file with a large header. > # This is line 259 of a file with a large header. > # This is line 260 of a file with a large header. > # This is line 261 of a file with a large header. > # This is line 262 of a file with a large header. > # This is line 263 of a file with a large header. > # This is line 264 of a file with a large header. > # This is line 265 of a file with a large header. > # This is line 266 of a file with a large header. > # This is line 267 of a file with a large header. > # This is line 268 of a file with a large header. > # This is line 269 of a file with a large header. > # This is line 270 of a file with a large header. > # This is line 271 of a file with a large header. > # This is line 272 of a file with a large header. > # This is line 273 of a file with a large header. > # This is line 274 of a file with a large header. > # This is line 275 of a file with a large header. > # This is line 276 of a file with a large header. > # This is line 277 of a file with a large header. > # This is line 278 of a file with a large header. > # This is line 279 of a file with a large header. > # This is line 280 of a file with a large header. > # This is line 281 of a file with a large header. > # This is line 282 of a file with a large header. > # This is line 283 of a file with a large header. > # This is line 284 of a file with a large header. > # This is line 285 of a file with a large header. > # This is line 286 of a file with a large header. > # This is line 287 of a file with a large header. > # This is line 288 of a file with a large header. > # This is line 289 of a file with a large header. > # This is line 290 of a file with a large header. > # This is line 291 of a file with a large header. > # This is line 292 of a file with a large header. > # This is line 293 of a file with a large header. > # This is line 294 of a file with a large header. > # This is line 295 of a file with a large header. > # This is line 296 of a file with a large header. > # This is line 297 of a file with a large header. > # This is line 298 of a file with a large header. > # This is line 299 of a file with a large header. > # This is line 300 of a file with a large header. > # This is line 301 of a file with a large header. > # This is line 302 of a file with a large header. > # This is line 303 of a file with a large header. > # This is line 304 of a file with a large header. > # This is line 305 of a file with a large header. > # This is line 306 of a file with a large header. > # This is line 307 of a file with a large header. > # This is line 308 of a file with a large header. > # This is line 309 of a file with a large header. > # This is line 310 of a file with a large header. > # This is line 311 of a file with a large header. > # This is line 312 of a file with a large header. > # This is line 313 of a file with a large header. > # This is line 314 of a file with a large header. > # This is line 315 of a file with a large header. > # This is line 316 of a file with a large header. > # This is line 317 of a file with a large header. > # This is line 318 of a file with a large header. > # This is line 319 of a file with a large header. > # This is line 320 of a file with a large header. > # This is line 321 of a file with a large header. > # This is line 322 of a file with a large header. > # This is line 323 of a file with a large header. > # This is line 324 of a file with a large header. > # This is line 325 of a file with a large header. > # This is line 326 of a file with a large header. > # This is line 327 of a file with a large header. > # This is line 328 of a file with a large header. > # This is line 329 of a file with a large header. > # This is line 330 of a file with a large header. > # This is line 331 of a file with a large header. > # This is line 332 of a file with a large header. > # This is line 333 of a file with a large header. > # This is line 334 of a file with a large header. > # This is line 335 of a file with a large header. > # This is line 336 of a file with a large header. > # This is line 337 of a file with a large header. > # This is line 338 of a file with a large header. > # This is line 339 of a file with a large header. > # This is line 340 of a file with a large header. > # This is line 341 of a file with a large header. > # This is line 342 of a file with a large header. > # This is line 343 of a file with a large header. > # This is line 344 of a file with a large header. > # This is line 345 of a file with a large header. > # This is line 346 of a file with a large header. > # This is line 347 of a file with a large header. > # This is line 348 of a file with a large header. > # This is line 349 of a file with a large header. > # This is line 350 of a file with a large header. > # This is line 351 of a file with a large header. > # This is line 352 of a file with a large header. > # This is line 353 of a file with a large header. > # This is line 354 of a file with a large header. > # This is line 355 of a file with a large header. > # This is line 356 of a file with a large header. > # This is line 357 of a file with a large header. > # This is line 358 of a file with a large header. > # This is line 359 of a file with a large header. > # This is line 360 of a file with a large header. > # This is line 361 of a file with a large header. > # This is line 362 of a file with a large header. > # This is line 363 of a file with a large header. > # This is line 364 of a file with a large header. > # This is line 365 of a file with a large header. > # This is line 366 of a file with a large header. > # This is line 367 of a file with a large header. > # This is line 368 of a file with a large header. > # This is line 369 of a file with a large header. > # This is line 370 of a file with a large header. > # This is line 371 of a file with a large header. > # This is line 372 of a file with a large header. > # This is line 373 of a file with a large header. > # This is line 374 of a file with a large header. > # This is line 375 of a file with a large header. > # This is line 376 of a file with a large header. > # This is line 377 of a file with a large header. > # This is line 378 of a file with a large header. > # This is line 379 of a file with a large header. > # This is line 380 of a file with a large header. > # This is line 381 of a file with a large header. > # This is line 382 of a file with a large header. > # This is line 383 of a file with a large header. > # This is line 384 of a file with a large header. > # This is line 385 of a file with a large header. > # This is line 386 of a file with a large header. > # This is line 387 of a file with a large header. > # This is line 388 of a file with a large header. > # This is line 389 of a file with a large header. > # This is line 390 of a file with a large header. > # This is line 391 of a file with a large header. > # This is line 392 of a file with a large header. > # This is line 393 of a file with a large header. > # This is line 394 of a file with a large header. > # This is line 395 of a file with a large header. > # This is line 396 of a file with a large header. > # This is line 397 of a file with a large header. > # This is line 398 of a file with a large header. > # This is line 399 of a file with a large header. > # This is line 400 of a file with a large header. > # This is line 401 of a file with a large header. > # This is line 402 of a file with a large header. > # This is line 403 of a file with a large header. > # This is line 404 of a file with a large header. > # This is line 405 of a file with a large header. > # This is line 406 of a file with a large header. > # This is line 407 of a file with a large header. > # This is line 408 of a file with a large header. > # This is line 409 of a file with a large header. > # This is line 410 of a file with a large header. > # This is line 411 of a file with a large header. > # This is line 412 of a file with a large header. > # This is line 413 of a file with a large header. > # This is line 414 of a file with a large header. > # This is line 415 of a file with a large header. > # This is line 416 of a file with a large header. > # This is line 417 of a file with a large header. > # This is line 418 of a file with a large header. > # This is line 419 of a file with a large header. > # This is line 420 of a file with a large header. > # This is line 421 of a file with a large header. > # This is line 422 of a file with a large header. > # This is line 423 of a file with a large header. > # This is line 424 of a file with a large header. > # This is line 425 of a file with a large header. > # This is line 426 of a file with a large header. > # This is line 427 of a file with a large header. > # This is line 428 of a file with a large header. > # This is line 429 of a file with a large header. > # This is line 430 of a file with a large header. > # This is line 431 of a file with a large header. > # This is line 432 of a file with a large header. > # This is line 433 of a file with a large header. > # This is line 434 of a file with a large header. > # This is line 435 of a file with a large header. > # This is line 436 of a file with a large header. > # This is line 437 of a file with a large header. > # This is line 438 of a file with a large header. > # This is line 439 of a file with a large header. > # This is line 440 of a file with a large header. > # This is line 441 of a file with a large header. > # This is line 442 of a file with a large header. > # This is line 443 of a file with a large header. > # This is line 444 of a file with a large header. > # This is line 445 of a file with a large header. > # This is line 446 of a file with a large header. > # This is line 447 of a file with a large header. > # This is line 448 of a file with a large header. > # This is line 449 of a file with a large header. > # This is line 450 of a file with a large header. > # This is line 451 of a file with a large header. > # This is line 452 of a file with a large header. > # This is line 453 of a file with a large header. > # This is line 454 of a file with a large header. > # This is line 455 of a file with a large header. > # This is line 456 of a file with a large header. > # This is line 457 of a file with a large header. > # This is line 458 of a file with a large header. > # This is line 459 of a file with a large header. > # This is line 460 of a file with a large header. > # This is line 461 of a file with a large header. > # This is line 462 of a file with a large header. > # This is line 463 of a file with a large header. > # This is line 464 of a file with a large header. > # This is line 465 of a file with a large header. > # This is line 466 of a file with a large header. > # This is line 467 of a file with a large header. > # This is line 468 of a file with a large header. > # This is line 469 of a file with a large header. > # This is line 470 of a file with a large header. > # This is line 471 of a file with a large header. > # This is line 472 of a file with a large header. > # This is line 473 of a file with a large header. > # This is line 474 of a file with a large header. > # This is line 475 of a file with a large header. > # This is line 476 of a file with a large header. > # This is line 477 of a file with a large header. > # This is line 478 of a file with a large header. > # This is line 479 of a file with a large header. > # This is line 480 of a file with a large header. > # This is line 481 of a file with a large header. > # This is line 482 of a file with a large header. > # This is line 483 of a file with a large header. > # This is line 484 of a file with a large header. > # This is line 485 of a file with a large header. > # This is line 486 of a file with a large header. > # This is line 487 of a file with a large header. > # This is line 488 of a file with a large header. > # This is line 489 of a file with a large header. > # This is line 490 of a file with a large header. > # This is line 491 of a file with a large header. > # This is line 492 of a file with a large header. > # This is line 493 of a file with a large header. > # This is line 494 of a file with a large header. > # This is line 495 of a file with a large header. > # This is line 496 of a file with a large header. > # This is line 497 of a file with a large header. > # This is line 498 of a file with a large header. > # This is line 499 of a file with a large header. > # This is line 500 of a file with a large header. > # This is line 501 of a file with a large header. > # This is line 502 of a file with a large header. > # This is line 503 of a file with a large header. > # This is line 504 of a file with a large header. > # This is line 505 of a file with a large header. > # This is line 506 of a file with a large header. > # This is line 507 of a file with a large header. > # This is line 508 of a file with a large header. > # This is line 509 of a file with a large header. > # This is line 510 of a file with a large header. > # This is line 511 of a file with a large header. > # This is line 512 of a file with a large header. > # This is line 513 of a file with a large header. > # This is line 514 of a file with a large header. > # This is line 515 of a file with a large header. > # This is line 516 of a file with a large header. > # This is line 517 of a file with a large header. > # This is line 518 of a file with a large header. > # This is line 519 of a file with a large header. > # This is line 520 of a file with a large header. > # This is line 521 of a file with a large header. > # This is line 522 of a file with a large header. > # This is line 523 of a file with a large header. > # This is line 524 of a file with a large header. > # This is line 525 of a file with a large header. > # This is line 526 of a file with a large header. > # This is line 527 of a file with a large header. > # This is line 528 of a file with a large header. > # This is line 529 of a file with a large header. > # This is line 530 of a file with a large header. > # This is line 531 of a file with a large header. > # This is line 532 of a file with a large header. > # This is line 533 of a file with a large header. > # This is line 534 of a file with a large header. > # This is line 535 of a file with a large header. > # This is line 536 of a file with a large header. > # This is line 537 of a file with a large header. > # This is line 538 of a file with a large header. > # This is line 539 of a file with a large header. > # This is line 540 of a file with a large header. > # This is line 541 of a file with a large header. > # This is line 542 of a file with a large header. > # This is line 543 of a file with a large header. > # This is line 544 of a file with a large header. > # This is line 545 of a file with a large header. > # This is line 546 of a file with a large header. > # This is line 547 of a file with a large header. > # This is line 548 of a file with a large header. > # This is line 549 of a file with a large header. > # This is line 550 of a file with a large header. > # This is line 551 of a file with a large header. > # This is line 552 of a file with a large header. > # This is line 553 of a file with a large header. > # This is line 554 of a file with a large header. > # This is line 555 of a file with a large header. > # This is line 556 of a file with a large header. > # This is line 557 of a file with a large header. > # This is line 558 of a file with a large header. > # This is line 559 of a file with a large header. > # This is line 560 of a file with a large header. > # This is line 561 of a file with a large header. > # This is line 562 of a file with a large header. > # This is line 563 of a file with a large header. > # This is line 564 of a file with a large header. > # This is line 565 of a file with a large header. > # This is line 566 of a file with a large header. > # This is line 567 of a file with a large header. > # This is line 568 of a file with a large header. > # This is line 569 of a file with a large header. > # This is line 570 of a file with a large header. > # This is line 571 of a file with a large header. > # This is line 572 of a file with a large header. > # This is line 573 of a file with a large header. > # This is line 574 of a file with a large header. > # This is line 575 of a file with a large header. > # This is line 576 of a file with a large header. > # This is line 577 of a file with a large header. > # This is line 578 of a file with a large header. > # This is line 579 of a file with a large header. > # This is line 580 of a file with a large header. > # This is line 581 of a file with a large header. > # This is line 582 of a file with a large header. > # This is line 583 of a file with a large header. > # This is line 584 of a file with a large header. > # This is line 585 of a file with a large header. > # This is line 586 of a file with a large header. > # This is line 587 of a file with a large header. > # This is line 588 of a file with a large header. > # This is line 589 of a file with a large header. > # This is line 590 of a file with a large header. > # This is line 591 of a file with a large header. > # This is line 592 of a file with a large header. > # This is line 593 of a file with a large header. > # This is line 594 of a file with a large header. > # This is line 595 of a file with a large header. > # This is line 596 of a file with a large header. > # This is line 597 of a file with a large header. > # This is line 598 of a file with a large header. > # This is line 599 of a file with a large header. > # This is line 600 of a file with a large header. > # This is line 601 of a file with a large header. > # This is line 602 of a file with a large header. > # This is line 603 of a file with a large header. > # This is line 604 of a file with a large header. > # This is line 605 of a file with a large header. > # This is line 606 of a file with a large header. > # This is line 607 of a file with a large header. > # This is line 608 of a file with a large header. > # This is line 609 of a file with a large header. > # This is line 610 of a file with a large header. > # This is line 611 of a file with a large header. > # This is line 612 of a file with a large header. > # This is line 613 of a file with a large header. > # This is line 614 of a file with a large header. > # This is line 615 of a file with a large header. > # This is line 616 of a file with a large header. > # This is line 617 of a file with a large header. > # This is line 618 of a file with a large header. > # This is line 619 of a file with a large header. > # This is line 620 of a file with a large header. > # This is line 621 of a file with a large header. > # This is line 622 of a file with a large header. > # This is line 623 of a file with a large header. > # This is line 624 of a file with a large header. > # This is line 625 of a file with a large header. > # This is line 626 of a file with a large header. > # This is line 627 of a file with a large header. > # This is line 628 of a file with a large header. > # This is line 629 of a file with a large header. > # This is line 630 of a file with a large header. > # This is line 631 of a file with a large header. > # This is line 632 of a file with a large header. > # This is line 633 of a file with a large header. > # This is line 634 of a file with a large header. > # This is line 635 of a file with a large header. > # This is line 636 of a file with a large header. > # This is line 637 of a file with a large header. > # This is line 638 of a file with a large header. > # This is line 639 of a file with a large header. > # This is line 640 of a file with a large header. > # This is line 641 of a file with a large header. > # This is line 642 of a file with a large header. > # This is line 643 of a file with a large header. > # This is line 644 of a file with a large header. > # This is line 645 of a file with a large header. > # This is line 646 of a file with a large header. > # This is line 647 of a file with a large header. > # This is line 648 of a file with a large header. > # This is line 649 of a file with a large header. > # This is line 650 of a file with a large header. > # This is line 651 of a file with a large header. > # This is line 652 of a file with a large header. > # This is line 653 of a file with a large header. > # This is line 654 of a file with a large header. > # This is line 655 of a file with a large header. > # This is line 656 of a file with a large header. > # This is line 657 of a file with a large header. > # This is line 658 of a file with a large header. > # This is line 659 of a file with a large header. > # This is line 660 of a file with a large header. > # This is line 661 of a file with a large header. > # This is line 662 of a file with a large header. > # This is line 663 of a file with a large header. > # This is line 664 of a file with a large header. > # This is line 665 of a file with a large header. > # This is line 666 of a file with a large header. > # This is line 667 of a file with a large header. > # This is line 668 of a file with a large header. > # This is line 669 of a file with a large header. > # This is line 670 of a file with a large header. > # This is line 671 of a file with a large header. > # This is line 672 of a file with a large header. > # This is line 673 of a file with a large header. > # This is line 674 of a file with a large header. > # This is line 675 of a file with a large header. > # This is line 676 of a file with a large header. > # This is line 677 of a file with a large header. > # This is line 678 of a file with a large header. > # This is line 679 of a file with a large header. > # This is line 680 of a file with a large header. > # This is line 681 of a file with a large header. > # This is line 682 of a file with a large header. > # This is line 683 of a file with a large header. > # This is line 684 of a file with a large header. > # This is line 685 of a file with a large header. > # This is line 686 of a file with a large header. > # This is line 687 of a file with a large header. > # This is line 688 of a file with a large header. > # This is line 689 of a file with a large header. > # This is line 690 of a file with a large header. > # This is line 691 of a file with a large header. > # This is line 692 of a file with a large header. > # This is line 693 of a file with a large header. > # This is line 694 of a file with a large header. > # This is line 695 of a file with a large header. > # This is line 696 of a file with a large header. > # This is line 697 of a file with a large header. > # This is line 698 of a file with a large header. > # This is line 699 of a file with a large header. > # This is line 700 of a file with a large header. > # This is line 701 of a file with a large header. > # This is line 702 of a file with a large header. > # This is line 703 of a file with a large header. > # This is line 704 of a file with a large header. > # This is line 705 of a file with a large header. > # This is line 706 of a file with a large header. > # This is line 707 of a file with a large header. > # This is line 708 of a file with a large header. > # This is line 709 of a file with a large header. > # This is line 710 of a file with a large header. > # This is line 711 of a file with a large header. > # This is line 712 of a file with a large header. > # This is line 713 of a file with a large header. > # This is line 714 of a file with a large header. > # This is line 715 of a file with a large header. > # This is line 716 of a file with a large header. > # This is line 717 of a file with a large header. > # This is line 718 of a file with a large header. > # This is line 719 of a file with a large header. > # This is line 720 of a file with a large header. > # This is line 721 of a file with a large header. > # This is line 722 of a file with a large header. > # This is line 723 of a file with a large header. > # This is line 724 of a file with a large header. > # This is line 725 of a file with a large header. > # This is line 726 of a file with a large header. > # This is line 727 of a file with a large header. > # This is line 728 of a file with a large header. > # This is line 729 of a file with a large header. > # This is line 730 of a file with a large header. > # This is line 731 of a file with a large header. > # This is line 732 of a file with a large header. > # This is line 733 of a file with a large header. > # This is line 734 of a file with a large header. > # This is line 735 of a file with a large header. > # This is line 736 of a file with a large header. > # This is line 737 of a file with a large header. > # This is line 738 of a file with a large header. > # This is line 739 of a file with a large header. > # This is line 740 of a file with a large header. > # This is line 741 of a file with a large header. > # This is line 742 of a file with a large header. > # This is line 743 of a file with a large header. > # This is line 744 of a file with a large header. > # This is line 745 of a file with a large header. > # This is line 746 of a file with a large header. > # This is line 747 of a file with a large header. > # This is line 748 of a file with a large header. > # This is line 749 of a file with a large header. > # This is line 750 of a file with a large header. > # This is line 751 of a file with a large header. > # This is line 752 of a file with a large header. > # This is line 753 of a file with a large header. > # This is line 754 of a file with a large header. > # This is line 755 of a file with a large header. > # This is line 756 of a file with a large header. > # This is line 757 of a file with a large header. > # This is line 758 of a file with a large header. > # This is line 759 of a file with a large header. > # This is line 760 of a file with a large header. > # This is line 761 of a file with a large header. > # This is line 762 of a file with a large header. > # This is line 763 of a file with a large header. > # This is line 764 of a file with a large header. > # This is line 765 of a file with a large header. > # This is line 766 of a file with a large header. > # This is line 767 of a file with a large header. > # This is line 768 of a file with a large header. > # This is line 769 of a file with a large header. > # This is line 770 of a file with a large header. > # This is line 771 of a file with a large header. > # This is line 772 of a file with a large header. > # This is line 773 of a file with a large header. > # This is line 774 of a file with a large header. > # This is line 775 of a file with a large header. > # This is line 776 of a file with a large header. > # This is line 777 of a file with a large header. > # This is line 778 of a file with a large header. > # This is line 779 of a file with a large header. > # This is line 780 of a file with a large header. > # This is line 781 of a file with a large header. > # This is line 782 of a file with a large header. > # This is line 783 of a file with a large header. > # This is line 784 of a file with a large header. > # This is line 785 of a file with a large header. > # This is line 786 of a file with a large header. > # This is line 787 of a file with a large header. > # This is line 788 of a file with a large header. > # This is line 789 of a file with a large header. > # This is line 790 of a file with a large header. > # This is line 791 of a file with a large header. > # This is line 792 of a file with a large header. > # This is line 793 of a file with a large header. > # This is line 794 of a file with a large header. > # This is line 795 of a file with a large header. > # This is line 796 of a file with a large header. > # This is line 797 of a file with a large header. > # This is line 798 of a file with a large header. > # This is line 799 of a file with a large header. > # This is line 800 of a file with a large header. > # This is line 801 of a file with a large header. > # This is line 802 of a file with a large header. > # This is line 803 of a file with a large header. > # This is line 804 of a file with a large header. > # This is line 805 of a file with a large header. > # This is line 806 of a file with a large header. > # This is line 807 of a file with a large header. > # This is line 808 of a file with a large header. > # This is line 809 of a file with a large header. > # This is line 810 of a file with a large header. > # This is line 811 of a file with a large header. > # This is line 812 of a file with a large header. > # This is line 813 of a file with a large header. > # This is line 814 of a file with a large header. > # This is line 815 of a file with a large header. > # This is line 816 of a file with a large header. > # This is line 817 of a file with a large header. > # This is line 818 of a file with a large header. > # This is line 819 of a file with a large header. > # This is line 820 of a file with a large header. > # This is line 821 of a file with a large header. > # This is line 822 of a file with a large header. > # This is line 823 of a file with a large header. > # This is line 824 of a file with a large header. > # This is line 825 of a file with a large header. > # This is line 826 of a file with a large header. > # This is line 827 of a file with a large header. > # This is line 828 of a file with a large header. > # This is line 829 of a file with a large header. > # This is line 830 of a file with a large header. > # This is line 831 of a file with a large header. > # This is line 832 of a file with a large header. > # This is line 833 of a file with a large header. > # This is line 834 of a file with a large header. > # This is line 835 of a file with a large header. > # This is line 836 of a file with a large header. > # This is line 837 of a file with a large header. > # This is line 838 of a file with a large header. > # This is line 839 of a file with a large header. > # This is line 840 of a file with a large header. > # This is line 841 of a file with a large header. > # This is line 842 of a file with a large header. > # This is line 843 of a file with a large header. > # This is line 844 of a file with a large header. > # This is line 845 of a file with a large header. > # This is line 846 of a file with a large header. > # This is line 847 of a file with a large header. > # This is line 848 of a file with a large header. > # This is line 849 of a file with a large header. > # This is line 850 of a file with a large header. > # This is line 851 of a file with a large header. > # This is line 852 of a file with a large header. > # This is line 853 of a file with a large header. > # This is line 854 of a file with a large header. > # This is line 855 of a file with a large header. > # This is line 856 of a file with a large header. > # This is line 857 of a file with a large header. > # This is line 858 of a file with a large header. > # This is line 859 of a file with a large header. > # This is line 860 of a file with a large header. > # This is line 861 of a file with a large header. > # This is line 862 of a file with a large header. > # This is line 863 of a file with a large header. > # This is line 864 of a file with a large header. > # This is line 865 of a file with a large header. > # This is line 866 of a file with a large header. > # This is line 867 of a file with a large header. > # This is line 868 of a file with a large header. > # This is line 869 of a file with a large header. > # This is line 870 of a file with a large header. > # This is line 871 of a file with a large header. > # This is line 872 of a file with a large header. > # This is line 873 of a file with a large header. > # This is line 874 of a file with a large header. > # This is line 875 of a file with a large header. > # This is line 876 of a file with a large header. > # This is line 877 of a file with a large header. > # This is line 878 of a file with a large header. > # This is line 879 of a file with a large header. > # This is line 880 of a file with a large header. > # This is line 881 of a file with a large header. > # This is line 882 of a file with a large header. > # This is line 883 of a file with a large header. > # This is line 884 of a file with a large header. > # This is line 885 of a file with a large header. > # This is line 886 of a file with a large header. > # This is line 887 of a file with a large header. > # This is line 888 of a file with a large header. > # This is line 889 of a file with a large header. > # This is line 890 of a file with a large header. > # This is line 891 of a file with a large header. > # This is line 892 of a file with a large header. > # This is line 893 of a file with a large header. > # This is line 894 of a file with a large header. > # This is line 895 of a file with a large header. > # This is line 896 of a file with a large header. > # This is line 897 of a file with a large header. > # This is line 898 of a file with a large header. > # This is line 899 of a file with a large header. > # This is line 900 of a file with a large header. > # This is line 901 of a file with a large header. > # This is line 902 of a file with a large header. > # This is line 903 of a file with a large header. > # This is line 904 of a file with a large header. > # This is line 905 of a file with a large header. > # This is line 906 of a file with a large header. > # This is line 907 of a file with a large header. > # This is line 908 of a file with a large header. > # This is line 909 of a file with a large header. > # This is line 910 of a file with a large header. > # This is line 911 of a file with a large header. > # This is line 912 of a file with a large header. > # This is line 913 of a file with a large header. > # This is line 914 of a file with a large header. > # This is line 915 of a file with a large header. > # This is line 916 of a file with a large header. > # This is line 917 of a file with a large header. > # This is line 918 of a file with a large header. > # This is line 919 of a file with a large header. > # This is line 920 of a file with a large header. > # This is line 921 of a file with a large header. > # This is line 922 of a file with a large header. > # This is line 923 of a file with a large header. > # This is line 924 of a file with a large header. > # This is line 925 of a file with a large header. > # This is line 926 of a file with a large header. > # This is line 927 of a file with a large header. > # This is line 928 of a file with a large header. > # This is line 929 of a file with a large header. > # This is line 930 of a file with a large header. > # This is line 931 of a file with a large header. > # This is line 932 of a file with a large header. > # This is line 933 of a file with a large header. > # This is line 934 of a file with a large header. > # This is line 935 of a file with a large header. > # This is line 936 of a file with a large header. > # This is line 937 of a file with a large header. > # This is line 938 of a file with a large header. > # This is line 939 of a file with a large header. > # This is line 940 of a file with a large header. > # This is line 941 of a file with a large header. > # This is line 942 of a file with a large header. > # This is line 943 of a file with a large header. > # This is line 944 of a file with a large header. > # This is line 945 of a file with a large header. > # This is line 946 of a file with a large header. > # This is line 947 of a file with a large header. > # This is line 948 of a file with a large header. > # This is line 949 of a file with a large header. > # This is line 950 of a file with a large header. > # This is line 951 of a file with a large header. > # This is line 952 of a file with a large header. > # This is line 953 of a file with a large header. > # This is line 954 of a file with a large header. > # This is line 955 of a file with a large header. > # This is line 956 of a file with a large header. > # This is line 957 of a file with a large header. > # This is line 958 of a file with a large header. > # This is line 959 of a file with a large header. > # This is line 960 of a file with a large header. > # This is line 961 of a file with a large header. > # This is line 962 of a file with a large header. > # This is line 963 of a file with a large header. > # This is line 964 of a file with a large header. > # This is line 965 of a file with a large header. > # This is line 966 of a file with a large header. > # This is line 967 of a file with a large header. > # This is line 968 of a file with a large header. > # This is line 969 of a file with a large header. > # This is line 970 of a file with a large header. > # This is line 971 of a file with a large header. > # This is line 972 of a file with a large header. > # This is line 973 of a file with a large header. > # This is line 974 of a file with a large header. > # This is line 975 of a file with a large header. > # This is line 976 of a file with a large header. > # This is line 977 of a file with a large header. > # This is line 978 of a file with a large header. > # This is line 979 of a file with a large header. > # This is line 980 of a file with a large header. > # This is line 981 of a file with a large header. > # This is line 982 of a file with a large header. > # This is line 983 of a file with a large header. > # This is line 984 of a file with a large header. > # This is line 985 of a file with a large header. > # This is line 986 of a file with a large header. > # This is line 987 of a file with a large header. > # This is line 988 of a file with a large header. > # This is line 989 of a file with a large header. > # This is line 990 of a file with a large header. > # This is line 991 of a file with a large header. > # This is line 992 of a file with a large header. > # This is line 993 of a file with a large header. > # This is line 994 of a file with a large header. > # This is line 995 of a file with a large header. > # This is line 996 of a file with a large header. > # This is line 997 of a file with a large header. > # This is line 998 of a file with a large header. > # This is line 999 of a file with a large header. > # This is line 1000 of a file with a large header. > # This is line 1001 of a file with a large header. > # This is line 1002 of a file with a large header. > # This is line 1003 of a file with a large header. > # This is line 1004 of a file with a large header. > # This is line 1005 of a file with a large header. > # This is line 1006 of a file with a large header. > # This is line 1007 of a file with a large header. > # This is line 1008 of a file with a large header. > # This is line 1009 of a file with a large header. > # This is line 1010 of a file with a large header. > # This is line 1011 of a file with a large header. > # This is line 1012 of a file with a large header. > # This is line 1013 of a file with a large header. > # This is line 1014 of a file with a large header. > # This is line 1015 of a file with a large header. > # This is line 1016 of a file with a large header. > # This is line 1017 of a file with a large header. > # This is line 1018 of a file with a large header. > # This is line 1019 of a file with a large header. > # This is line 1020 of a file with a large header. > # This is line 1021 of a file with a large header. > # This is line 1022 of a file with a large header. > # This is line 1023 of a file with a large header. > # This is line 1024 of a file with a large header. > # This is line 1025 of a file with a large header. > # This is line 1026 of a file with a large header. > # This is line 1027 of a file with a large header. > # This is line 1028 of a file with a large header. > # This is line 1029 of a file with a large header. > # This is line 1030 of a file with a large header. > # This is line 1031 of a file with a large header. > # This is line 1032 of a file with a large header. > # This is line 1033 of a file with a large header. > # This is line 1034 of a file with a large header. > # This is line 1035 of a file with a large header. > # This is line 1036 of a file with a large header. > # This is line 1037 of a file with a large header. > # This is line 1038 of a file with a large header. > # This is line 1039 of a file with a large header. > # This is line 1040 of a file with a large header. > # This is line 1041 of a file with a large header. > # This is line 1042 of a file with a large header. > # This is line 1043 of a file with a large header. > # This is line 1044 of a file with a large header. > # This is line 1045 of a file with a large header. > # This is line 1046 of a file with a large header. > # This is line 1047 of a file with a large header. > # This is line 1048 of a file with a large header. > # This is line 1049 of a file with a large header. > # This is line 1050 of a file with a large header. > # This is line 1051 of a file with a large header. > # This is line 1052 of a file with a large header. > # This is line 1053 of a file with a large header. > # This is line 1054 of a file with a large header. > # This is line 1055 of a file with a large header. > # This is line 1056 of a file with a large header. > # This is line 1057 of a file with a large header. > # This is line 1058 of a file with a large header. > # This is line 1059 of a file with a large header. > # This is line 1060 of a file with a large header. > # This is line 1061 of a file with a large header. > # This is line 1062 of a file with a large header. > # This is line 1063 of a file with a large header. > # This is line 1064 of a file with a large header. > # This is line 1065 of a file with a large header. > # This is line 1066 of a file with a large header. > # This is line 1067 of a file with a large header. > # This is line 1068 of a file with a large header. > # This is line 1069 of a file with a large header. > # This is line 1070 of a file with a large header. > # This is line 1071 of a file with a large header. > # This is line 1072 of a file with a large header. > # This is line 1073 of a file with a large header. > # This is line 1074 of a file with a large header. > # This is line 1075 of a file with a large header. > # This is line 1076 of a file with a large header. > # This is line 1077 of a file with a large header. > # This is line 1078 of a file with a large header. > # This is line 1079 of a file with a large header. > # This is line 1080 of a file with a large header. > # This is line 1081 of a file with a large header. > # This is line 1082 of a file with a large header. > # This is line 1083 of a file with a large header. > # This is line 1084 of a file with a large header. > # This is line 1085 of a file with a large header. > # This is line 1086 of a file with a large header. > # This is line 1087 of a file with a large header. > # This is line 1088 of a file with a large header. > # This is line 1089 of a file with a large header. > # This is line 1090 of a file with a large header. > # This is line 1091 of a file with a large header. > # This is line 1092 of a file with a large header. > # This is line 1093 of a file with a large header. > # This is line 1094 of a file with a large header. > # This is line 1095 of a file with a large header. > # This is line 1096 of a file with a large header. > # This is line 1097 of a file with a large header. > # This is line 1098 of a file with a large header. > # This is line 1099 of a file with a large header. > # This is line 1100 of a file with a large header. > # This is line 1101 of a file with a large header. > # This is line 1102 of a file with a large header. > # This is line 1103 of a file with a large header. > # This is line 1104 of a file with a large header. > # This is line 1105 of a file with a large header. > # This is line 1106 of a file with a large header. > # This is line 1107 of a file with a large header. > # This is line 1108 of a file with a large header. > # This is line 1109 of a file with a large header. > # This is line 1110 of a file with a large header. > # This is line 1111 of a file with a large header. > # This is line 1112 of a file with a large header. > # This is line 1113 of a file with a large header. > # This is line 1114 of a file with a large header. > # This is line 1115 of a file with a large header. > # This is line 1116 of a file with a large header. > # This is line 1117 of a file with a large header. > # This is line 1118 of a file with a large header. > # This is line 1119 of a file with a large header. > # This is line 1120 of a file with a large header. > # This is line 1121 of a file with a large header. > # This is line 1122 of a file with a large header. > # This is line 1123 of a file with a large header. > # This is line 1124 of a file with a large header. > # This is line 1125 of a file with a large header. > # This is line 1126 of a file with a large header. > # This is line 1127 of a file with a large header. > # This is line 1128 of a file with a large header. > # This is line 1129 of a file with a large header. > # This is line 1130 of a file with a large header. > # This is line 1131 of a file with a large header. > # This is line 1132 of a file with a large header. > # This is line 1133 of a file with a large header. > # This is line 1134 of a file with a large header. > # This is line 1135 of a file with a large header. > # This is line 1136 of a file with a large header. > # This is line 1137 of a file with a large header. > # This is line 1138 of a file with a large header. > # This is line 1139 of a file with a large header. > # This is line 1140 of a file with a large header. > # This is line 1141 of a file with a large header. > # This is line 1142 of a file with a large header. > # This is line 1143 of a file with a large header. > # This is line 1144 of a file with a large header. > # This is line 1145 of a file with a large header. > # This is line 1146 of a file with a large header. > # This is line 1147 of a file with a large header. > # This is line 1148 of a file with a large header. > # This is line 1149 of a file with a large header. > # This is line 1150 of a file with a large header. > # This is line 1151 of a file with a large header. > # This is line 1152 of a file with a large header. > # This is line 1153 of a file with a large header. > # This is line 1154 of a file with a large header. > # This is line 1155 of a file with a large header. > # This is line 1156 of a file with a large header. > # This is line 1157 of a file with a large header. > # This is line 1158 of a file with a large header. > # This is line 1159 of a file with a large header. > # This is line 1160 of a file with a large header. > # This is line 1161 of a file with a large header. > # This is line 1162 of a file with a large header. > # This is line 1163 of a file with a large header. > # This is line 1164 of a file with a large header. > # This is line 1165 of a file with a large header. > # This is line 1166 of a file with a large header. > # This is line 1167 of a file with a large header. > # This is line 1168 of a file with a large header. > # This is line 1169 of a file with a large header. > # This is line 1170 of a file with a large header. > # This is line 1171 of a file with a large header. > # This is line 1172 of a file with a large header. > # This is line 1173 of a file with a large header. > # This is line 1174 of a file with a large header. > # This is line 1175 of a file with a large header. > # This is line 1176 of a file with a large header. > # This is line 1177 of a file with a large header. > # This is line 1178 of a file with a large header. > # This is line 1179 of a file with a large header. > # This is line 1180 of a file with a large header. > # This is line 1181 of a file with a large header. > # This is line 1182 of a file with a large header. > # This is line 1183 of a file with a large header. > # This is line 1184 of a file with a large header. > # This is line 1185 of a file with a large header. > # This is line 1186 of a file with a large header. > # This is line 1187 of a file with a large header. > # This is line 1188 of a file with a large header. > # This is line 1189 of a file with a large header. > # This is line 1190 of a file with a large header. > # This is line 1191 of a file with a large header. > # This is line 1192 of a file with a large header. > # This is line 1193 of a file with a large header. > # This is line 1194 of a file with a large header. > # This is line 1195 of a file with a large header. > # This is line 1196 of a file with a large header. > # This is line 1197 of a file with a large header. > # This is line 1198 of a file with a large header. > # This is line 1199 of a file with a large header. > # This is line 1200 of a file with a large header. > # This is line 1201 of a file with a large header. > # This is line 1202 of a file with a large header. > # This is line 1203 of a file with a large header. > # This is line 1204 of a file with a large header. > # This is line 1205 of a file with a large header. > # This is line 1206 of a file with a large header. > # This is line 1207 of a file with a large header. > # This is line 1208 of a file with a large header. > # This is line 1209 of a file with a large header. > # This is line 1210 of a file with a large header. > # This is line 1211 of a file with a large header. > # This is line 1212 of a file with a large header. > # This is line 1213 of a file with a large header. > # This is line 1214 of a file with a large header. > # This is line 1215 of a file with a large header. > # This is line 1216 of a file with a large header. > # This is line 1217 of a file with a large header. > # This is line 1218 of a file with a large header. > # This is line 1219 of a file with a large header. > # This is line 1220 of a file with a large header. > # This is line 1221 of a file with a large header. > # This is line 1222 of a file with a large header. > # This is line 1223 of a file with a large header. > # This is line 1224 of a file with a large header. > # This is line 1225 of a file with a large header. > # This is line 1226 of a file with a large header. > # This is line 1227 of a file with a large header. > # This is line 1228 of a file with a large header. > # This is line 1229 of a file with a large header. > # This is line 1230 of a file with a large header. > # This is line 1231 of a file with a large header. > # This is line 1232 of a file with a large header. > # This is line 1233 of a file with a large header. > # This is line 1234 of a file with a large header. > # This is line 1235 of a file with a large header. > # This is line 1236 of a file with a large header. > # This is line 1237 of a file with a large header. > # This is line 1238 of a file with a large header. > # This is line 1239 of a file with a large header. > # This is line 1240 of a file with a large header. > # This is line 1241 of a file with a large header. > # This is line 1242 of a file with a large header. > # This is line 1243 of a file with a large header. > # This is line 1244 of a file with a large header. > # This is line 1245 of a file with a large header. > # This is line 1246 of a file with a large header. > # This is line 1247 of a file with a large header. > # This is line 1248 of a file with a large header. > # This is line 1249 of a file with a large header. > # This is line 1250 of a file with a large header. > # This is line 1251 of a file with a large header. > # This is line 1252 of a file with a large header. > # This is line 1253 of a file with a large header. > # This is line 1254 of a file with a large header. > # This is line 1255 of a file with a large header. > # This is line 1256 of a file with a large header. > # This is line 1257 of a file with a large header. > # This is line 1258 of a file with a large header. > # This is line 1259 of a file with a large header. > # This is line 1260 of a file with a large header. > # This is line 1261 of a file with a large header. > # This is line 1262 of a file with a large header. > # This is line 1263 of a file with a large header. > # This is line 1264 of a file with a large header. > # This is line 1265 of a file with a large header. > # This is line 1266 of a file with a large header. > # This is line 1267 of a file with a large header. > # This is line 1268 of a file with a large header. > # This is line 1269 of a file with a large header. > # This is line 1270 of a file with a large header. > # This is line 1271 of a file with a large header. > # This is line 1272 of a file with a large header. > # This is line 1273 of a file with a large header. > # This is line 1274 of a file with a large header. > # This is line 1275 of a file with a large header. > # This is line 1276 of a file with a large header. > # This is line 1277 of a file with a large header. > # This is line 1278 of a file with a large header. > # This is line 1279 of a file with a large header. > # This is line 1280 of a file with a large header. > # This is line 1281 of a file with a large header. > # This is line 1282 of a file with a large header. > # This is line 1283 of a file with a large header. > # This is line 1284 of a file with a large header. > # This is line 1285 of a file with a large header. > # This is line 1286 of a file with a large header. > # This is line 1287 of a file with a large header. > # This is line 1288 of a file with a large header. > # This is line 1289 of a file with a large header. > # This is line 1290 of a file with a large header. > # This is line 1291 of a file with a large header. > # This is line 1292 of a file with a large header. > # This is line 1293 of a file with a large header. > # This is line 1294 of a file with a large header. > # This is line 1295 of a file with a large header. > # This is line 1296 of a file with a large header. > # This is line 1297 of a file with a large header. > # This is line 1298 of a file with a large header. > # This is line 1299 of a file with a large header. > # This is line 1300 of a file with a large header. > # This is line 1301 of a file with a large header. > # This is line 1302 of a file with a large header. > # This is line 1303 of a file with a large header. > # This is line 1304 of a file with a large header. > # This is line 1305 of a file with a large header. > # This is line 1306 of a file with a large header. > # This is line 1307 of a file with a large header. > # This is line 1308 of a file with a large header. > # This is line 1309 of a file with a large header. > # This is line 1310 of a file with a large header. > # This is line 1311 of a file with a large header. > # This is line 1312 of a file with a large header. > # This is line 1313 of a file with a large header. > # This is line 1314 of a file with a large header. > # This is line 1315 of a file with a large header. > # This is line 1316 of a file with a large header. > # This is line 1317 of a file with a large header. > # This is line 1318 of a file with a large header. > # This is line 1319 of a file with a large header. > # This is line 1320 of a file with a large header. > # This is line 1321 of a file with a large header. > # This is line 1322 of a file with a large header. > # This is line 1323 of a file with a large header. > # This is line 1324 of a file with a large header. > # This is line 1325 of a file with a large header. > # This is line 1326 of a file with a large header. > # This is line 1327 of a file with a large header. > # This is line 1328 of a file with a large header. > # This is line 1329 of a file with a large header. > # This is line 1330 of a file with a large header. > # This is line 1331 of a file with a large header. > # This is line 1332 of a file with a large header. > # This is line 1333 of a file with a large header. > # This is line 1334 of a file with a large header. > # This is line 1335 of a file with a large header. > # This is line 1336 of a file with a large header. > # This is line 1337 of a file with a large header. > # This is line 1338 of a file with a large header. > # This is line 1339 of a file with a large header. > # This is line 1340 of a file with a large header. > # This is line 1341 of a file with a large header. > # This is line 1342 of a file with a large header. > # This is line 1343 of a file with a large header. > # This is line 1344 of a file with a large header. > # This is line 1345 of a file with a large header. > # This is line 1346 of a file with a large header. > # This is line 1347 of a file with a large header. > # This is line 1348 of a file with a large header. > # This is line 1349 of a file with a large header. > # This is line 1350 of a file with a large header. > # This is line 1351 of a file with a large header. > # This is line 1352 of a file with a large header. > # This is line 1353 of a file with a large header. > # This is line 1354 of a file with a large header. > # This is line 1355 of a file with a large header. > # This is line 1356 of a file with a large header. > # This is line 1357 of a file with a large header. > # This is line 1358 of a file with a large header. > # This is line 1359 of a file with a large header. > # This is line 1360 of a file with a large header. > # This is line 1361 of a file with a large header. > # This is line 1362 of a file with a large header. > # This is line 1363 of a file with a large header. > # This is line 1364 of a file with a large header. > # This is line 1365 of a file with a large header. > # This is line 1366 of a file with a large header. > # This is line 1367 of a file with a large header. > # This is line 1368 of a file with a large header. > # This is line 1369 of a file with a large header. > # This is line 1370 of a file with a large header. > # This is line 1371 of a file with a large header. > # This is line 1372 of a file with a large header. > # This is line 1373 of a file with a large header. > # This is line 1374 of a file with a large header. > # This is line 1375 of a file with a large header. > # This is line 1376 of a file with a large header. > # This is line 1377 of a file with a large header. > # This is line 1378 of a file with a large header. > # This is line 1379 of a file with a large header. > # This is line 1380 of a file with a large header. > # This is line 1381 of a file with a large header. > # This is line 1382 of a file with a large header. > # This is line 1383 of a file with a large header. > # This is line 1384 of a file with a large header. > # This is line 1385 of a file with a large header. > # This is line 1386 of a file with a large header. > # This is line 1387 of a file with a large header. > # This is line 1388 of a file with a large header. > # This is line 1389 of a file with a large header. > # This is line 1390 of a file with a large header. > # This is line 1391 of a file with a large header. > # This is line 1392 of a file with a large header. > # This is line 1393 of a file with a large header. > # This is line 1394 of a file with a large header. > # This is line 1395 of a file with a large header. > # This is line 1396 of a file with a large header. > # This is line 1397 of a file with a large header. > # This is line 1398 of a file with a large header. > # This is line 1399 of a file with a large header. > # This is line 1400 of a file with a large header. > # This is line 1401 of a file with a large header. > # This is line 1402 of a file with a large header. > # This is line 1403 of a file with a large header. > # This is line 1404 of a file with a large header. > # This is line 1405 of a file with a large header. > # This is line 1406 of a file with a large header. > # This is line 1407 of a file with a large header. > # This is line 1408 of a file with a large header. > # This is line 1409 of a file with a large header. > # This is line 1410 of a file with a large header. > # This is line 1411 of a file with a large header. > # This is line 1412 of a file with a large header. > # This is line 1413 of a file with a large header. > # This is line 1414 of a file with a large header. > # This is line 1415 of a file with a large header. > # This is line 1416 of a file with a large header. > # This is line 1417 of a file with a large header. > # This is line 1418 of a file with a large header. > # This is line 1419 of a file with a large header. > # This is line 1420 of a file with a large header. > # This is line 1421 of a file with a large header. > # This is line 1422 of a file with a large header. > # This is line 1423 of a file with a large header. > # This is line 1424 of a file with a large header. > # This is line 1425 of a file with a large header. > # This is line 1426 of a file with a large header. > # This is line 1427 of a file with a large header. > # This is line 1428 of a file with a large header. > # This is line 1429 of a file with a large header. > # This is line 1430 of a file with a large header. > # This is line 1431 of a file with a large header. > # This is line 1432 of a file with a large header. > # This is line 1433 of a file with a large header. > # This is line 1434 of a file with a large header. > # This is line 1435 of a file with a large header. > # This is line 1436 of a file with a large header. > # This is line 1437 of a file with a large header. > # This is line 1438 of a file with a large header. > # This is line 1439 of a file with a large header. > # This is line 1440 of a file with a large header. > # This is line 1441 of a file with a large header. > # This is line 1442 of a file with a large header. > # This is line 1443 of a file with a large header. > # This is line 1444 of a file with a large header. > # This is line 1445 of a file with a large header. > # This is line 1446 of a file with a large header. > # This is line 1447 of a file with a large header. > # This is line 1448 of a file with a large header. > # This is line 1449 of a file with a large header. > # This is line 1450 of a file with a large header. > # This is line 1451 of a file with a large header. > # This is line 1452 of a file with a large header. > # This is line 1453 of a file with a large header. > # This is line 1454 of a file with a large header. > # This is line 1455 of a file with a large header. > # This is line 1456 of a file with a large header. > # This is line 1457 of a file with a large header. > # This is line 1458 of a file with a large header. > # This is line 1459 of a file with a large header. > # This is line 1460 of a file with a large header. > # This is line 1461 of a file with a large header. > # This is line 1462 of a file with a large header. > # This is line 1463 of a file with a large header. > # This is line 1464 of a file with a large header. > # This is line 1465 of a file with a large header. > # This is line 1466 of a file with a large header. > # This is line 1467 of a file with a large header. > # This is line 1468 of a file with a large header. > # This is line 1469 of a file with a large header. > # This is line 1470 of a file with a large header. > # This is line 1471 of a file with a large header. > # This is line 1472 of a file with a large header. > # This is line 1473 of a file with a large header. > # This is line 1474 of a file with a large header. > # This is line 1475 of a file with a large header. > # This is line 1476 of a file with a large header. > # This is line 1477 of a file with a large header. > # This is line 1478 of a file with a large header. > # This is line 1479 of a file with a large header. > # This is line 1480 of a file with a large header. > # This is line 1481 of a file with a large header. > # This is line 1482 of a file with a large header. > # This is line 1483 of a file with a large header. > # This is line 1484 of a file with a large header. > # This is line 1485 of a file with a large header. > # This is line 1486 of a file with a large header. > # This is line 1487 of a file with a large header. > # This is line 1488 of a file with a large header. > # This is line 1489 of a file with a large header. > # This is line 1490 of a file with a large header. > # This is line 1491 of a file with a large header. > # This is line 1492 of a file with a large header. > # This is line 1493 of a file with a large header. > # This is line 1494 of a file with a large header. > # This is line 1495 of a file with a large header. > # This is line 1496 of a file with a large header. > # This is line 1497 of a file with a large header. > # This is line 1498 of a file with a large header. > # This is line 1499 of a file with a large header. > # This is line 1500 of a file with a large header. > # This is line 1501 of a file with a large header. > # This is line 1502 of a file with a large header. > # This is line 1503 of a file with a large header. > # This is line 1504 of a file with a large header. > # This is line 1505 of a file with a large header. > # This is line 1506 of a file with a large header. > # This is line 1507 of a file with a large header. > # This is line 1508 of a file with a large header. > # This is line 1509 of a file with a large header. > # This is line 1510 of a file with a large header. > # This is line 1511 of a file with a large header. > # This is line 1512 of a file with a large header. > # This is line 1513 of a file with a large header. > # This is line 1514 of a file with a large header. > # This is line 1515 of a file with a large header. > # This is line 1516 of a file with a large header. > # This is line 1517 of a file with a large header. > # This is line 1518 of a file with a large header. > # This is line 1519 of a file with a large header. > # This is line 1520 of a file with a large header. > # This is line 1521 of a file with a large header. > # This is line 1522 of a file with a large header. > # This is line 1523 of a file with a large header. > # This is line 1524 of a file with a large header. > # This is line 1525 of a file with a large header. > # This is line 1526 of a file with a large header. > # This is line 1527 of a file with a large header. > # This is line 1528 of a file with a large header. > # This is line 1529 of a file with a large header. > # This is line 1530 of a file with a large header. > # This is line 1531 of a file with a large header. > # This is line 1532 of a file with a large header. > # This is line 1533 of a file with a large header. > # This is line 1534 of a file with a large header. > # This is line 1535 of a file with a large header. > # This is line 1536 of a file with a large header. > # This is line 1537 of a file with a large header. > # This is line 1538 of a file with a large header. > # This is line 1539 of a file with a large header. > # This is line 1540 of a file with a large header. > # This is line 1541 of a file with a large header. > # This is line 1542 of a file with a large header. > # This is line 1543 of a file with a large header. > # This is line 1544 of a file with a large header. > # This is line 1545 of a file with a large header. > # This is line 1546 of a file with a large header. > # This is line 1547 of a file with a large header. > # This is line 1548 of a file with a large header. > # This is line 1549 of a file with a large header. > # This is line 1550 of a file with a large header. > # This is line 1551 of a file with a large header. > # This is line 1552 of a file with a large header. > # This is line 1553 of a file with a large header. > # This is line 1554 of a file with a large header. > # This is line 1555 of a file with a large header. > # This is line 1556 of a file with a large header. > # This is line 1557 of a file with a large header. > # This is line 1558 of a file with a large header. > # This is line 1559 of a file with a large header. > # This is line 1560 of a file with a large header. > # This is line 1561 of a file with a large header. > # This is line 1562 of a file with a large header. > # This is line 1563 of a file with a large header. > # This is line 1564 of a file with a large header. > # This is line 1565 of a file with a large header. > # This is line 1566 of a file with a large header. > # This is line 1567 of a file with a large header. > # This is line 1568 of a file with a large header. > # This is line 1569 of a file with a large header. > # This is line 1570 of a file with a large header. > # This is line 1571 of a file with a large header. > # This is line 1572 of a file with a large header. > # This is line 1573 of a file with a large header. > # This is line 1574 of a file with a large header. > # This is line 1575 of a file with a large header. > # This is line 1576 of a file with a large header. > # This is line 1577 of a file with a large header. > # This is line 1578 of a file with a large header. > # This is line 1579 of a file with a large header. > # This is line 1580 of a file with a large header. > # This is line 1581 of a file with a large header. > # This is line 1582 of a file with a large header. > # This is line 1583 of a file with a large header. > # This is line 1584 of a file with a large header. > # This is line 1585 of a file with a large header. > # This is line 1586 of a file with a large header. > # This is line 1587 of a file with a large header. > # This is line 1588 of a file with a large header. > # This is line 1589 of a file with a large header. > # This is line 1590 of a file with a large header. > # This is line 1591 of a file with a large header. > # This is line 1592 of a file with a large header. > # This is line 1593 of a file with a large header. > # This is line 1594 of a file with a large header. > # This is line 1595 of a file with a large header. > # This is line 1596 of a file with a large header. > # This is line 1597 of a file with a large header. > # This is line 1598 of a file with a large header. > # This is line 1599 of a file with a large header. > # This is line 1600 of a file with a large header. > # This is line 1601 of a file with a large header. > # This is line 1602 of a file with a large header. > # This is line 1603 of a file with a large header. > # This is line 1604 of a file with a large header. > # This is line 1605 of a file with a large header. > # This is line 1606 of a file with a large header. > # This is line 1607 of a file with a large header. > # This is line 1608 of a file with a large header. > # This is line 1609 of a file with a large header. > # This is line 1610 of a file with a large header. > # This is line 1611 of a file with a large header. > # This is line 1612 of a file with a large header. > # This is line 1613 of a file with a large header. > # This is line 1614 of a file with a large header. > # This is line 1615 of a file with a large header. > # This is line 1616 of a file with a large header. > # This is line 1617 of a file with a large header. > # This is line 1618 of a file with a large header. > # This is line 1619 of a file with a large header. > # This is line 1620 of a file with a large header. > # This is line 1621 of a file with a large header. > # This is line 1622 of a file with a large header. > # This is line 1623 of a file with a large header. > # This is line 1624 of a file with a large header. > # This is line 1625 of a file with a large header. > # This is line 1626 of a file with a large header. > # This is line 1627 of a file with a large header. > # This is line 1628 of a file with a large header. > # This is line 1629 of a file with a large header. > # This is line 1630 of a file with a large header. > # This is line 1631 of a file with a large header. > # This is line 1632 of a file with a large header. > # This is line 1633 of a file with a large header. > # This is line 1634 of a file with a large header. > # This is line 1635 of a file with a large header. > # This is line 1636 of a file with a large header. > # This is line 1637 of a file with a large header. > # This is line 1638 of a file with a large header. > # This is line 1639 of a file with a large header. > # This is line 1640 of a file with a large header. > # This is line 1641 of a file with a large header. > # This is line 1642 of a file with a large header. > # This is line 1643 of a file with a large header. > # This is line 1644 of a file with a large header. > # This is line 1645 of a file with a large header. > # This is line 1646 of a file with a large header. > # This is line 1647 of a file with a large header. > # This is line 1648 of a file with a large header. > # This is line 1649 of a file with a large header. > # This is line 1650 of a file with a large header. > # This is line 1651 of a file with a large header. > # This is line 1652 of a file with a large header. > # This is line 1653 of a file with a large header. > # This is line 1654 of a file with a large header. > # This is line 1655 of a file with a large header. > # This is line 1656 of a file with a large header. > # This is line 1657 of a file with a large header. > # This is line 1658 of a file with a large header. > # This is line 1659 of a file with a large header. > # This is line 1660 of a file with a large header. > # This is line 1661 of a file with a large header. > # This is line 1662 of a file with a large header. > # This is line 1663 of a file with a large header. > # This is line 1664 of a file with a large header. > # This is line 1665 of a file with a large header. > # This is line 1666 of a file with a large header. > # This is line 1667 of a file with a large header. > # This is line 1668 of a file with a large header. > # This is line 1669 of a file with a large header. > # This is line 1670 of a file with a large header. > # This is line 1671 of a file with a large header. > # This is line 1672 of a file with a large header. > # This is line 1673 of a file with a large header. > # This is line 1674 of a file with a large header. > # This is line 1675 of a file with a large header. > # This is line 1676 of a file with a large header. > # This is line 1677 of a file with a large header. > # This is line 1678 of a file with a large header. > # This is line 1679 of a file with a large header. > # This is line 1680 of a file with a large header. > # This is line 1681 of a file with a large header. > # This is line 1682 of a file with a large header. > # This is line 1683 of a file with a large header. > # This is line 1684 of a file with a large header. > # This is line 1685 of a file with a large header. > # This is line 1686 of a file with a large header. > # This is line 1687 of a file with a large header. > # This is line 1688 of a file with a large header. > # This is line 1689 of a file with a large header. > # This is line 1690 of a file with a large header. > # This is line 1691 of a file with a large header. > # This is line 1692 of a file with a large header. > # This is line 1693 of a file with a large header. > # This is line 1694 of a file with a large header. > # This is line 1695 of a file with a large header. > # This is line 1696 of a file with a large header. > # This is line 1697 of a file with a large header. > # This is line 1698 of a file with a large header. > # This is line 1699 of a file with a large header. > # This is line 1700 of a file with a large header. > # This is line 1701 of a file with a large header. > # This is line 1702 of a file with a large header. > # This is line 1703 of a file with a large header. > # This is line 1704 of a file with a large header. > # This is line 1705 of a file with a large header. > # This is line 1706 of a file with a large header. > # This is line 1707 of a file with a large header. > # This is line 1708 of a file with a large header. > # This is line 1709 of a file with a large header. > # This is line 1710 of a file with a large header. > # This is line 1711 of a file with a large header. > # This is line 1712 of a file with a large header. > # This is line 1713 of a file with a large header. > # This is line 1714 of a file with a large header. > # This is line 1715 of a file with a large header. > # This is line 1716 of a file with a large header. > # This is line 1717 of a file with a large header. > # This is line 1718 of a file with a large header. > # This is line 1719 of a file with a large header. > # This is line 1720 of a file with a large header. > # This is line 1721 of a file with a large header. > # This is line 1722 of a file with a large header. > # This is line 1723 of a file with a large header. > # This is line 1724 of a file with a large header. > # This is line 1725 of a file with a large header. > # This is line 1726 of a file with a large header. > # This is line 1727 of a file with a large header. > # This is line 1728 of a file with a large header. > # This is line 1729 of a file with a large header. > # This is line 1730 of a file with a large header. > # This is line 1731 of a file with a large header. > # This is line 1732 of a file with a large header. > # This is line 1733 of a file with a large header. > # This is line 1734 of a file with a large header. > # This is line 1735 of a file with a large header. > # This is line 1736 of a file with a large header. > # This is line 1737 of a file with a large header. > # This is line 1738 of a file with a large header. > # This is line 1739 of a file with a large header. > # This is line 1740 of a file with a large header. > # This is line 1741 of a file with a large header. > # This is line 1742 of a file with a large header. > # This is line 1743 of a file with a large header. > # This is line 1744 of a file with a large header. > # This is line 1745 of a file with a large header. > # This is line 1746 of a file with a large header. > # This is line 1747 of a file with a large header. > # This is line 1748 of a file with a large header. > # This is line 1749 of a file with a large header. > # This is line 1750 of a file with a large header. > # This is line 1751 of a file with a large header. > # This is line 1752 of a file with a large header. > # This is line 1753 of a file with a large header. > # This is line 1754 of a file with a large header. > # This is line 1755 of a file with a large header. > # This is line 1756 of a file with a large header. > # This is line 1757 of a file with a large header. > # This is line 1758 of a file with a large header. > # This is line 1759 of a file with a large header. > # This is line 1760 of a file with a large header. > # This is line 1761 of a file with a large header. > # This is line 1762 of a file with a large header. > # This is line 1763 of a file with a large header. > # This is line 1764 of a file with a large header. > # This is line 1765 of a file with a large header. > # This is line 1766 of a file with a large header. > # This is line 1767 of a file with a large header. > # This is line 1768 of a file with a large header. > # This is line 1769 of a file with a large header. > # This is line 1770 of a file with a large header. > # This is line 1771 of a file with a large header. > # This is line 1772 of a file with a large header. > # This is line 1773 of a file with a large header. > # This is line 1774 of a file with a large header. > # This is line 1775 of a file with a large header. > # This is line 1776 of a file with a large header. > # This is line 1777 of a file with a large header. > # This is line 1778 of a file with a large header. > # This is line 1779 of a file with a large header. > # This is line 1780 of a file with a large header. > # This is line 1781 of a file with a large header. > # This is line 1782 of a file with a large header. > # This is line 1783 of a file with a large header. > # This is line 1784 of a file with a large header. > # This is line 1785 of a file with a large header. > # This is line 1786 of a file with a large header. > # This is line 1787 of a file with a large header. > # This is line 1788 of a file with a large header. > # This is line 1789 of a file with a large header. > # This is line 1790 of a file with a large header. > # This is line 1791 of a file with a large header. > # This is line 1792 of a file with a large header. > # This is line 1793 of a file with a large header. > # This is line 1794 of a file with a large header. > # This is line 1795 of a file with a large header. > # This is line 1796 of a file with a large header. > # This is line 1797 of a file with a large header. > # This is line 1798 of a file with a large header. > # This is line 1799 of a file with a large header. > # This is line 1800 of a file with a large header. > # This is line 1801 of a file with a large header. > # This is line 1802 of a file with a large header. > # This is line 1803 of a file with a large header. > # This is line 1804 of a file with a large header. > # This is line 1805 of a file with a large header. > # This is line 1806 of a file with a large header. > # This is line 1807 of a file with a large header. > # This is line 1808 of a file with a large header. > # This is line 1809 of a file with a large header. > # This is line 1810 of a file with a large header. > # This is line 1811 of a file with a large header. > # This is line 1812 of a file with a large header. > # This is line 1813 of a file with a large header. > # This is line 1814 of a file with a large header. > # This is line 1815 of a file with a large header. > # This is line 1816 of a file with a large header. > # This is line 1817 of a file with a large header. > # This is line 1818 of a file with a large header. > # This is line 1819 of a file with a large header. > # This is line 1820 of a file with a large header. > # This is line 1821 of a file with a large header. > # This is line 1822 of a file with a large header. > # This is line 1823 of a file with a large header. > # This is line 1824 of a file with a large header. > # This is line 1825 of a file with a large header. > # This is line 1826 of a file with a large header. > # This is line 1827 of a file with a large header. > # This is line 1828 of a file with a large header. > # This is line 1829 of a file with a large header. > # This is line 1830 of a file with a large header. > # This is line 1831 of a file with a large header. > # This is line 1832 of a file with a large header. > # This is line 1833 of a file with a large header. > # This is line 1834 of a file with a large header. > # This is line 1835 of a file with a large header. > # This is line 1836 of a file with a large header. > # This is line 1837 of a file with a large header. > # This is line 1838 of a file with a large header. > # This is line 1839 of a file with a large header. > # This is line 1840 of a file with a large header. > # This is line 1841 of a file with a large header. > # This is line 1842 of a file with a large header. > # This is line 1843 of a file with a large header. > # This is line 1844 of a file with a large header. > # This is line 1845 of a file with a large header. > # This is line 1846 of a file with a large header. > # This is line 1847 of a file with a large header. > # This is line 1848 of a file with a large header. > # This is line 1849 of a file with a large header. > # This is line 1850 of a file with a large header. > # This is line 1851 of a file with a large header. > # This is line 1852 of a file with a large header. > # This is line 1853 of a file with a large header. > # This is line 1854 of a file with a large header. > # This is line 1855 of a file with a large header. > # This is line 1856 of a file with a large header. > # This is line 1857 of a file with a large header. > # This is line 1858 of a file with a large header. > # This is line 1859 of a file with a large header. > # This is line 1860 of a file with a large header. > # This is line 1861 of a file with a large header. > # This is line 1862 of a file with a large header. > # This is line 1863 of a file with a large header. > # This is line 1864 of a file with a large header. > # This is line 1865 of a file with a large header. > # This is line 1866 of a file with a large header. > # This is line 1867 of a file with a large header. > # This is line 1868 of a file with a large header. > # This is line 1869 of a file with a large header. > # This is line 1870 of a file with a large header. > # This is line 1871 of a file with a large header. > # This is line 1872 of a file with a large header. > # This is line 1873 of a file with a large header. > # This is line 1874 of a file with a large header. > # This is line 1875 of a file with a large header. > # This is line 1876 of a file with a large header. > # This is line 1877 of a file with a large header. > # This is line 1878 of a file with a large header. > # This is line 1879 of a file with a large header. > # This is line 1880 of a file with a large header. > # This is line 1881 of a file with a large header. > # This is line 1882 of a file with a large header. > # This is line 1883 of a file with a large header. > # This is line 1884 of a file with a large header. > # This is line 1885 of a file with a large header. > # This is line 1886 of a file with a large header. > # This is line 1887 of a file with a large header. > # This is line 1888 of a file with a large header. > # This is line 1889 of a file with a large header. > # This is line 1890 of a file with a large header. > # This is line 1891 of a file with a large header. > # This is line 1892 of a file with a large header. > # This is line 1893 of a file with a large header. > # This is line 1894 of a file with a large header. > # This is line 1895 of a file with a large header. > # This is line 1896 of a file with a large header. > # This is line 1897 of a file with a large header. > # This is line 1898 of a file with a large header. > # This is line 1899 of a file with a large header. > # This is line 1900 of a file with a large header. > # This is line 1901 of a file with a large header. > # This is line 1902 of a file with a large header. > # This is line 1903 of a file with a large header. > # This is line 1904 of a file with a large header. > # This is line 1905 of a file with a large header. > # This is line 1906 of a file with a large header. > # This is line 1907 of a file with a large header. > # This is line 1908 of a file with a large header. > # This is line 1909 of a file with a large header. > # This is line 1910 of a file with a large header. > # This is line 1911 of a file with a large header. > # This is line 1912 of a file with a large header. > # This is line 1913 of a file with a large header. > # This is line 1914 of a file with a large header. > # This is line 1915 of a file with a large header. > # This is line 1916 of a file with a large header. > # This is line 1917 of a file with a large header. > # This is line 1918 of a file with a large header. > # This is line 1919 of a file with a large header. > # This is line 1920 of a file with a large header. > # This is line 1921 of a file with a large header. > # This is line 1922 of a file with a large header. > # This is line 1923 of a file with a large header. > # This is line 1924 of a file with a large header. > # This is line 1925 of a file with a large header. > # This is line 1926 of a file with a large header. > # This is line 1927 of a file with a large header. > # This is line 1928 of a file with a large header. > # This is line 1929 of a file with a large header. > # This is line 1930 of a file with a large header. > # This is line 1931 of a file with a large header. > # This is line 1932 of a file with a large header. > # This is line 1933 of a file with a large header. > # This is line 1934 of a file with a large header. > # This is line 1935 of a file with a large header. > # This is line 1936 of a file with a large header. > # This is line 1937 of a file with a large header. > # This is line 1938 of a file with a large header. > # This is line 1939 of a file with a large header. > # This is line 1940 of a file with a large header. > # This is line 1941 of a file with a large header. > # This is line 1942 of a file with a large header. > # This is line 1943 of a file with a large header. > # This is line 1944 of a file with a large header. > # This is line 1945 of a file with a large header. > # This is line 1946 of a file with a large header. > # This is line 1947 of a file with a large header. > # This is line 1948 of a file with a large header. > # This is line 1949 of a file with a large header. > # This is line 1950 of a file with a large header. > # This is line 1951 of a file with a large header. > # This is line 1952 of a file with a large header. > # This is line 1953 of a file with a large header. > # This is line 1954 of a file with a large header. > # This is line 1955 of a file with a large header. > # This is line 1956 of a file with a large header. > # This is line 1957 of a file with a large header. > # This is line 1958 of a file with a large header. > # This is line 1959 of a file with a large header. > # This is line 1960 of a file with a large header. > # This is line 1961 of a file with a large header. > # This is line 1962 of a file with a large header. > # This is line 1963 of a file with a large header. > # This is line 1964 of a file with a large header. > # This is line 1965 of a file with a large header. > # This is line 1966 of a file with a large header. > # This is line 1967 of a file with a large header. > # This is line 1968 of a file with a large header. > # This is line 1969 of a file with a large header. > # This is line 1970 of a file with a large header. > # This is line 1971 of a file with a large header. > # This is line 1972 of a file with a large header. > # This is line 1973 of a file with a large header. > # This is line 1974 of a file with a large header. > # This is line 1975 of a file with a large header. > # This is line 1976 of a file with a large header. > # This is line 1977 of a file with a large header. > # This is line 1978 of a file with a large header. > # This is line 1979 of a file with a large header. > # This is line 1980 of a file with a large header. > # This is line 1981 of a file with a large header. > # This is line 1982 of a file with a large header. > # This is line 1983 of a file with a large header. > # This is line 1984 of a file with a large header. > # This is line 1985 of a file with a large header. > # This is line 1986 of a file with a large header. > # This is line 1987 of a file with a large header. > # This is line 1988 of a file with a large header. > # This is line 1989 of a file with a large header. > # This is line 1990 of a file with a large header. > # This is line 1991 of a file with a large header. > # This is line 1992 of a file with a large header. > # This is line 1993 of a file with a large header. > # This is line 1994 of a file with a large header. > # This is line 1995 of a file with a large header. > # This is line 1996 of a file with a large header. > # This is line 1997 of a file with a large header. > # This is line 1998 of a file with a large header. > # This is line 1999 of a file with a large header. > # This is line 2000 of a file with a large header. > # This is line 2001 of a file with a large header. > # This is line 2002 of a file with a large header. > # This is line 2003 of a file with a large header. > # This is line 2004 of a file with a large header. > # This is line 2005 of a file with a large header. > # This is line 2006 of a file with a large header. > # This is line 2007 of a file with a large header. > # This is line 2008 of a file with a large header. > # This is line 2009 of a file with a large header. > # This is line 2010 of a file with a large header. > # This is line 2011 of a file with a large header. > # This is line 2012 of a file with a large header. > # This is line 2013 of a file with a large header. > # This is line 2014 of a file with a large header. > # This is line 2015 of a file with a large header. > # This is line 2016 of a file with a large header. > # This is line 2017 of a file with a large header. > # This is line 2018 of a file with a large header. > # This is line 2019 of a file with a large header. > # This is line 2020 of a file with a large header. > # This is line 2021 of a file with a large header. > # This is line 2022 of a file with a large header. > # This is line 2023 of a file with a large header. > # This is line 2024 of a file with a large header. > # This is line 2025 of a file with a large header. > # This is line 2026 of a file with a large header. > # This is line 2027 of a file with a large header. > # This is line 2028 of a file with a large header. > # This is line 2029 of a file with a large header. > # This is line 2030 of a file with a large header. > # This is line 2031 of a file with a large header. > # This is line 2032 of a file with a large header. > # This is line 2033 of a file with a large header. > # This is line 2034 of a file with a large header. > # This is line 2035 of a file with a large header. > # This is line 2036 of a file with a large header. > # This is line 2037 of a file with a large header. > # This is line 2038 of a file with a large header. > # This is line 2039 of a file with a large header. > # This is line 2040 of a file with a large header. > # This is line 2041 of a file with a large header. > # This is line 2042 of a file with a large header. > # This is line 2043 of a file with a large header. > # This is line 2044 of a file with a large header. > # This is line 2045 of a file with a large header. > # This is line 2046 of a file with a large header. > # This is line 2047 of a file with a large header. > # This is line 2048 of a file with a large header. > # This is line 2049 of a file with a large header. > # This is line 2050 of a file with a large header. > # This is line 2051 of a file with a large header. > # This is line 2052 of a file with a large header. > # This is line 2053 of a file with a large header. > # This is line 2054 of a file with a large header. > # This is line 2055 of a file with a large header. > # This is line 2056 of a file with a large header. > # This is line 2057 of a file with a large header. > # This is line 2058 of a file with a large header. > # This is line 2059 of a file with a large header. > # This is line 2060 of a file with a large header. > # This is line 2061 of a file with a large header. > # This is line 2062 of a file with a large header. > # This is line 2063 of a file with a large header. > # This is line 2064 of a file with a large header. > # This is line 2065 of a file with a large header. > # This is line 2066 of a file with a large header. > # This is line 2067 of a file with a large header. > # This is line 2068 of a file with a large header. > # This is line 2069 of a file with a large header. > # This is line 2070 of a file with a large header. > # This is line 2071 of a file with a large header. > # This is line 2072 of a file with a large header. > # This is line 2073 of a file with a large header. > # This is line 2074 of a file with a large header. > # This is line 2075 of a file with a large header. > # This is line 2076 of a file with a large header. > # This is line 2077 of a file with a large header. > # This is line 2078 of a file with a large header. > # This is line 2079 of a file with a large header. > # This is line 2080 of a file with a large header. > # This is line 2081 of a file with a large header. > # This is line 2082 of a file with a large header. > # This is line 2083 of a file with a large header. > # This is line 2084 of a file with a large header. > # This is line 2085 of a file with a large header. > # This is line 2086 of a file with a large header. > # This is line 2087 of a file with a large header. > # This is line 2088 of a file with a large header. > # This is line 2089 of a file with a large header. > # This is line 2090 of a file with a large header. > # This is line 2091 of a file with a large header. > # This is line 2092 of a file with a large header. > # This is line 2093 of a file with a large header. > # This is line 2094 of a file with a large header. > # This is line 2095 of a file with a large header. > # This is line 2096 of a file with a large header. > # This is line 2097 of a file with a large header. > # This is line 2098 of a file with a large header. > # This is line 2099 of a file with a large header. > # This is line 2100 of a file with a large header. > # This is line 2101 of a file with a large header. > # This is line 2102 of a file with a large header. > # This is line 2103 of a file with a large header. > # This is line 2104 of a file with a large header. > # This is line 2105 of a file with a large header. > # This is line 2106 of a file with a large header. > # This is line 2107 of a file with a large header. > # This is line 2108 of a file with a large header. > # This is line 2109 of a file with a large header. > # This is line 2110 of a file with a large header. > # This is line 2111 of a file with a large header. > # This is line 2112 of a file with a large header. > # This is line 2113 of a file with a large header. > # This is line 2114 of a file with a large header. > # This is line 2115 of a file with a large header. > # This is line 2116 of a file with a large header. > # This is line 2117 of a file with a large header. > # This is line 2118 of a file with a large header. > # This is line 2119 of a file with a large header. > # This is line 2120 of a file with a large header. > # This is line 2121 of a file with a large header. > # This is line 2122 of a file with a large header. > # This is line 2123 of a file with a large header. > # This is line 2124 of a file with a large header. > # This is line 2125 of a file with a large header. > # This is line 2126 of a file with a large header. > # This is line 2127 of a file with a large header. > # This is line 2128 of a file with a large header. > # This is line 2129 of a file with a large header. > # This is line 2130 of a file with a large header. > # This is line 2131 of a file with a large header. > # This is line 2132 of a file with a large header. > # This is line 2133 of a file with a large header. > # This is line 2134 of a file with a large header. > # This is line 2135 of a file with a large header. > # This is line 2136 of a file with a large header. > # This is line 2137 of a file with a large header. > # This is line 2138 of a file with a large header. > # This is line 2139 of a file with a large header. > # This is line 2140 of a file with a large header. > # This is line 2141 of a file with a large header. > # This is line 2142 of a file with a large header. > # This is line 2143 of a file with a large header. > # This is line 2144 of a file with a large header. > # This is line 2145 of a file with a large header. > # This is line 2146 of a file with a large header. > # This is line 2147 of a file with a large header. > # This is line 2148 of a file with a large header. > # This is line 2149 of a file with a large header. > # This is line 2150 of a file with a large header. > # This is line 2151 of a file with a large header. > # This is line 2152 of a file with a large header. > # This is line 2153 of a file with a large header. > # This is line 2154 of a file with a large header. > # This is line 2155 of a file with a large header. > # This is line 2156 of a file with a large header. > # This is line 2157 of a file with a large header. > # This is line 2158 of a file with a large header. > # This is line 2159 of a file with a large header. > # This is line 2160 of a file with a large header. > # This is line 2161 of a file with a large header. > # This is line 2162 of a file with a large header. > # This is line 2163 of a file with a large header. > # This is line 2164 of a file with a large header. > # This is line 2165 of a file with a large header. > # This is line 2166 of a file with a large header. > # This is line 2167 of a file with a large header. > # This is line 2168 of a file with a large header. > # This is line 2169 of a file with a large header. > # This is line 2170 of a file with a large header. > # This is line 2171 of a file with a large header. > # This is line 2172 of a file with a large header. > # This is line 2173 of a file with a large header. > # This is line 2174 of a file with a large header. > # This is line 2175 of a file with a large header. > # This is line 2176 of a file with a large header. > # This is line 2177 of a file with a large header. > # This is line 2178 of a file with a large header. > # This is line 2179 of a file with a large header. > # This is line 2180 of a file with a large header. > # This is line 2181 of a file with a large header. > # This is line 2182 of a file with a large header. > # This is line 2183 of a file with a large header. > # This is line 2184 of a file with a large header. > # This is line 2185 of a file with a large header. > # This is line 2186 of a file with a large header. > # This is line 2187 of a file with a large header. > # This is line 2188 of a file with a large header. > # This is line 2189 of a file with a large header. > # This is line 2190 of a file with a large header. > # This is line 2191 of a file with a large header. > # This is line 2192 of a file with a large header. > # This is line 2193 of a file with a large header. > # This is line 2194 of a file with a large header. > # This is line 2195 of a file with a large header. > # This is line 2196 of a file with a large header. > # This is line 2197 of a file with a large header. > # This is line 2198 of a file with a large header. > # This is line 2199 of a file with a large header. > # This is line 2200 of a file with a large header. > # This is line 2201 of a file with a large header. > # This is line 2202 of a file with a large header. > # This is line 2203 of a file with a large header. > # This is line 2204 of a file with a large header. > # This is line 2205 of a file with a large header. > # This is line 2206 of a file with a large header. > # This is line 2207 of a file with a large header. > # This is line 2208 of a file with a large header. > # This is line 2209 of a file with a large header. > # This is line 2210 of a file with a large header. > # This is line 2211 of a file with a large header. > # This is line 2212 of a file with a large header. > # This is line 2213 of a file with a large header. > # This is line 2214 of a file with a large header. > # This is line 2215 of a file with a large header. > # This is line 2216 of a file with a large header. > # This is line 2217 of a file with a large header. > # This is line 2218 of a file with a large header. > # This is line 2219 of a file with a large header. > # This is line 2220 of a file with a large header. > # This is line 2221 of a file with a large header. > # This is line 2222 of a file with a large header. > # This is line 2223 of a file with a large header. > # This is line 2224 of a file with a large header. > # This is line 2225 of a file with a large header. > # This is line 2226 of a file with a large header. > # This is line 2227 of a file with a large header. > # This is line 2228 of a file with a large header. > # This is line 2229 of a file with a large header. > # This is line 2230 of a file with a large header. > # This is line 2231 of a file with a large header. > # This is line 2232 of a file with a large header. > # This is line 2233 of a file with a large header. > # This is line 2234 of a file with a large header. > # This is line 2235 of a file with a large header. > # This is line 2236 of a file with a large header. > # This is line 2237 of a file with a large header. > # This is line 2238 of a file with a large header. > # This is line 2239 of a file with a large header. > # This is line 2240 of a file with a large header. > # This is line 2241 of a file with a large header. > # This is line 2242 of a file with a large header. > # This is line 2243 of a file with a large header. > # This is line 2244 of a file with a large header. > # This is line 2245 of a file with a large header. > # This is line 2246 of a file with a large header. > # This is line 2247 of a file with a large header. > # This is line 2248 of a file with a large header. > # This is line 2249 of a file with a large header. > # This is line 2250 of a file with a large header. > # This is line 2251 of a file with a large header. > # This is line 2252 of a file with a large header. > # This is line 2253 of a file with a large header. > # This is line 2254 of a file with a large header. > # This is line 2255 of a file with a large header. > # This is line 2256 of a file with a large header. > # This is line 2257 of a file with a large header. > # This is line 2258 of a file with a large header. > # This is line 2259 of a file with a large header. > # This is line 2260 of a file with a large header. > # This is line 2261 of a file with a large header. > # This is line 2262 of a file with a large header. > # This is line 2263 of a file with a large header. > # This is line 2264 of a file with a large header. > # This is line 2265 of a file with a large header. > # This is line 2266 of a file with a large header. > # This is line 2267 of a file with a large header. > # This is line 2268 of a file with a large header. > # This is line 2269 of a file with a large header. > # This is line 2270 of a file with a large header. > # This is line 2271 of a file with a large header. > # This is line 2272 of a file with a large header. > # This is line 2273 of a file with a large header. > # This is line 2274 of a file with a large header. > # This is line 2275 of a file with a large header. > # This is line 2276 of a file with a large header. > # This is line 2277 of a file with a large header. > # This is line 2278 of a file with a large header. > # This is line 2279 of a file with a large header. > # This is line 2280 of a file with a large header. > # This is line 2281 of a file with a large header. > # This is line 2282 of a file with a large header. > # This is line 2283 of a file with a large header. > # This is line 2284 of a file with a large header. > # This is line 2285 of a file with a large header. > # This is line 2286 of a file with a large header. > # This is line 2287 of a file with a large header. > # This is line 2288 of a file with a large header. > # This is line 2289 of a file with a large header. > # This is line 2290 of a file with a large header. > # This is line 2291 of a file with a large header. > # This is line 2292 of a file with a large header. > # This is line 2293 of a file with a large header. > # This is line 2294 of a file with a large header. > # This is line 2295 of a file with a large header. > # This is line 2296 of a file with a large header. > # This is line 2297 of a file with a large header. > # This is line 2298 of a file with a large header. > # This is line 2299 of a file with a large header. > # This is line 2300 of a file with a large header. > # This is line 2301 of a file with a large header. > # This is line 2302 of a file with a large header. > # This is line 2303 of a file with a large header. > # This is line 2304 of a file with a large header. > # This is line 2305 of a file with a large header. > # This is line 2306 of a file with a large header. > # This is line 2307 of a file with a large header. > # This is line 2308 of a file with a large header. > # This is line 2309 of a file with a large header. > # This is line 2310 of a file with a large header. > # This is line 2311 of a file with a large header. > # This is line 2312 of a file with a large header. > # This is line 2313 of a file with a large header. > # This is line 2314 of a file with a large header. > # This is line 2315 of a file with a large header. > # This is line 2316 of a file with a large header. > # This is line 2317 of a file with a large header. > # This is line 2318 of a file with a large header. > # This is line 2319 of a file with a large header. > # This is line 2320 of a file with a large header. > # This is line 2321 of a file with a large header. > # This is line 2322 of a file with a large header. > # This is line 2323 of a file with a large header. > # This is line 2324 of a file with a large header. > # This is line 2325 of a file with a large header. > # This is line 2326 of a file with a large header. > # This is line 2327 of a file with a large header. > # This is line 2328 of a file with a large header. > # This is line 2329 of a file with a large header. > # This is line 2330 of a file with a large header. > # This is line 2331 of a file with a large header. > # This is line 2332 of a file with a large header. > # This is line 2333 of a file with a large header. > # This is line 2334 of a file with a large header. > # This is line 2335 of a file with a large header. > # This is line 2336 of a file with a large header. > # This is line 2337 of a file with a large header. > # This is line 2338 of a file with a large header. > # This is line 2339 of a file with a large header. > # This is line 2340 of a file with a large header. > # This is line 2341 of a file with a large header. > # This is line 2342 of a file with a large header. > # This is line 2343 of a file with a large header. > # This is line 2344 of a file with a large header. > # This is line 2345 of a file with a large header. > # This is line 2346 of a file with a large header. > # This is line 2347 of a file with a large header. > # This is line 2348 of a file with a large header. > # This is line 2349 of a file with a large header. > # This is line 2350 of a file with a large header. > # This is line 2351 of a file with a large header. > # This is line 2352 of a file with a large header. > # This is line 2353 of a file with a large header. > # This is line 2354 of a file with a large header. > # This is line 2355 of a file with a large header. > # This is line 2356 of a file with a large header. > # This is line 2357 of a file with a large header. > # This is line 2358 of a file with a large header. > # This is line 2359 of a file with a large header. > # This is line 2360 of a file with a large header. > # This is line 2361 of a file with a large header. > # This is line 2362 of a file with a large header. > # This is line 2363 of a file with a large header. > # This is line 2364 of a file with a large header. > # This is line 2365 of a file with a large header. > # This is line 2366 of a file with a large header. > # This is line 2367 of a file with a large header. > # This is line 2368 of a file with a large header. > # This is line 2369 of a file with a large header. > # This is line 2370 of a file with a large header. > # This is line 2371 of a file with a large header. > # This is line 2372 of a file with a large header. > # This is line 2373 of a file with a large header. > # This is line 2374 of a file with a large header. > # This is line 2375 of a file with a large header. > # This is line 2376 of a file with a large header. > # This is line 2377 of a file with a large header. > # This is line 2378 of a file with a large header. > # This is line 2379 of a file with a large header. > # This is line 2380 of a file with a large header. > # This is line 2381 of a file with a large header. > # This is line 2382 of a file with a large header. > # This is line 2383 of a file with a large header. > # This is line 2384 of a file with a large header. > # This is line 2385 of a file with a large header. > # This is line 2386 of a file with a large header. > # This is line 2387 of a file with a large header. > # This is line 2388 of a file with a large header. > # This is line 2389 of a file with a large header. > # This is line 2390 of a file with a large header. > # This is line 2391 of a file with a large header. > # This is line 2392 of a file with a large header. > # This is line 2393 of a file with a large header. > # This is line 2394 of a file with a large header. > # This is line 2395 of a file with a large header. > # This is line 2396 of a file with a large header. > # This is line 2397 of a file with a large header. > # This is line 2398 of a file with a large header. > # This is line 2399 of a file with a large header. > # This is line 2400 of a file with a large header. > # This is line 2401 of a file with a large header. > # This is line 2402 of a file with a large header. > # This is line 2403 of a file with a large header. > # This is line 2404 of a file with a large header. > # This is line 2405 of a file with a large header. > # This is line 2406 of a file with a large header. > # This is line 2407 of a file with a large header. > # This is line 2408 of a file with a large header. > # This is line 2409 of a file with a large header. > # This is line 2410 of a file with a large header. > # This is line 2411 of a file with a large header. > # This is line 2412 of a file with a large header. > # This is line 2413 of a file with a large header. > # This is line 2414 of a file with a large header. > # This is line 2415 of a file with a large header. > # This is line 2416 of a file with a large header. > # This is line 2417 of a file with a large header. > # This is line 2418 of a file with a large header. > # This is line 2419 of a file with a large header. > # This is line 2420 of a file with a large header. > # This is line 2421 of a file with a large header. > # This is line 2422 of a file with a large header. > # This is line 2423 of a file with a large header. > # This is line 2424 of a file with a large header. > # This is line 2425 of a file with a large header. > # This is line 2426 of a file with a large header. > # This is line 2427 of a file with a large header. > # This is line 2428 of a file with a large header. > # This is line 2429 of a file with a large header. > # This is line 2430 of a file with a large header. > # This is line 2431 of a file with a large header. > # This is line 2432 of a file with a large header. > # This is line 2433 of a file with a large header. > # This is line 2434 of a file with a large header. > # This is line 2435 of a file with a large header. > # This is line 2436 of a file with a large header. > # This is line 2437 of a file with a large header. > # This is line 2438 of a file with a large header. > # This is line 2439 of a file with a large header. > # This is line 2440 of a file with a large header. > # This is line 2441 of a file with a large header. > # This is line 2442 of a file with a large header. > # This is line 2443 of a file with a large header. > # This is line 2444 of a file with a large header. > # This is line 2445 of a file with a large header. > # This is line 2446 of a file with a large header. > # This is line 2447 of a file with a large header. > # This is line 2448 of a file with a large header. > # This is line 2449 of a file with a large header. > # This is line 2450 of a file with a large header. > # This is line 2451 of a file with a large header. > # This is line 2452 of a file with a large header. > # This is line 2453 of a file with a large header. > # This is line 2454 of a file with a large header. > # This is line 2455 of a file with a large header. > # This is line 2456 of a file with a large header. > # This is line 2457 of a file with a large header. > # This is line 2458 of a file with a large header. > # This is line 2459 of a file with a large header. > # This is line 2460 of a file with a large header. > # This is line 2461 of a file with a large header. > # This is line 2462 of a file with a large header. > # This is line 2463 of a file with a large header. > # This is line 2464 of a file with a large header. > # This is line 2465 of a file with a large header. > # This is line 2466 of a file with a large header. > # This is line 2467 of a file with a large header. > # This is line 2468 of a file with a large header. > # This is line 2469 of a file with a large header. > # This is line 2470 of a file with a large header. > # This is line 2471 of a file with a large header. > # This is line 2472 of a file with a large header. > # This is line 2473 of a file with a large header. > # This is line 2474 of a file with a large header. > # This is line 2475 of a file with a large header. > # This is line 2476 of a file with a large header. > # This is line 2477 of a file with a large header. > # This is line 2478 of a file with a large header. > # This is line 2479 of a file with a large header. > # This is line 2480 of a file with a large header. > # This is line 2481 of a file with a large header. > # This is line 2482 of a file with a large header. > # This is line 2483 of a file with a large header. > # This is line 2484 of a file with a large header. > # This is line 2485 of a file with a large header. > # This is line 2486 of a file with a large header. > # This is line 2487 of a file with a large header. > # This is line 2488 of a file with a large header. > # This is line 2489 of a file with a large header. > # This is line 2490 of a file with a large header. > # This is line 2491 of a file with a large header. > # This is line 2492 of a file with a large header. > # This is line 2493 of a file with a large header. > # This is line 2494 of a file with a large header. > # This is line 2495 of a file with a large header. > # This is line 2496 of a file with a large header. > # This is line 2497 of a file with a large header. > # This is line 2498 of a file with a large header. > # This is line 2499 of a file with a large header. > # This is line 2500 of a file with a large header. > # This is line 2501 of a file with a large header. > # This is line 2502 of a file with a large header. > # This is line 2503 of a file with a large header. > # This is line 2504 of a file with a large header. > # This is line 2505 of a file with a large header. > # This is line 2506 of a file with a large header. > # This is line 2507 of a file with a large header. > # This is line 2508 of a file with a large header. > # This is line 2509 of a file with a large header. > # This is line 2510 of a file with a large header. > # This is line 2511 of a file with a large header. > # This is line 2512 of a file with a large header. > # This is line 2513 of a file with a large header. > # This is line 2514 of a file with a large header. > # This is line 2515 of a file with a large header. > # This is line 2516 of a file with a large header. > # This is line 2517 of a file with a large header. > # This is line 2518 of a file with a large header. > # This is line 2519 of a file with a large header. > # This is line 2520 of a file with a large header. > # This is line 2521 of a file with a large header. > # This is line 2522 of a file with a large header. > # This is line 2523 of a file with a large header. > # This is line 2524 of a file with a large header. > # This is line 2525 of a file with a large header. > # This is line 2526 of a file with a large header. > # This is line 2527 of a file with a large header. > # This is line 2528 of a file with a large header. > # This is line 2529 of a file with a large header. > # This is line 2530 of a file with a large header. > # This is line 2531 of a file with a large header. > # This is line 2532 of a file with a large header. > # This is line 2533 of a file with a large header. > # This is line 2534 of a file with a large header. > # This is line 2535 of a file with a large header. > # This is line 2536 of a file with a large header. > # This is line 2537 of a file with a large header. > # This is line 2538 of a file with a large header. > # This is line 2539 of a file with a large header. > # This is line 2540 of a file with a large header. > # This is line 2541 of a file with a large header. > # This is line 2542 of a file with a large header. > # This is line 2543 of a file with a large header. > # This is line 2544 of a file with a large header. > # This is line 2545 of a file with a large header. > # This is line 2546 of a file with a large header. > # This is line 2547 of a file with a large header. > # This is line 2548 of a file with a large header. > # This is line 2549 of a file with a large header. > # This is line 2550 of a file with a large header. > # This is line 2551 of a file with a large header. > # This is line 2552 of a file with a large header. > # This is line 2553 of a file with a large header. > # This is line 2554 of a file with a large header. > # This is line 2555 of a file with a large header. > # This is line 2556 of a file with a large header. > # This is line 2557 of a file with a large header. > # This is line 2558 of a file with a large header. > # This is line 2559 of a file with a large header. > # This is line 2560 of a file with a large header. > # This is line 2561 of a file with a large header. > # This is line 2562 of a file with a large header. > # This is line 2563 of a file with a large header. > # This is line 2564 of a file with a large header. > # This is line 2565 of a file with a large header. > # This is line 2566 of a file with a large header. > # This is line 2567 of a file with a large header. > # This is line 2568 of a file with a large header. > # This is line 2569 of a file with a large header. > # This is line 2570 of a file with a large header. > # This is line 2571 of a file with a large header. > # This is line 2572 of a file with a large header. > # This is line 2573 of a file with a large header. > # This is line 2574 of a file with a large header. > # This is line 2575 of a file with a large header. > # This is line 2576 of a file with a large header. > # This is line 2577 of a file with a large header. > # This is line 2578 of a file with a large header. > # This is line 2579 of a file with a large header. > # This is line 2580 of a file with a large header. > # This is line 2581 of a file with a large header. > # This is line 2582 of a file with a large header. > # This is line 2583 of a file with a large header. > # This is line 2584 of a file with a large header. > # This is line 2585 of a file with a large header. > # This is line 2586 of a file with a large header. > # This is line 2587 of a file with a large header. > # This is line 2588 of a file with a large header. > # This is line 2589 of a file with a large header. > # This is line 2590 of a file with a large header. > # This is line 2591 of a file with a large header. > # This is line 2592 of a file with a large header. > # This is line 2593 of a file with a large header. > # This is line 2594 of a file with a large header. > # This is line 2595 of a file with a large header. > # This is line 2596 of a file with a large header. > # This is line 2597 of a file with a large header. > # This is line 2598 of a file with a large header. > # This is line 2599 of a file with a large header. > # This is line 2600 of a file with a large header. > # This is line 2601 of a file with a large header. > # This is line 2602 of a file with a large header. > # This is line 2603 of a file with a large header. > # This is line 2604 of a file with a large header. > # This is line 2605 of a file with a large header. > # This is line 2606 of a file with a large header. > # This is line 2607 of a file with a large header. > # This is line 2608 of a file with a large header. > # This is line 2609 of a file with a large header. > # This is line 2610 of a file with a large header. > # This is line 2611 of a file with a large header. > # This is line 2612 of a file with a large header. > # This is line 2613 of a file with a large header. > # This is line 2614 of a file with a large header. > # This is line 2615 of a file with a large header. > # This is line 2616 of a file with a large header. > # This is line 2617 of a file with a large header. > # This is line 2618 of a file with a large header. > # This is line 2619 of a file with a large header. > # This is line 2620 of a file with a large header. > # This is line 2621 of a file with a large header. > # This is line 2622 of a file with a large header. > # This is line 2623 of a file with a large header. > # This is line 2624 of a file with a large header. > # This is line 2625 of a file with a large header. > # This is line 2626 of a file with a large header. > # This is line 2627 of a file with a large header. > # This is line 2628 of a file with a large header. > # This is line 2629 of a file with a large header. > # This is line 2630 of a file with a large header. > # This is line 2631 of a file with a large header. > # This is line 2632 of a file with a large header. > # This is line 2633 of a file with a large header. > # This is line 2634 of a file with a large header. > # This is line 2635 of a file with a large header. > # This is line 2636 of a file with a large header. > # This is line 2637 of a file with a large header. > # This is line 2638 of a file with a large header. > # This is line 2639 of a file with a large header. > # This is line 2640 of a file with a large header. > # This is line 2641 of a file with a large header. > # This is line 2642 of a file with a large header. > # This is line 2643 of a file with a large header. > # This is line 2644 of a file with a large header. > # This is line 2645 of a file with a large header. > # This is line 2646 of a file with a large header. > # This is line 2647 of a file with a large header. > # This is line 2648 of a file with a large header. > # This is line 2649 of a file with a large header. > # This is line 2650 of a file with a large header. > # This is line 2651 of a file with a large header. > # This is line 2652 of a file with a large header. > # This is line 2653 of a file with a large header. > # This is line 2654 of a file with a large header. > # This is line 2655 of a file with a large header. > # This is line 2656 of a file with a large header. > # This is line 2657 of a file with a large header. > # This is line 2658 of a file with a large header. > # This is line 2659 of a file with a large header. > # This is line 2660 of a file with a large header. > # This is line 2661 of a file with a large header. > # This is line 2662 of a file with a large header. > # This is line 2663 of a file with a large header. > # This is line 2664 of a file with a large header. > # This is line 2665 of a file with a large header. > # This is line 2666 of a file with a large header. > # This is line 2667 of a file with a large header. > # This is line 2668 of a file with a large header. > # This is line 2669 of a file with a large header. > # This is line 2670 of a file with a large header. > # This is line 2671 of a file with a large header. > # This is line 2672 of a file with a large header. > # This is line 2673 of a file with a large header. > # This is line 2674 of a file with a large header. > # This is line 2675 of a file with a large header. > # This is line 2676 of a file with a large header. > # This is line 2677 of a file with a large header. > # This is line 2678 of a file with a large header. > # This is line 2679 of a file with a large header. > # This is line 2680 of a file with a large header. > # This is line 2681 of a file with a large header. > # This is line 2682 of a file with a large header. > # This is line 2683 of a file with a large header. > # This is line 2684 of a file with a large header. > # This is line 2685 of a file with a large header. > # This is line 2686 of a file with a large header. > # This is line 2687 of a file with a large header. > # This is line 2688 of a file with a large header. > # This is line 2689 of a file with a large header. > # This is line 2690 of a file with a large header. > # This is line 2691 of a file with a large header. > # This is line 2692 of a file with a large header. > # This is line 2693 of a file with a large header. > # This is line 2694 of a file with a large header. > # This is line 2695 of a file with a large header. > # This is line 2696 of a file with a large header. > # This is line 2697 of a file with a large header. > # This is line 2698 of a file with a large header. > # This is line 2699 of a file with a large header. > # This is line 2700 of a file with a large header. > # This is line 2701 of a file with a large header. > # This is line 2702 of a file with a large header. > # This is line 2703 of a file with a large header. > # This is line 2704 of a file with a large header. > # This is line 2705 of a file with a large header. > # This is line 2706 of a file with a large header. > # This is line 2707 of a file with a large header. > # This is line 2708 of a file with a large header. > # This is line 2709 of a file with a large header. > # This is line 2710 of a file with a large header. > # This is line 2711 of a file with a large header. > # This is line 2712 of a file with a large header. > # This is line 2713 of a file with a large header. > # This is line 2714 of a file with a large header. > # This is line 2715 of a file with a large header. > # This is line 2716 of a file with a large header. > # This is line 2717 of a file with a large header. > # This is line 2718 of a file with a large header. > # This is line 2719 of a file with a large header. > # This is line 2720 of a file with a large header. > # This is line 2721 of a file with a large header. > # This is line 2722 of a file with a large header. > # This is line 2723 of a file with a large header. > # This is line 2724 of a file with a large header. > # This is line 2725 of a file with a large header. > # This is line 2726 of a file with a large header. > # This is line 2727 of a file with a large header. > # This is line 2728 of a file with a large header. > # This is line 2729 of a file with a large header. > # This is line 2730 of a file with a large header. > # This is line 2731 of a file with a large header. > # This is line 2732 of a file with a large header. > # This is line 2733 of a file with a large header. > # This is line 2734 of a file with a large header. > # This is line 2735 of a file with a large header. > # This is line 2736 of a file with a large header. > # This is line 2737 of a file with a large header. > # This is line 2738 of a file with a large header. > # This is line 2739 of a file with a large header. > # This is line 2740 of a file with a large header. > # This is line 2741 of a file with a large header. > # This is line 2742 of a file with a large header. > # This is line 2743 of a file with a large header. > # This is line 2744 of a file with a large header. > # This is line 2745 of a file with a large header. > # This is line 2746 of a file with a large header. > # This is line 2747 of a file with a large header. > # This is line 2748 of a file with a large header. > # This is line 2749 of a file with a large header. > # This is line 2750 of a file with a large header. > # This is line 2751 of a file with a large header. > # This is line 2752 of a file with a large header. > # This is line 2753 of a file with a large header. > # This is line 2754 of a file with a large header. > # This is line 2755 of a file with a large header. > # This is line 2756 of a file with a large header. > # This is line 2757 of a file with a large header. > # This is line 2758 of a file with a large header. > # This is line 2759 of a file with a large header. > # This is line 2760 of a file with a large header. > # This is line 2761 of a file with a large header. > # This is line 2762 of a file with a large header. > # This is line 2763 of a file with a large header. > # This is line 2764 of a file with a large header. > # This is line 2765 of a file with a large header. > # This is line 2766 of a file with a large header. > # This is line 2767 of a file with a large header. > # This is line 2768 of a file with a large header. > # This is line 2769 of a file with a large header. > # This is line 2770 of a file with a large header. > # This is line 2771 of a file with a large header. > # This is line 2772 of a file with a large header. > # This is line 2773 of a file with a large header. > # This is line 2774 of a file with a large header. > # This is line 2775 of a file with a large header. > # This is line 2776 of a file with a large header. > # This is line 2777 of a file with a large header. > # This is line 2778 of a file with a large header. > # This is line 2779 of a file with a large header. > # This is line 2780 of a file with a large header. > # This is line 2781 of a file with a large header. > # This is line 2782 of a file with a large header. > # This is line 2783 of a file with a large header. > # This is line 2784 of a file with a large header. > # This is line 2785 of a file with a large header. > # This is line 2786 of a file with a large header. > # This is line 2787 of a file with a large header. > # This is line 2788 of a file with a large header. > # This is line 2789 of a file with a large header. > # This is line 2790 of a file with a large header. > # This is line 2791 of a file with a large header. > # This is line 2792 of a file with a large header. > # This is line 2793 of a file with a large header. > # This is line 2794 of a file with a large header. > # This is line 2795 of a file with a large header. > # This is line 2796 of a file with a large header. > # This is line 2797 of a file with a large header. > # This is line 2798 of a file with a large header. > # This is line 2799 of a file with a large header. > # This is line 2800 of a file with a large header. > # This is line 2801 of a file with a large header. > # This is line 2802 of a file with a large header. > # This is line 2803 of a file with a large header. > # This is line 2804 of a file with a large header. > # This is line 2805 of a file with a large header. > # This is line 2806 of a file with a large header. > # This is line 2807 of a file with a large header. > # This is line 2808 of a file with a large header. > # This is line 2809 of a file with a large header. > # This is line 2810 of a file with a large header. > # This is line 2811 of a file with a large header. > # This is line 2812 of a file with a large header. > # This is line 2813 of a file with a large header. > # This is line 2814 of a file with a large header. > # This is line 2815 of a file with a large header. > # This is line 2816 of a file with a large header. > # This is line 2817 of a file with a large header. > # This is line 2818 of a file with a large header. > # This is line 2819 of a file with a large header. > # This is line 2820 of a file with a large header. > # This is line 2821 of a file with a large header. > # This is line 2822 of a file with a large header. > # This is line 2823 of a file with a large header. > # This is line 2824 of a file with a large header. > # This is line 2825 of a file with a large header. > # This is line 2826 of a file with a large header. > # This is line 2827 of a file with a large header. > # This is line 2828 of a file with a large header. > # This is line 2829 of a file with a large header. > # This is line 2830 of a file with a large header. > # This is line 2831 of a file with a large header. > # This is line 2832 of a file with a large header. > # This is line 2833 of a file with a large header. > # This is line 2834 of a file with a large header. > # This is line 2835 of a file with a large header. > # This is line 2836 of a file with a large header. > # This is line 2837 of a file with a large header. > # This is line 2838 of a file with a large header. > # This is line 2839 of a file with a large header. > # This is line 2840 of a file with a large header. > # This is line 2841 of a file with a large header. > # This is line 2842 of a file with a large header. > # This is line 2843 of a file with a large header. > # This is line 2844 of a file with a large header. > # This is line 2845 of a file with a large header. > # This is line 2846 of a file with a large header. > # This is line 2847 of a file with a large header. > # This is line 2848 of a file with a large header. > # This is line 2849 of a file with a large header. > # This is line 2850 of a file with a large header. > # This is line 2851 of a file with a large header. > # This is line 2852 of a file with a large header. > # This is line 2853 of a file with a large header. > # This is line 2854 of a file with a large header. > # This is line 2855 of a file with a large header. > # This is line 2856 of a file with a large header. > # This is line 2857 of a file with a large header. > # This is line 2858 of a file with a large header. > # This is line 2859 of a file with a large header. > # This is line 2860 of a file with a large header. > # This is line 2861 of a file with a large header. > # This is line 2862 of a file with a large header. > # This is line 2863 of a file with a large header. > # This is line 2864 of a file with a large header. > # This is line 2865 of a file with a large header. > # This is line 2866 of a file with a large header. > # This is line 2867 of a file with a large header. > # This is line 2868 of a file with a large header. > # This is line 2869 of a file with a large header. > # This is line 2870 of a file with a large header. > # This is line 2871 of a file with a large header. > # This is line 2872 of a file with a large header. > # This is line 2873 of a file with a large header. > # This is line 2874 of a file with a large header. > # This is line 2875 of a file with a large header. > # This is line 2876 of a file with a large header. > # This is line 2877 of a file with a large header. > # This is line 2878 of a file with a large header. > # This is line 2879 of a file with a large header. > # This is line 2880 of a file with a large header. > # This is line 2881 of a file with a large header. > # This is line 2882 of a file with a large header. > # This is line 2883 of a file with a large header. > # This is line 2884 of a file with a large header. > # This is line 2885 of a file with a large header. > # This is line 2886 of a file with a large header. > # This is line 2887 of a file with a large header. > # This is line 2888 of a file with a large header. > # This is line 2889 of a file with a large header. > # This is line 2890 of a file with a large header. > # This is line 2891 of a file with a large header. > # This is line 2892 of a file with a large header. > # This is line 2893 of a file with a large header. > # This is line 2894 of a file with a large header. > # This is line 2895 of a file with a large header. > # This is line 2896 of a file with a large header. > # This is line 2897 of a file with a large header. > # This is line 2898 of a file with a large header. > # This is line 2899 of a file with a large header. terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents > # This is line 2900 of a file with a large header. > # This is line 2901 of a file with a large header. > # This is line 2902 of a file with a large header. > # This is line 2903 of a file with a large header. > # This is line 2904 of a file with a large header. > # This is line 2905 of a file with a large header. > # This is line 2906 of a file with a large header. > # This is line 2907 of a file with a large header. > # This is line 2908 of a file with a large header. > # This is line 2909 of a file with a large header. > # This is line 2910 of a file with a large header. > # This is line 2911 of a file with a large header. > # This is line 2912 of a file with a large header. > # This is line 2913 of a file with a large header. > # This is line 2914 of a file with a large header. > # This is line 2915 of a file with a large header. > # This is line 2916 of a file with a large header. > # This is line 2917 of a file with a large header. > # This is line 2918 of a file with a large header. > # This is line 2919 of a file with a large header. > # This is line 2920 of a file with a large header. > # This is line 2921 of a file with a large header. > # This is line 2922 of a file with a large header. > # This is line 2923 of a file with a large header. > # This is line 2924 of a file with a large header. > # This is line 2925 of a file with a large header. > # This is line 2926 of a file with a large header. > # This is line 2927 of a file with a large header. > # This is line 2928 of a file with a large header. new_test-intersect.sh: line 578: 15652 Aborted $BT intersect -a <(cat a_withLargeHeader_bgzipped.bed.gz) -b b.bed -header > obs > # This is line 2929 of a file with a large header. > # This is line 2930 of a file with a large header. > # This is line 2931 of a file with a large header. > # This is line 2932 of a file with a large header. > # This is line 2933 of a file with a large header. > # This is line 2934 of a file with a large header. > # This is line 2935 of a file with a large header. > # This is line 2936 of a file with a large header. > # This is line 2937 of a file with a large header. > # This is line 2938 of a file with a large header. > # This is line 2939 of a file with a large header. > # This is line 2940 of a file with a large header. > # This is line 2941 of a file with a large header. > # This is line 2942 of a file with a large header. > # This is line 2943 of a file with a large header. > # This is line 2944 of a file with a large header. > # This is line 2945 of a file with a large header. > # This is line 2946 of a file with a large header. > # This is line 2947 of a file with a large header. > # This is line 2948 of a file with a large header. > # This is line 2949 of a file with a large header. > # This is line 2950 of a file with a large header. > # This is line 2951 of a file with a large header. > # This is line 2952 of a file with a large header. > # This is line 2953 of a file with a large header. > # This is line 2954 of a file with a large header. > # This is line 2955 of a file with a large header. > # This is line 2956 of a file with a large header. > # This is line 2957 of a file with a large header. > # This is line 2958 of a file with a large header. > # This is line 2959 of a file with a large header. > # This is line 2960 of a file with a large header. > # This is line 2961 of a file with a large header. > # This is line 2962 of a file with a large header. > # This is line 2963 of a file with a large header. > # This is line 2964 of a file with a large header. > # This is line 2965 of a file with a large header. > # This is line 2966 of a file with a large header. > # This is line 2967 of a file with a large header. > # This is line 2968 of a file with a large header. > # This is line 2969 of a file with a large header. > # This is line 2970 of a file with a large header. > # This is line 2971 of a file with a large header. > # This is line 2972 of a file with a large header. > # This is line 2973 of a file with a large header. > # This is line 2974 of a file with a large header. > # This is line 2975 of a file with a large header. > # This is line 2976 of a file with a large header. > # This is line 2977 of a file with a large header. > # This is line 2978 of a file with a large header. > # This is line 2979 of a file with a large header. > # This is line 2980 of a file with a large header. > # This is line 2981 of a file with a large header. > # This is line 2982 of a file with a large header. > # This is line 2983 of a file with a large header. > # This is line 2984 of a file with a large header. > # This is line 2985 of a file with a large header. > # This is line 2986 of a file with a large header. > # This is line 2987 of a file with a large header. > # This is line 2988 of a file with a large header. > # This is line 2989 of a file with a large header. > # This is line 2990 of a file with a large header. > # This is line 2991 of a file with a large header. > # This is line 2992 of a file with a large header. > # This is line 2993 of a file with a large header. > # This is line 2994 of a file with a large header. > # This is line 2995 of a file with a large header. > # This is line 2996 of a file with a large header. > # This is line 2997 of a file with a large header. > # This is line 2998 of a file with a large header. > # This is line 2999 of a file with a large header. > # This is line 3000 of a file with a large header. > # This is line 3001 of a file with a large header. > # This is line 3002 of a file with a large header. > # This is line 3003 of a file with a large header. > # This is line 3004 of a file with a large header. > # This is line 3005 of a file with a large header. > # This is line 3006 of a file with a large header. > # This is line 3007 of a file with a large header. > # This is line 3008 of a file with a large header. > # This is line 3009 of a file with a large header. > # This is line 3010 of a file with a large header. > # This is line 3011 of a file with a large header. > # This is line 3012 of a file with a large header. > # This is line 3013 of a file with a large header. > # This is line 3014 of a file with a large header. > # This is line 3015 of a file with a large header. > # This is line 3016 of a file with a large header. > # This is line 3017 of a file with a large header. > # This is line 3018 of a file with a large header. > # This is line 3019 of a file with a large header. > # This is line 3020 of a file with a large header. > # This is line 3021 of a file with a large header. > # This is line 3022 of a file with a large header. > # This is line 3023 of a file with a large header. > # This is line 3024 of a file with a large header. > # This is line 3025 of a file with a large header. > # This is line 3026 of a file with a large header. > # This is line 3027 of a file with a large header. > # This is line 3028 of a file with a large header. > # This is line 3029 of a file with a large header. > # This is line 3030 of a file with a large header. > # This is line 3031 of a file with a large header. > # This is line 3032 of a file with a large header. > # This is line 3033 of a file with a large header. > # This is line 3034 of a file with a large header. > # This is line 3035 of a file with a large header. > # This is line 3036 of a file with a large header. > # This is line 3037 of a file with a large header. > # This is line 3038 of a file with a large header. > # This is line 3039 of a file with a large header. > # This is line 3040 of a file with a large header. > # This is line 3041 of a file with a large header. > # This is line 3042 of a file with a large header. > # This is line 3043 of a file with a large header. > # This is line 3044 of a file with a large header. > # This is line 3045 of a file with a large header. > # This is line 3046 of a file with a large header. > # This is line 3047 of a file with a large header. > # This is line 3048 of a file with a large header. > # This is line 3049 of a file with a large header. > # This is line 3050 of a file with a large header. > # This is line 3051 of a file with a large header. > # This is line 3052 of a file with a large header. > # This is line 3053 of a file with a large header. > # This is line 3054 of a file with a large header. > # This is line 3055 of a file with a large header. > # This is line 3056 of a file with a large header. > # This is line 3057 of a file with a large header. > # This is line 3058 of a file with a large header. > # This is line 3059 of a file with a large header. > # This is line 3060 of a file with a large header. > # This is line 3061 of a file with a large header. > # This is line 3062 of a file with a large header. > # This is line 3063 of a file with a large header. > # This is line 3064 of a file with a large header. > # This is line 3065 of a file with a large header. > # This is line 3066 of a file with a large header. > # This is line 3067 of a file with a large header. > # This is line 3068 of a file with a large header. > # This is line 3069 of a file with a large header. > # This is line 3070 of a file with a large header. > # This is line 3071 of a file with a large header. > # This is line 3072 of a file with a large header. > # This is line 3073 of a file with a large header. > # This is line 3074 of a file with a large header. > # This is line 3075 of a file with a large header. > # This is line 3076 of a file with a large header. > # This is line 3077 of a file with a large header. > # This is line 3078 of a file with a large header. > # This is line 3079 of a file with a large header. > # This is line 3080 of a file with a large header. > # This is line 3081 of a file with a large header. > # This is line 3082 of a file with a large header. > # This is line 3083 of a file with a large header. > # This is line 3084 of a file with a large header. > # This is line 3085 of a file with a large header. > # This is line 3086 of a file with a large header. > # This is line 3087 of a file with a large header. > # This is line 3088 of a file with a large header. > # This is line 3089 of a file with a large header. > # This is line 3090 of a file with a large header. > # This is line 3091 of a file with a large header. > # This is line 3092 of a file with a large header. > # This is line 3093 of a file with a large header. > # This is line 3094 of a file with a large header. > # This is line 3095 of a file with a large header. > # This is line 3096 of a file with a large header. > # This is line 3097 of a file with a large header. > # This is line 3098 of a file with a large header. > # This is line 3099 of a file with a large header. > # This is line 3100 of a file with a large header. > # This is line 3101 of a file with a large header. > # This is line 3102 of a file with a large header. > # This is line 3103 of a file with a large header. > # This is line 3104 of a file with a large header. > # This is line 3105 of a file with a large header. > # This is line 3106 of a file with a large header. > # This is line 3107 of a file with a large header. > # This is line 3108 of a file with a large header. > # This is line 3109 of a file with a large header. > # This is line 3110 of a file with a large header. > # This is line 3111 of a file with a large header. > # This is line 3112 of a file with a large header. > # This is line 3113 of a file with a large header. > # This is line 3114 of a file with a large header. > # This is line 3115 of a file with a large header. > # This is line 3116 of a file with a large header. > # This is line 3117 of a file with a large header. > # This is line 3118 of a file with a large header. > # This is line 3119 of a file with a large header. > # This is line 3120 of a file with a large header. > # This is line 3121 of a file with a large header. > # This is line 3122 of a file with a large header. > # This is line 3123 of a file with a large header. > # This is line 3124 of a file with a large header. > # This is line 3125 of a file with a large header. > # This is line 3126 of a file with a large header. > # This is line 3127 of a file with a large header. > # This is line 3128 of a file with a large header. > # This is line 3129 of a file with a large header. > # This is line 3130 of a file with a large header. > # This is line 3131 of a file with a large header. > # This is line 3132 of a file with a large header. > # This is line 3133 of a file with a large header. > # This is line 3134 of a file with a large header. > # This is line 3135 of a file with a large header. > # This is line 3136 of a file with a large header. > # This is line 3137 of a file with a large header. > # This is line 3138 of a file with a large header. > # This is line 3139 of a file with a large header. > # This is line 3140 of a file with a large header. > # This is line 3141 of a file with a large header. > # This is line 3142 of a file with a large header. > # This is line 3143 of a file with a large header. > # This is line 3144 of a file with a large header. > # This is line 3145 of a file with a large header. > # This is line 3146 of a file with a large header. > # This is line 3147 of a file with a large header. > # This is line 3148 of a file with a large header. > # This is line 3149 of a file with a large header. > # This is line 3150 of a file with a large header. > # This is line 3151 of a file with a large header. > # This is line 3152 of a file with a large header. > # This is line 3153 of a file with a large header. > # This is line 3154 of a file with a large header. > # This is line 3155 of a file with a large header. > # This is line 3156 of a file with a large header. > # This is line 3157 of a file with a large header. > # This is line 3158 of a file with a large header. > # This is line 3159 of a file with a large header. > # This is line 3160 of a file with a large header. > # This is line 3161 of a file with a large header. > # This is line 3162 of a file with a large header. > # This is line 3163 of a file with a large header. > # This is line 3164 of a file with a large header. > # This is line 3165 of a file with a large header. > # This is line 3166 of a file with a large header. > # This is line 3167 of a file with a large header. > # This is line 3168 of a file with a large header. > # This is line 3169 of a file with a large header. > # This is line 3170 of a file with a large header. > # This is line 3171 of a file with a large header. > # This is line 3172 of a file with a large header. > # This is line 3173 of a file with a large header. > # This is line 3174 of a file with a large header. > # This is line 3175 of a file with a large header. > # This is line 3176 of a file with a large header. > # This is line 3177 of a file with a large header. > # This is line 3178 of a file with a large header. > # This is line 3179 of a file with a large header. > # This is line 3180 of a file with a large header. > # This is line 3181 of a file with a large header. > # This is line 3182 of a file with a large header. > # This is line 3183 of a file with a large header. > # This is line 3184 of a file with a large header. > # This is line 3185 of a file with a large header. > # This is line 3186 of a file with a large header. > # This is line 3187 of a file with a large header. > # This is line 3188 of a file with a large header. > # This is line 3189 of a file with a large header. > # This is line 3190 of a file with a large header. > # This is line 3191 of a file with a large header. > # This is line 3192 of a file with a large header. > # This is line 3193 of a file with a large header. > # This is line 3194 of a file with a large header. > # This is line 3195 of a file with a large header. > # This is line 3196 of a file with a large header. > # This is line 3197 of a file with a large header. > # This is line 3198 of a file with a large header. > # This is line 3199 of a file with a large header. > # This is line 3200 of a file with a large header. > # This is line 3201 of a file with a large header. > # This is line 3202 of a file with a large header. > # This is line 3203 of a file with a large header. > # This is line 3204 of a file with a large header. > # This is line 3205 of a file with a large header. > # This is line 3206 of a file with a large header. > # This is line 3207 of a file with a large header. > # This is line 3208 of a file with a large header. > # This is line 3209 of a file with a large header. > # This is line 3210 of a file with a large header. > # This is line 3211 of a file with a large header. > # This is line 3212 of a file with a large header. > # This is line 3213 of a file with a large header. > # This is line 3214 of a file with a large header. > # This is line 3215 of a file with a large header. > # This is line 3216 of a file with a large header. > # This is line 3217 of a file with a large header. > # This is line 3218 of a file with a large header. > # This is line 3219 of a file with a large header. > # This is line 3220 of a file with a large header. > # This is line 3221 of a file with a large header. > # This is line 3222 of a file with a large header. > # This is line 3223 of a file with a large header. > # This is line 3224 of a file with a large header. > # This is line 3225 of a file with a large header. > # This is line 3226 of a file with a large header. > # This is line 3227 of a file with a large header. > # This is line 3228 of a file with a large header. > # This is line 3229 of a file with a large header. > # This is line 3230 of a file with a large header. > # This is line 3231 of a file with a large header. > # This is line 3232 of a file with a large header. > # This is line 3233 of a file with a large header. > # This is line 3234 of a file with a large header. > # This is line 3235 of a file with a large header. > # This is line 3236 of a file with a large header. > # This is line 3237 of a file with a large header. > # This is line 3238 of a file with a large header. > # This is line 3239 of a file with a large header. > # This is line 3240 of a file with a large header. > # This is line 3241 of a file with a large header. > # This is line 3242 of a file with a large header. > # This is line 3243 of a file with a large header. > # This is line 3244 of a file with a large header. > # This is line 3245 of a file with a large header. > # This is line 3246 of a file with a large header. > # This is line 3247 of a file with a large header. > # This is line 3248 of a file with a large header. > # This is line 3249 of a file with a large header. > # This is line 3250 of a file with a large header. > # This is line 3251 of a file with a large header. > # This is line 3252 of a file with a large header. > # This is line 3253 of a file with a large header. > # This is line 3254 of a file with a large header. > # This is line 3255 of a file with a large header. > # This is line 3256 of a file with a large header. > # This is line 3257 of a file with a large header. > # This is line 3258 of a file with a large header. > # This is line 3259 of a file with a large header. > # This is line 3260 of a file with a large header. > # This is line 3261 of a file with a large header. > # This is line 3262 of a file with a large header. > # This is line 3263 of a file with a large header. > # This is line 3264 of a file with a large header. > # This is line 3265 of a file with a large header. > # This is line 3266 of a file with a large header. > # This is line 3267 of a file with a large header. > # This is line 3268 of a file with a large header. > # This is line 3269 of a file with a large header. > # This is line 3270 of a file with a large header. > # This is line 3271 of a file with a large header. > # This is line 3272 of a file with a large header. > # This is line 3273 of a file with a large header. > # This is line 3274 of a file with a large header. > # This is line 3275 of a file with a large header. > # This is line 3276 of a file with a large header. > # This is line 3277 of a file with a large header. > # This is line 3278 of a file with a large header. > # This is line 3279 of a file with a large header. > # This is line 3280 of a file with a large header. > # This is line 3281 of a file with a large header. > # This is line 3282 of a file with a large header. > # This is line 3283 of a file with a large header. > # This is line 3284 of a file with a large header. > # This is line 3285 of a file with a large header. > # This is line 3286 of a file with a large header. > # This is line 3287 of a file with a large header. > # This is line 3288 of a file with a large header. > # This is line 3289 of a file with a large header. > # This is line 3290 of a file with a large header. > # This is line 3291 of a file with a large header. > # This is line 3292 of a file with a large header. > # This is line 3293 of a file with a large header. > # This is line 3294 of a file with a large header. > # This is line 3295 of a file with a large header. > # This is line 3296 of a file with a large header. > # This is line 3297 of a file with a large header. > # This is line 3298 of a file with a large header. > # This is line 3299 of a file with a large header. > # This is line 3300 of a file with a large header. > # This is line 3301 of a file with a large header. > # This is line 3302 of a file with a large header. > # This is line 3303 of a file with a large header. > # This is line 3304 of a file with a large header. > # This is line 3305 of a file with a large header. > # This is line 3306 of a file with a large header. > # This is line 3307 of a file with a large header. > # This is line 3308 of a file with a large header. > # This is line 3309 of a file with a large header. > # This is line 3310 of a file with a large header. > # This is line 3311 of a file with a large header. > # This is line 3312 of a file with a large header. > # This is line 3313 of a file with a large header. > # This is line 3314 of a file with a large header. > # This is line 3315 of a file with a large header. > # This is line 3316 of a file with a large header. > # This is line 3317 of a file with a large header. > # This is line 3318 of a file with a large header. > # This is line 3319 of a file with a large header. > # This is line 3320 of a file with a large header. > # This is line 3321 of a file with a large header. > # This is line 3322 of a file with a large header. > # This is line 3323 of a file with a large header. > # This is line 3324 of a file with a large header. > # This is line 3325 of a file with a large header. > # This is line 3326 of a file with a large header. > # This is line 3327 of a file with a large header. > # This is line 3328 of a file with a large header. > # This is line 3329 of a file with a large header. > # This is line 3330 of a file with a large header. > # This is line 3331 of a file with a large header. > # This is line 3332 of a file with a large header. > # This is line 3333 of a file with a large header. > # This is line 3334 of a file with a large header. > # This is line 3335 of a file with a large header. > # This is line 3336 of a file with a large header. > # This is line 3337 of a file with a large header. > # This is line 3338 of a file with a large header. > # This is line 3339 of a file with a large header. > # This is line 3340 of a file with a large header. > # This is line 3341 of a file with a large header. > # This is line 3342 of a file with a large header. > # This is line 3343 of a file with a large header. > # This is line 3344 of a file with a large header. > # This is line 3345 of a file with a large header. > # This is line 3346 of a file with a large header. > # This is line 3347 of a file with a large header. > # This is line 3348 of a file with a large header. > # This is line 3349 of a file with a large header. > # This is line 3350 of a file with a large header. > # This is line 3351 of a file with a large header. > # This is line 3352 of a file with a large header. > # This is line 3353 of a file with a large header. > # This is line 3354 of a file with a large header. > # This is line 3355 of a file with a large header. > # This is line 3356 of a file with a large header. > # This is line 3357 of a file with a large header. > # This is line 3358 of a file with a large header. > # This is line 3359 of a file with a large header. > # This is line 3360 of a file with a large header. > # This is line 3361 of a file with a large header. > # This is line 3362 of a file with a large header. > # This is line 3363 of a file with a large header. > # This is line 3364 of a file with a large header. > # This is line 3365 of a file with a large header. > # This is line 3366 of a file with a large header. > # This is line 3367 of a file with a large header. > # This is line 3368 of a file with a large header. > # This is line 3369 of a file with a large header. > # This is line 3370 of a file with a large header. > # This is line 3371 of a file with a large header. > # This is line 3372 of a file with a large header. > # This is line 3373 of a file with a large header. > # This is line 3374 of a file with a large header. > # This is line 3375 of a file with a large header. > # This is line 3376 of a file with a large header. > # This is line 3377 of a file with a large header. > # This is line 3378 of a file with a large header. > # This is line 3379 of a file with a large header. > # This is line 3380 of a file with a large header. > # This is line 3381 of a file with a large header. > # This is line 3382 of a file with a large header. > # This is line 3383 of a file with a large header. > # This is line 3384 of a file with a large header. > # This is line 3385 of a file with a large header. > # This is line 3386 of a file with a large header. > # This is line 3387 of a file with a large header. > # This is line 3388 of a file with a large header. > # This is line 3389 of a file with a large header. > # This is line 3390 of a file with a large header. > # This is line 3391 of a file with a large header. > # This is line 3392 of a file with a large header. > # This is line 3393 of a file with a large header. > # This is line 3394 of a file with a large header. > # This is line 3395 of a file with a large header. > # This is line 3396 of a file with a large header. > # This is line 3397 of a file with a large header. > # This is line 3398 of a file with a large header. > # This is line 3399 of a file with a large header. > # This is line 3400 of a file with a large header. > # This is line 3401 of a file with a large header. > # This is line 3402 of a file with a large header. > # This is line 3403 of a file with a large header. > # This is line 3404 of a file with a large header. > # This is line 3405 of a file with a large header. > # This is line 3406 of a file with a large header. > # This is line 3407 of a file with a large header. > # This is line 3408 of a file with a large header. > # This is line 3409 of a file with a large header. > # This is line 3410 of a file with a large header. > # This is line 3411 of a file with a large header. > # This is line 3412 of a file with a large header. > # This is line 3413 of a file with a large header. > # This is line 3414 of a file with a large header. > # This is line 3415 of a file with a large header. > # This is line 3416 of a file with a large header. > # This is line 3417 of a file with a large header. > # This is line 3418 of a file with a large header. > # This is line 3419 of a file with a large header. > # This is line 3420 of a file with a large header. > # This is line 3421 of a file with a large header. > # This is line 3422 of a file with a large header. > # This is line 3423 of a file with a large header. > # This is line 3424 of a file with a large header. > # This is line 3425 of a file with a large header. > # This is line 3426 of a file with a large header. > # This is line 3427 of a file with a large header. > # This is line 3428 of a file with a large header. > # This is line 3429 of a file with a large header. > # This is line 3430 of a file with a large header. > # This is line 3431 of a file with a large header. > # This is line 3432 of a file with a large header. > # This is line 3433 of a file with a large header. > # This is line 3434 of a file with a large header. > # This is line 3435 of a file with a large header. > # This is line 3436 of a file with a large header. > # This is line 3437 of a file with a large header. > # This is line 3438 of a file with a large header. > # This is line 3439 of a file with a large header. > # This is line 3440 of a file with a large header. > # This is line 3441 of a file with a large header. > # This is line 3442 of a file with a large header. > # This is line 3443 of a file with a large header. > # This is line 3444 of a file with a large header. > # This is line 3445 of a file with a large header. > # This is line 3446 of a file with a large header. > # This is line 3447 of a file with a large header. > # This is line 3448 of a file with a large header. > # This is line 3449 of a file with a large header. > # This is line 3450 of a file with a large header. > # This is line 3451 of a file with a large header. > # This is line 3452 of a file with a large header. > # This is line 3453 of a file with a large header. > # This is line 3454 of a file with a large header. > # This is line 3455 of a file with a large header. > # This is line 3456 of a file with a large header. > # This is line 3457 of a file with a large header. > # This is line 3458 of a file with a large header. > # This is line 3459 of a file with a large header. > # This is line 3460 of a file with a large header. > # This is line 3461 of a file with a large header. > # This is line 3462 of a file with a large header. > # This is line 3463 of a file with a large header. > # This is line 3464 of a file with a large header. > # This is line 3465 of a file with a large header. > # This is line 3466 of a file with a large header. > # This is line 3467 of a file with a large header. > # This is line 3468 of a file with a large header. > # This is line 3469 of a file with a large header. > # This is line 3470 of a file with a large header. > # This is line 3471 of a file with a large header. > # This is line 3472 of a file with a large header. > # This is line 3473 of a file with a large header. > # This is line 3474 of a file with a large header. > # This is line 3475 of a file with a large header. > # This is line 3476 of a file with a large header. > # This is line 3477 of a file with a large header. > # This is line 3478 of a file with a large header. > # This is line 3479 of a file with a large header. > # This is line 3480 of a file with a large header. > # This is line 3481 of a file with a large header. > # This is line 3482 of a file with a large header. > # This is line 3483 of a file with a large header. > # This is line 3484 of a file with a large header. > # This is line 3485 of a file with a large header. > # This is line 3486 of a file with a large header. > # This is line 3487 of a file with a large header. > # This is line 3488 of a file with a large header. > # This is line 3489 of a file with a large header. > # This is line 3490 of a file with a large header. > # This is line 3491 of a file with a large header. > # This is line 3492 of a file with a large header. > # This is line 3493 of a file with a large header. > # This is line 3494 of a file with a large header. > # This is line 3495 of a file with a large header. > # This is line 3496 of a file with a large header. > # This is line 3497 of a file with a large header. > # This is line 3498 of a file with a large header. > # This is line 3499 of a file with a large header. > # This is line 3500 of a file with a large header. > # This is line 3501 of a file with a large header. > # This is line 3502 of a file with a large header. > # This is line 3503 of a file with a large header. > # This is line 3504 of a file with a large header. > # This is line 3505 of a file with a large header. > # This is line 3506 of a file with a large header. > # This is line 3507 of a file with a large header. > # This is line 3508 of a file with a large header. > # This is line 3509 of a file with a large header. > # This is line 3510 of a file with a large header. > # This is line 3511 of a file with a large header. > # This is line 3512 of a file with a large header. > # This is line 3513 of a file with a large header. > # This is line 3514 of a file with a large header. > # This is line 3515 of a file with a large header. > # This is line 3516 of a file with a large header. > # This is line 3517 of a file with a large header. > # This is line 3518 of a file with a large header. > # This is line 3519 of a file with a large header. > # This is line 3520 of a file with a large header. > # This is line 3521 of a file with a large header. > # This is line 3522 of a file with a large header. > # This is line 3523 of a file with a large header. > # This is line 3524 of a file with a large header. > # This is line 3525 of a file with a large header. > # This is line 3526 of a file with a large header. > # This is line 3527 of a file with a large header. > # This is line 3528 of a file with a large header. > # This is line 3529 of a file with a large header. > # This is line 3530 of a file with a large header. > # This is line 3531 of a file with a large header. > # This is line 3532 of a file with a large header. > # This is line 3533 of a file with a large header. > # This is line 3534 of a file with a large header. > # This is line 3535 of a file with a large header. > # This is line 3536 of a file with a large header. > # This is line 3537 of a file with a large header. > # This is line 3538 of a file with a large header. > # This is line 3539 of a file with a large header. > # This is line 3540 of a file with a large header. > # This is line 3541 of a file with a large header. > # This is line 3542 of a file with a large header. > # This is line 3543 of a file with a large header. > # This is line 3544 of a file with a large header. > # This is line 3545 of a file with a large header. > # This is line 3546 of a file with a large header. > # This is line 3547 of a file with a large header. > # This is line 3548 of a file with a large header. > # This is line 3549 of a file with a large header. > # This is line 3550 of a file with a large header. > # This is line 3551 of a file with a large header. > # This is line 3552 of a file with a large header. > # This is line 3553 of a file with a large header. > # This is line 3554 of a file with a large header. > # This is line 3555 of a file with a large header. > # This is line 3556 of a file with a large header. > # This is line 3557 of a file with a large header. > # This is line 3558 of a file with a large header. > # This is line 3559 of a file with a large header. > # This is line 3560 of a file with a large header. > # This is line 3561 of a file with a large header. > # This is line 3562 of a file with a large header. > # This is line 3563 of a file with a large header. > # This is line 3564 of a file with a large header. > # This is line 3565 of a file with a large header. > # This is line 3566 of a file with a large header. > # This is line 3567 of a file with a large header. > # This is line 3568 of a file with a large header. > # This is line 3569 of a file with a large header. > # This is line 3570 of a file with a large header. > # This is line 3571 of a file with a large header. > # This is line 3572 of a file with a large header. > # This is line 3573 of a file with a large header. > # This is line 3574 of a file with a large header. > # This is line 3575 of a file with a large header. > # This is line 3576 of a file with a large header. > # This is line 3577 of a file with a large header. > # This is line 3578 of a file with a large header. > # This is line 3579 of a file with a large header. > # This is line 3580 of a file with a large header. > # This is line 3581 of a file with a large header. > # This is line 3582 of a file with a large header. > # This is line 3583 of a file with a large header. > # This is line 3584 of a file with a large header. > # This is line 3585 of a file with a large header. > # This is line 3586 of a file with a large header. > # This is line 3587 of a file with a large header. > # This is line 3588 of a file with a large header. > # This is line 3589 of a file with a large header. > # This is line 3590 of a file with a large header. > # This is line 3591 of a file with a large header. > # This is line 3592 of a file with a large header. > # This is line 3593 of a file with a large header. > # This is line 3594 of a file with a large header. > # This is line 3595 of a file with a large header. > # This is line 3596 of a file with a large header. > # This is line 3597 of a file with a large header. > # This is line 3598 of a file with a large header. > # This is line 3599 of a file with a large header. > # This is line 3600 of a file with a large header. > # This is line 3601 of a file with a large header. > # This is line 3602 of a file with a large header. > # This is line 3603 of a file with a large header. > # This is line 3604 of a file with a large header. > # This is line 3605 of a file with a large header. > # This is line 3606 of a file with a large header. > # This is line 3607 of a file with a large header. > # This is line 3608 of a file with a large header. > # This is line 3609 of a file with a large header. > # This is line 3610 of a file with a large header. > # This is line 3611 of a file with a large header. > # This is line 3612 of a file with a large header. > # This is line 3613 of a file with a large header. > # This is line 3614 of a file with a large header. > # This is line 3615 of a file with a large header. > # This is line 3616 of a file with a large header. > # This is line 3617 of a file with a large header. > # This is line 3618 of a file with a large header. > # This is line 3619 of a file with a large header. > # This is line 3620 of a file with a large header. > # This is line 3621 of a file with a large header. > # This is line 3622 of a file with a large header. > # This is line 3623 of a file with a large header. > # This is line 3624 of a file with a large header. > # This is line 3625 of a file with a large header. > # This is line 3626 of a file with a large header. > # This is line 3627 of a file with a large header. > # This is line 3628 of a file with a large header. > # This is line 3629 of a file with a large header. > # This is line 3630 of a file with a large header. > # This is line 3631 of a file with a large header. > # This is line 3632 of a file with a large header. > # This is line 3633 of a file with a large header. > # This is line 3634 of a file with a large header. > # This is line 3635 of a file with a large header. > # This is line 3636 of a file with a large header. > # This is line 3637 of a file with a large header. > # This is line 3638 of a file with a large header. > # This is line 3639 of a file with a large header. > # This is line 3640 of a file with a large header. > # This is line 3641 of a file with a large header. > # This is line 3642 of a file with a large header. > # This is line 3643 of a file with a large header. > # This is line 3644 of a file with a large header. > # This is line 3645 of a file with a large header. > # This is line 3646 of a file with a large header. > # This is line 3647 of a file with a large header. > # This is line 3648 of a file with a large header. > # This is line 3649 of a file with a large header. > # This is line 3650 of a file with a large header. > # This is line 3651 of a file with a large header. > # This is line 3652 of a file with a large header. > # This is line 3653 of a file with a large header. > # This is line 3654 of a file with a large header. > # This is line 3655 of a file with a large header. > # This is line 3656 of a file with a large header. > # This is line 3657 of a file with a large header. > # This is line 3658 of a file with a large header. > # This is line 3659 of a file with a large header. > # This is line 3660 of a file with a large header. > # This is line 3661 of a file with a large header. > # This is line 3662 of a file with a large header. > # This is line 3663 of a file with a large header. > # This is line 3664 of a file with a large header. > # This is line 3665 of a file with a large header. > # This is line 3666 of a file with a large header. > # This is line 3667 of a file with a large header. > # This is line 3668 of a file with a large header. > # This is line 3669 of a file with a large header. > # This is line 3670 of a file with a large header. > # This is line 3671 of a file with a large header. > # This is line 3672 of a file with a large header. > # This is line 3673 of a file with a large header. > # This is line 3674 of a file with a large header. > # This is line 3675 of a file with a large header. > # This is line 3676 of a file with a large header. > # This is line 3677 of a file with a large header. > # This is line 3678 of a file with a large header. > # This is line 3679 of a file with a large header. > # This is line 3680 of a file with a large header. > # This is line 3681 of a file with a large header. > # This is line 3682 of a file with a large header. > # This is line 3683 of a file with a large header. > # This is line 3684 of a file with a large header. > # This is line 3685 of a file with a large header. > # This is line 3686 of a file with a large header. > # This is line 3687 of a file with a large header. > # This is line 3688 of a file with a large header. > # This is line 3689 of a file with a large header. > # This is line 3690 of a file with a large header. > # This is line 3691 of a file with a large header. > # This is line 3692 of a file with a large header. > # This is line 3693 of a file with a large header. > # This is line 3694 of a file with a large header. > # This is line 3695 of a file with a large header. > # This is line 3696 of a file with a large header. > # This is line 3697 of a file with a large header. > # This is line 3698 of a file with a large header. > # This is line 3699 of a file with a large header. > # This is line 3700 of a file with a large header. > # This is line 3701 of a file with a large header. > # This is line 3702 of a file with a large header. > # This is line 3703 of a file with a large header. > # This is line 3704 of a file with a large header. > # This is line 3705 of a file with a large header. > # This is line 3706 of a file with a large header. > # This is line 3707 of a file with a large header. > # This is line 3708 of a file with a large header. > # This is line 3709 of a file with a large header. > # This is line 3710 of a file with a large header. > # This is line 3711 of a file with a large header. > # This is line 3712 of a file with a large header. > # This is line 3713 of a file with a large header. > # This is line 3714 of a file with a large header. > # This is line 3715 of a file with a large header. > # This is line 3716 of a file with a large header. > # This is line 3717 of a file with a large header. > # This is line 3718 of a file with a large header. > # This is line 3719 of a file with a large header. > # This is line 3720 of a file with a large header. > # This is line 3721 of a file with a large header. > # This is line 3722 of a file with a large header. > # This is line 3723 of a file with a large header. > # This is line 3724 of a file with a large header. > # This is line 3725 of a file with a large header. > # This is line 3726 of a file with a large header. > # This is line 3727 of a file with a large header. > # This is line 3728 of a file with a large header. > # This is line 3729 of a file with a large header. > # This is line 3730 of a file with a large header. > # This is line 3731 of a file with a large header. > # This is line 3732 of a file with a large header. > # This is line 3733 of a file with a large header. > # This is line 3734 of a file with a large header. > # This is line 3735 of a file with a large header. > # This is line 3736 of a file with a large header. > # This is line 3737 of a file with a large header. > # This is line 3738 of a file with a large header. > # This is line 3739 of a file with a large header. > # This is line 3740 of a file with a large header. > # This is line 3741 of a file with a large header. > # This is line 3742 of a file with a large header. > # This is line 3743 of a file with a large header. > # This is line 3744 of a file with a large header. > # This is line 3745 of a file with a large header. > # This is line 3746 of a file with a large header. > # This is line 3747 of a file with a large header. > # This is line 3748 of a file with a large header. > # This is line 3749 of a file with a large header. > # This is line 3750 of a file with a large header. > # This is line 3751 of a file with a large header. > # This is line 3752 of a file with a large header. > # This is line 3753 of a file with a large header. > # This is line 3754 of a file with a large header. > # This is line 3755 of a file with a large header. > # This is line 3756 of a file with a large header. > # This is line 3757 of a file with a large header. > # This is line 3758 of a file with a large header. > # This is line 3759 of a file with a large header. > # This is line 3760 of a file with a large header. > # This is line 3761 of a file with a large header. > # This is line 3762 of a file with a large header. > # This is line 3763 of a file with a large header. > # This is line 3764 of a file with a large header. > # This is line 3765 of a file with a large header. > # This is line 3766 of a file with a large header. > # This is line 3767 of a file with a large header. > # This is line 3768 of a file with a large header. > # This is line 3769 of a file with a large header. > # This is line 3770 of a file with a large header. > # This is line 3771 of a file with a large header. > # This is line 3772 of a file with a large header. > # This is line 3773 of a file with a large header. > # This is line 3774 of a file with a large header. > # This is line 3775 of a file with a large header. > # This is line 3776 of a file with a large header. > # This is line 3777 of a file with a large header. > # This is line 3778 of a file with a large header. > # This is line 3779 of a file with a large header. > # This is line 3780 of a file with a large header. > # This is line 3781 of a file with a large header. > # This is line 3782 of a file with a large header. > # This is line 3783 of a file with a large header. > # This is line 3784 of a file with a large header. > # This is line 3785 of a file with a large header. > # This is line 3786 of a file with a large header. > # This is line 3787 of a file with a large header. > # This is line 3788 of a file with a large header. > # This is line 3789 of a file with a large header. > # This is line 3790 of a file with a large header. > # This is line 3791 of a file with a large header. > # This is line 3792 of a file with a large header. > # This is line 3793 of a file with a large header. > # This is line 3794 of a file with a large header. > # This is line 3795 of a file with a large header. > # This is line 3796 of a file with a large header. > # This is line 3797 of a file with a large header. > # This is line 3798 of a file with a large header. > # This is line 3799 of a file with a large header. > # This is line 3800 of a file with a large header. > # This is line 3801 of a file with a large header. > # This is line 3802 of a file with a large header. > # This is line 3803 of a file with a large header. > # This is line 3804 of a file with a large header. > # This is line 3805 of a file with a large header. > # This is line 3806 of a file with a large header. > # This is line 3807 of a file with a large header. > # This is line 3808 of a file with a large header. > # This is line 3809 of a file with a large header. > # This is line 3810 of a file with a large header. > # This is line 3811 of a file with a large header. > # This is line 3812 of a file with a large header. > # This is line 3813 of a file with a large header. > # This is line 3814 of a file with a large header. > # This is line 3815 of a file with a large header. > # This is line 3816 of a file with a large header. > # This is line 3817 of a file with a large header. > # This is line 3818 of a file with a large header. > # This is line 3819 of a file with a large header. > # This is line 3820 of a file with a large header. > # This is line 3821 of a file with a large header. > # This is line 3822 of a file with a large header. > # This is line 3823 of a file with a large header. > # This is line 3824 of a file with a large header. > # This is line 3825 of a file with a large header. > # This is line 3826 of a file with a large header. > # This is line 3827 of a file with a large header. > # This is line 3828 of a file with a large header. > # This is line 3829 of a file with a large header. > # This is line 3830 of a file with a large header. > # This is line 3831 of a file with a large header. > # This is line 3832 of a file with a large header. > # This is line 3833 of a file with a large header. > # This is line 3834 of a file with a large header. > # This is line 3835 of a file with a large header. > # This is line 3836 of a file with a large header. > # This is line 3837 of a file with a large header. > # This is line 3838 of a file with a large header. > # This is line 3839 of a file with a large header. > # This is line 3840 of a file with a large header. > # This is line 3841 of a file with a large header. > # This is line 3842 of a file with a large header. > # This is line 3843 of a file with a large header. > # This is line 3844 of a file with a large header. > # This is line 3845 of a file with a large header. > # This is line 3846 of a file with a large header. > # This is line 3847 of a file with a large header. > # This is line 3848 of a file with a large header. > # This is line 3849 of a file with a large header. > # This is line 3850 of a file with a large header. > # This is line 3851 of a file with a large header. > # This is line 3852 of a file with a large header. > # This is line 3853 of a file with a large header. > # This is line 3854 of a file with a large header. > # This is line 3855 of a file with a large header. > # This is line 3856 of a file with a large header. > # This is line 3857 of a file with a large header. > # This is line 3858 of a file with a large header. > # This is line 3859 of a file with a large header. > # This is line 3860 of a file with a large header. > # This is line 3861 of a file with a large header. > # This is line 3862 of a file with a large header. > # This is line 3863 of a file with a large header. > # This is line 3864 of a file with a large header. > # This is line 3865 of a file with a large header. > # This is line 3866 of a file with a large header. > # This is line 3867 of a file with a large header. > # This is line 3868 of a file with a large header. > # This is line 3869 of a file with a large header. > # This is line 3870 of a file with a large header. > # This is line 3871 of a file with a large header. > # This is line 3872 of a file with a large header. > # This is line 3873 of a file with a large header. > # This is line 3874 of a file with a large header. > # This is line 3875 of a file with a large header. > # This is line 3876 of a file with a large header. > # This is line 3877 of a file with a large header. > # This is line 3878 of a file with a large header. > # This is line 3879 of a file with a large header. > # This is line 3880 of a file with a large header. > # This is line 3881 of a file with a large header. > # This is line 3882 of a file with a large header. > # This is line 3883 of a file with a large header. > # This is line 3884 of a file with a large header. > # This is line 3885 of a file with a large header. > # This is line 3886 of a file with a large header. > # This is line 3887 of a file with a large header. > # This is line 3888 of a file with a large header. > # This is line 3889 of a file with a large header. > # This is line 3890 of a file with a large header. > # This is line 3891 of a file with a large header. > # This is line 3892 of a file with a large header. > # This is line 3893 of a file with a large header. > # This is line 3894 of a file with a large header. > # This is line 3895 of a file with a large header. > # This is line 3896 of a file with a large header. > # This is line 3897 of a file with a large header. > # This is line 3898 of a file with a large header. > # This is line 3899 of a file with a large header. > # This is line 3900 of a file with a large header. > # This is line 3901 of a file with a large header. > # This is line 3902 of a file with a large header. > # This is line 3903 of a file with a large header. > # This is line 3904 of a file with a large header. > # This is line 3905 of a file with a large header. > # This is line 3906 of a file with a large header. > # This is line 3907 of a file with a large header. > # This is line 3908 of a file with a large header. > # This is line 3909 of a file with a large header. > # This is line 3910 of a file with a large header. > # This is line 3911 of a file with a large header. > # This is line 3912 of a file with a large header. > # This is line 3913 of a file with a large header. > # This is line 3914 of a file with a large header. > # This is line 3915 of a file with a large header. > # This is line 3916 of a file with a large header. > # This is line 3917 of a file with a large header. > # This is line 3918 of a file with a large header. > # This is line 3919 of a file with a large header. > # This is line 3920 of a file with a large header. > # This is line 3921 of a file with a large header. > # This is line 3922 of a file with a large header. > # This is line 3923 of a file with a large header. > # This is line 3924 of a file with a large header. > # This is line 3925 of a file with a large header. > # This is line 3926 of a file with a large header. > # This is line 3927 of a file with a large header. > # This is line 3928 of a file with a large header. > # This is line 3929 of a file with a large header. > # This is line 3930 of a file with a large header. > # This is line 3931 of a file with a large header. > # This is line 3932 of a file with a large header. > # This is line 3933 of a file with a large header. > # This is line 3934 of a file with a large header. > # This is line 3935 of a file with a large header. > # This is line 3936 of a file with a large header. > # This is line 3937 of a file with a large header. > # This is line 3938 of a file with a large header. > # This is line 3939 of a file with a large header. > # This is line 3940 of a file with a large header. > # This is line 3941 of a file with a large header. > # This is line 3942 of a file with a large header. > # This is line 3943 of a file with a large header. > # This is line 3944 of a file with a large header. > # This is line 3945 of a file with a large header. > # This is line 3946 of a file with a large header. > # This is line 3947 of a file with a large header. > # This is line 3948 of a file with a large header. > # This is line 3949 of a file with a large header. > # This is line 3950 of a file with a large header. > # This is line 3951 of a file with a large header. > # This is line 3952 of a file with a large header. > # This is line 3953 of a file with a large header. > # This is line 3954 of a file with a large header. > # This is line 3955 of a file with a large header. > # This is line 3956 of a file with a large header. > # This is line 3957 of a file with a large header. > # This is line 3958 of a file with a large header. > # This is line 3959 of a file with a large header. > # This is line 3960 of a file with a large header. > # This is line 3961 of a file with a large header. > # This is line 3962 of a file with a large header. > # This is line 3963 of a file with a large header. > # This is line 3964 of a file with a large header. > # This is line 3965 of a file with a large header. > # This is line 3966 of a file with a large header. > # This is line 3967 of a file with a large header. > # This is line 3968 of a file with a large header. > # This is line 3969 of a file with a large header. > # This is line 3970 of a file with a large header. > # This is line 3971 of a file with a large header. > # This is line 3972 of a file with a large header. > # This is line 3973 of a file with a large header. > # This is line 3974 of a file with a large header. > # This is line 3975 of a file with a large header. > # This is line 3976 of a file with a large header. > # This is line 3977 of a file with a large header. > # This is line 3978 of a file with a large header. > # This is line 3979 of a file with a large header. > # This is line 3980 of a file with a large header. > # This is line 3981 of a file with a large header. > # This is line 3982 of a file with a large header. > # This is line 3983 of a file with a large header. > # This is line 3984 of a file with a large header. > # This is line 3985 of a file with a large header. > # This is line 3986 of a file with a large header. > # This is line 3987 of a file with a large header. > # This is line 3988 of a file with a large header. > # This is line 3989 of a file with a large header. > # This is line 3990 of a file with a large header. > # This is line 3991 of a file with a large header. > # This is line 3992 of a file with a large header. > # This is line 3993 of a file with a large header. > # This is line 3994 of a file with a large header. > # This is line 3995 of a file with a large header. > # This is line 3996 of a file with a large header. > # This is line 3997 of a file with a large header. > # This is line 3998 of a file with a large header. > # This is line 3999 of a file with a large header. > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t47...\c 0a1,4002 > # This is line 0 of a file with a large header. > # This is line 1 of a file with a large header. > # This is line 2 of a file with a large header. > # This is line 3 of a file with a large header. > # This is line 4 of a file with a large header. > # This is line 5 of a file with a large header. > # This is line 6 of a file with a large header. > # This is line 7 of a file with a large header. > # This is line 8 of a file with a large header. > # This is line 9 of a file with a large header. > # This is line 10 of a file with a large header. > # This is line 11 of a file with a large header. > # This is line 12 of a file with a large header. > # This is line 13 of a file with a large header. > # This is line 14 of a file with a large header. > # This is line 15 of a file with a large header. > # This is line 16 of a file with a large header. > # This is line 17 of a file with a large header. > # This is line 18 of a file with a large header. > # This is line 19 of a file with a large header. > # This is line 20 of a file with a large header. > # This is line 21 of a file with a large header. > # This is line 22 of a file with a large header. > # This is line 23 of a file with a large header. > # This is line 24 of a file with a large header. > # This is line 25 of a file with a large header. > # This is line 26 of a file with a large header. > # This is line 27 of a file with a large header. > # This is line 28 of a file with a large header. > # This is line 29 of a file with a large header. > # This is line 30 of a file with a large header. > # This is line 31 of a file with a large header. > # This is line 32 of a file with a large header. > # This is line 33 of a file with a large header. > # This is line 34 of a file with a large header. > # This is line 35 of a file with a large header. > # This is line 36 of a file with a large header. > # This is line 37 of a file with a large header. > # This is line 38 of a file with a large header. > # This is line 39 of a file with a large header. > # This is line 40 of a file with a large header. > # This is line 41 of a file with a large header. > # This is line 42 of a file with a large header. > # This is line 43 of a file with a large header. > # This is line 44 of a file with a large header. > # This is line 45 of a file with a large header. > # This is line 46 of a file with a large header. > # This is line 47 of a file with a large header. > # This is line 48 of a file with a large header. > # This is line 49 of a file with a large header. > # This is line 50 of a file with a large header. > # This is line 51 of a file with a large header. > # This is line 52 of a file with a large header. > # This is line 53 of a file with a large header. > # This is line 54 of a file with a large header. > # This is line 55 of a file with a large header. > # This is line 56 of a file with a large header. > # This is line 57 of a file with a large header. > # This is line 58 of a file with a large header. > # This is line 59 of a file with a large header. > # This is line 60 of a file with a large header. > # This is line 61 of a file with a large header. > # This is line 62 of a file with a large header. > # This is line 63 of a file with a large header. > # This is line 64 of a file with a large header. > # This is line 65 of a file with a large header. > # This is line 66 of a file with a large header. > # This is line 67 of a file with a large header. > # This is line 68 of a file with a large header. > # This is line 69 of a file with a large header. > # This is line 70 of a file with a large header. > # This is line 71 of a file with a large header. > # This is line 72 of a file with a large header. > # This is line 73 of a file with a large header. > # This is line 74 of a file with a large header. > # This is line 75 of a file with a large header. > # This is line 76 of a file with a large header. > # This is line 77 of a file with a large header. > # This is line 78 of a file with a large header. > # This is line 79 of a file with a large header. > # This is line 80 of a file with a large header. > # This is line 81 of a file with a large header. > # This is line 82 of a file with a large header. > # This is line 83 of a file with a large header. > # This is line 84 of a file with a large header. > # This is line 85 of a file with a large header. > # This is line 86 of a file with a large header. > # This is line 87 of a file with a large header. > # This is line 88 of a file with a large header. > # This is line 89 of a file with a large header. > # This is line 90 of a file with a large header. > # This is line 91 of a file with a large header. > # This is line 92 of a file with a large header. > # This is line 93 of a file with a large header. > # This is line 94 of a file with a large header. > # This is line 95 of a file with a large header. > # This is line 96 of a file with a large header. > # This is line 97 of a file with a large header. > # This is line 98 of a file with a large header. > # This is line 99 of a file with a large header. > # This is line 100 of a file with a large header. > # This is line 101 of a file with a large header. > # This is line 102 of a file with a large header. > # This is line 103 of a file with a large header. > # This is line 104 of a file with a large header. > # This is line 105 of a file with a large header. > # This is line 106 of a file with a large header. > # This is line 107 of a file with a large header. > # This is line 108 of a file with a large header. > # This is line 109 of a file with a large header. > # This is line 110 of a file with a large header. > # This is line 111 of a file with a large header. > # This is line 112 of a file with a large header. > # This is line 113 of a file with a large header. > # This is line 114 of a file with a large header. > # This is line 115 of a file with a large header. > # This is line 116 of a file with a large header. > # This is line 117 of a file with a large header. > # This is line 118 of a file with a large header. > # This is line 119 of a file with a large header. > # This is line 120 of a file with a large header. > # This is line 121 of a file with a large header. > # This is line 122 of a file with a large header. > # This is line 123 of a file with a large header. > # This is line 124 of a file with a large header. > # This is line 125 of a file with a large header. > # This is line 126 of a file with a large header. > # This is line 127 of a file with a large header. > # This is line 128 of a file with a large header. > # This is line 129 of a file with a large header. > # This is line 130 of a file with a large header. > # This is line 131 of a file with a large header. > # This is line 132 of a file with a large header. > # This is line 133 of a file with a large header. > # This is line 134 of a file with a large header. > # This is line 135 of a file with a large header. > # This is line 136 of a file with a large header. > # This is line 137 of a file with a large header. > # This is line 138 of a file with a large header. > # This is line 139 of a file with a large header. > # This is line 140 of a file with a large header. > # This is line 141 of a file with a large header. > # This is line 142 of a file with a large header. > # This is line 143 of a file with a large header. > # This is line 144 of a file with a large header. > # This is line 145 of a file with a large header. > # This is line 146 of a file with a large header. > # This is line 147 of a file with a large header. > # This is line 148 of a file with a large header. > # This is line 149 of a file with a large header. > # This is line 150 of a file with a large header. > # This is line 151 of a file with a large header. > # This is line 152 of a file with a large header. > # This is line 153 of a file with a large header. > # This is line 154 of a file with a large header. > # This is line 155 of a file with a large header. > # This is line 156 of a file with a large header. > # This is line 157 of a file with a large header. > # This is line 158 of a file with a large header. > # This is line 159 of a file with a large header. > # This is line 160 of a file with a large header. > # This is line 161 of a file with a large header. > # This is line 162 of a file with a large header. > # This is line 163 of a file with a large header. > # This is line 164 of a file with a large header. > # This is line 165 of a file with a large header. > # This is line 166 of a file with a large header. > # This is line 167 of a file with a large header. > # This is line 168 of a file with a large header. > # This is line 169 of a file with a large header. > # This is line 170 of a file with a large header. > # This is line 171 of a file with a large header. > # This is line 172 of a file with a large header. > # This is line 173 of a file with a large header. > # This is line 174 of a file with a large header. > # This is line 175 of a file with a large header. > # This is line 176 of a file with a large header. > # This is line 177 of a file with a large header. > # This is line 178 of a file with a large header. > # This is line 179 of a file with a large header. > # This is line 180 of a file with a large header. > # This is line 181 of a file with a large header. > # This is line 182 of a file with a large header. > # This is line 183 of a file with a large header. > # This is line 184 of a file with a large header. > # This is line 185 of a file with a large header. > # This is line 186 of a file with a large header. > # This is line 187 of a file with a large header. > # This is line 188 of a file with a large header. > # This is line 189 of a file with a large header. > # This is line 190 of a file with a large header. > # This is line 191 of a file with a large header. > # This is line 192 of a file with a large header. > # This is line 193 of a file with a large header. > # This is line 194 of a file with a large header. > # This is line 195 of a file with a large header. > # This is line 196 of a file with a large header. > # This is line 197 of a file with a large header. > # This is line 198 of a file with a large header. > # This is line 199 of a file with a large header. > # This is line 200 of a file with a large header. > # This is line 201 of a file with a large header. > # This is line 202 of a file with a large header. > # This is line 203 of a file with a large header. > # This is line 204 of a file with a large header. > # This is line 205 of a file with a large header. > # This is line 206 of a file with a large header. > # This is line 207 of a file with a large header. > # This is line 208 of a file with a large header. > # This is line 209 of a file with a large header. > # This is line 210 of a file with a large header. > # This is line 211 of a file with a large header. > # This is line 212 of a file with a large header. > # This is line 213 of a file with a large header. > # This is line 214 of a file with a large header. > # This is line 215 of a file with a large header. > # This is line 216 of a file with a large header. > # This is line 217 of a file with a large header. > # This is line 218 of a file with a large header. > # This is line 219 of a file with a large header. > # This is line 220 of a file with a large header. > # This is line 221 of a file with a large header. > # This is line 222 of a file with a large header. > # This is line 223 of a file with a large header. > # This is line 224 of a file with a large header. > # This is line 225 of a file with a large header. > # This is line 226 of a file with a large header. > # This is line 227 of a file with a large header. > # This is line 228 of a file with a large header. > # This is line 229 of a file with a large header. > # This is line 230 of a file with a large header. > # This is line 231 of a file with a large header. > # This is line 232 of a file with a large header. > # This is line 233 of a file with a large header. > # This is line 234 of a file with a large header. > # This is line 235 of a file with a large header. > # This is line 236 of a file with a large header. > # This is line 237 of a file with a large header. > # This is line 238 of a file with a large header. > # This is line 239 of a file with a large header. > # This is line 240 of a file with a large header. > # This is line 241 of a file with a large header. > # This is line 242 of a file with a large header. > # This is line 243 of a file with a large header. > # This is line 244 of a file with a large header. > # This is line 245 of a file with a large header. > # This is line 246 of a file with a large header. > # This is line 247 of a file with a large header. > # This is line 248 of a file with a large header. > # This is line 249 of a file with a large header. > # This is line 250 of a file with a large header. > # This is line 251 of a file with a large header. > # This is line 252 of a file with a large header. > # This is line 253 of a file with a large header. > # This is line 254 of a file with a large header. > # This is line 255 of a file with a large header. > # This is line 256 of a file with a large header. > # This is line 257 of a file with a large header. > # This is line 258 of a file with a large header. > # This is line 259 of a file with a large header. > # This is line 260 of a file with a large header. > # This is line 261 of a file with a large header. > # This is line 262 of a file with a large header. > # This is line 263 of a file with a large header. > # This is line 264 of a file with a large header. > # This is line 265 of a file with a large header. > # This is line 266 of a file with a large header. > # This is line 267 of a file with a large header. > # This is line 268 of a file with a large header. > # This is line 269 of a file with a large header. > # This is line 270 of a file with a large header. > # This is line 271 of a file with a large header. > # This is line 272 of a file with a large header. > # This is line 273 of a file with a large header. > # This is line 274 of a file with a large header. > # This is line 275 of a file with a large header. > # This is line 276 of a file with a large header. > # This is line 277 of a file with a large header. > # This is line 278 of a file with a large header. > # This is line 279 of a file with a large header. > # This is line 280 of a file with a large header. > # This is line 281 of a file with a large header. > # This is line 282 of a file with a large header. > # This is line 283 of a file with a large header. > # This is line 284 of a file with a large header. > # This is line 285 of a file with a large header. > # This is line 286 of a file with a large header. > # This is line 287 of a file with a large header. > # This is line 288 of a file with a large header. > # This is line 289 of a file with a large header. > # This is line 290 of a file with a large header. > # This is line 291 of a file with a large header. > # This is line 292 of a file with a large header. > # This is line 293 of a file with a large header. > # This is line 294 of a file with a large header. > # This is line 295 of a file with a large header. > # This is line 296 of a file with a large header. > # This is line 297 of a file with a large header. > # This is line 298 of a file with a large header. > # This is line 299 of a file with a large header. > # This is line 300 of a file with a large header. > # This is line 301 of a file with a large header. > # This is line 302 of a file with a large header. > # This is line 303 of a file with a large header. > # This is line 304 of a file with a large header. > # This is line 305 of a file with a large header. > # This is line 306 of a file with a large header. > # This is line 307 of a file with a large header. > # This is line 308 of a file with a large header. > # This is line 309 of a file with a large header. > # This is line 310 of a file with a large header. > # This is line 311 of a file with a large header. > # This is line 312 of a file with a large header. > # This is line 313 of a file with a large header. > # This is line 314 of a file with a large header. > # This is line 315 of a file with a large header. > # This is line 316 of a file with a large header. > # This is line 317 of a file with a large header. > # This is line 318 of a file with a large header. > # This is line 319 of a file with a large header. > # This is line 320 of a file with a large header. > # This is line 321 of a file with a large header. > # This is line 322 of a file with a large header. > # This is line 323 of a file with a large header. > # This is line 324 of a file with a large header. > # This is line 325 of a file with a large header. > # This is line 326 of a file with a large header. > # This is line 327 of a file with a large header. > # This is line 328 of a file with a large header. > # This is line 329 of a file with a large header. > # This is line 330 of a file with a large header. > # This is line 331 of a file with a large header. > # This is line 332 of a file with a large header. > # This is line 333 of a file with a large header. > # This is line 334 of a file with a large header. > # This is line 335 of a file with a large header. > # This is line 336 of a file with a large header. > # This is line 337 of a file with a large header. > # This is line 338 of a file with a large header. > # This is line 339 of a file with a large header. > # This is line 340 of a file with a large header. > # This is line 341 of a file with a large header. > # This is line 342 of a file with a large header. > # This is line 343 of a file with a large header. > # This is line 344 of a file with a large header. > # This is line 345 of a file with a large header. > # This is line 346 of a file with a large header. > # This is line 347 of a file with a large header. > # This is line 348 of a file with a large header. > # This is line 349 of a file with a large header. > # This is line 350 of a file with a large header. > # This is line 351 of a file with a large header. > # This is line 352 of a file with a large header. > # This is line 353 of a file with a large header. > # This is line 354 of a file with a large header. > # This is line 355 of a file with a large header. > # This is line 356 of a file with a large header. > # This is line 357 of a file with a large header. > # This is line 358 of a file with a large header. > # This is line 359 of a file with a large header. > # This is line 360 of a file with a large header. > # This is line 361 of a file with a large header. > # This is line 362 of a file with a large header. > # This is line 363 of a file with a large header. > # This is line 364 of a file with a large header. > # This is line 365 of a file with a large header. > # This is line 366 of a file with a large header. > # This is line 367 of a file with a large header. > # This is line 368 of a file with a large header. > # This is line 369 of a file with a large header. > # This is line 370 of a file with a large header. > # This is line 371 of a file with a large header. > # This is line 372 of a file with a large header. > # This is line 373 of a file with a large header. > # This is line 374 of a file with a large header. > # This is line 375 of a file with a large header. > # This is line 376 of a file with a large header. > # This is line 377 of a file with a large header. > # This is line 378 of a file with a large header. > # This is line 379 of a file with a large header. > # This is line 380 of a file with a large header. > # This is line 381 of a file with a large header. > # This is line 382 of a file with a large header. > # This is line 383 of a file with a large header. > # This is line 384 of a file with a large header. > # This is line 385 of a file with a large header. > # This is line 386 of a file with a large header. > # This is line 387 of a file with a large header. > # This is line 388 of a file with a large header. > # This is line 389 of a file with a large header. > # This is line 390 of a file with a large header. > # This is line 391 of a file with a large header. > # This is line 392 of a file with a large header. > # This is line 393 of a file with a large header. > # This is line 394 of a file with a large header. > # This is line 395 of a file with a large header. > # This is line 396 of a file with a large header. > # This is line 397 of a file with a large header. > # This is line 398 of a file with a large header. > # This is line 399 of a file with a large header. > # This is line 400 of a file with a large header. > # This is line 401 of a file with a large header. > # This is line 402 of a file with a large header. > # This is line 403 of a file with a large header. > # This is line 404 of a file with a large header. > # This is line 405 of a file with a large header. > # This is line 406 of a file with a large header. > # This is line 407 of a file with a large header. > # This is line 408 of a file with a large header. > # This is line 409 of a file with a large header. > # This is line 410 of a file with a large header. > # This is line 411 of a file with a large header. > # This is line 412 of a file with a large header. > # This is line 413 of a file with a large header. > # This is line 414 of a file with a large header. > # This is line 415 of a file with a large header. > # This is line 416 of a file with a large header. > # This is line 417 of a file with a large header. > # This is line 418 of a file with a large header. > # This is line 419 of a file with a large header. > # This is line 420 of a file with a large header. > # This is line 421 of a file with a large header. > # This is line 422 of a file with a large header. > # This is line 423 of a file with a large header. > # This is line 424 of a file with a large header. > # This is line 425 of a file with a large header. > # This is line 426 of a file with a large header. > # This is line 427 of a file with a large header. > # This is line 428 of a file with a large header. > # This is line 429 of a file with a large header. > # This is line 430 of a file with a large header. > # This is line 431 of a file with a large header. > # This is line 432 of a file with a large header. > # This is line 433 of a file with a large header. > # This is line 434 of a file with a large header. > # This is line 435 of a file with a large header. > # This is line 436 of a file with a large header. > # This is line 437 of a file with a large header. > # This is line 438 of a file with a large header. > # This is line 439 of a file with a large header. > # This is line 440 of a file with a large header. > # This is line 441 of a file with a large header. > # This is line 442 of a file with a large header. > # This is line 443 of a file with a large header. > # This is line 444 of a file with a large header. > # This is line 445 of a file with a large header. > # This is line 446 of a file with a large header. > # This is line 447 of a file with a large header. > # This is line 448 of a file with a large header. > # This is line 449 of a file with a large header. > # This is line 450 of a file with a large header. > # This is line 451 of a file with a large header. > # This is line 452 of a file with a large header. > # This is line 453 of a file with a large header. > # This is line 454 of a file with a large header. > # This is line 455 of a file with a large header. > # This is line 456 of a file with a large header. > # This is line 457 of a file with a large header. > # This is line 458 of a file with a large header. > # This is line 459 of a file with a large header. > # This is line 460 of a file with a large header. > # This is line 461 of a file with a large header. > # This is line 462 of a file with a large header. > # This is line 463 of a file with a large header. > # This is line 464 of a file with a large header. > # This is line 465 of a file with a large header. > # This is line 466 of a file with a large header. > # This is line 467 of a file with a large header. > # This is line 468 of a file with a large header. > # This is line 469 of a file with a large header. > # This is line 470 of a file with a large header. > # This is line 471 of a file with a large header. > # This is line 472 of a file with a large header. > # This is line 473 of a file with a large header. > # This is line 474 of a file with a large header. > # This is line 475 of a file with a large header. > # This is line 476 of a file with a large header. > # This is line 477 of a file with a large header. > # This is line 478 of a file with a large header. > # This is line 479 of a file with a large header. > # This is line 480 of a file with a large header. > # This is line 481 of a file with a large header. > # This is line 482 of a file with a large header. > # This is line 483 of a file with a large header. > # This is line 484 of a file with a large header. > # This is line 485 of a file with a large header. > # This is line 486 of a file with a large header. > # This is line 487 of a file with a large header. > # This is line 488 of a file with a large header. > # This is line 489 of a file with a large header. > # This is line 490 of a file with a large header. > # This is line 491 of a file with a large header. > # This is line 492 of a file with a large header. > # This is line 493 of a file with a large header. > # This is line 494 of a file with a large header. > # This is line 495 of a file with a large header. > # This is line 496 of a file with a large header. > # This is line 497 of a file with a large header. > # This is line 498 of a file with a large header. > # This is line 499 of a file with a large header. > # This is line 500 of a file with a large header. > # This is line 501 of a file with a large header. > # This is line 502 of a file with a large header. > # This is line 503 of a file with a large header. > # This is line 504 of a file with a large header. > # This is line 505 of a file with a large header. > # This is line 506 of a file with a large header. > # This is line 507 of a file with a large header. > # This is line 508 of a file with a large header. > # This is line 509 of a file with a large header. > # This is line 510 of a file with a large header. > # This is line 511 of a file with a large header. > # This is line 512 of a file with a large header. > # This is line 513 of a file with a large header. > # This is line 514 of a file with a large header. > # This is line 515 of a file with a large header. > # This is line 516 of a file with a large header. > # This is line 517 of a file with a large header. > # This is line 518 of a file with a large header. > # This is line 519 of a file with a large header. > # This is line 520 of a file with a large header. > # This is line 521 of a file with a large header. > # This is line 522 of a file with a large header. > # This is line 523 of a file with a large header. > # This is line 524 of a file with a large header. > # This is line 525 of a file with a large header. > # This is line 526 of a file with a large header. > # This is line 527 of a file with a large header. > # This is line 528 of a file with a large header. > # This is line 529 of a file with a large header. > # This is line 530 of a file with a large header. > # This is line 531 of a file with a large header. > # This is line 532 of a file with a large header. > # This is line 533 of a file with a large header. > # This is line 534 of a file with a large header. > # This is line 535 of a file with a large header. > # This is line 536 of a file with a large header. > # This is line 537 of a file with a large header. > # This is line 538 of a file with a large header. > # This is line 539 of a file with a large header. > # This is line 540 of a file with a large header. > # This is line 541 of a file with a large header. > # This is line 542 of a file with a large header. > # This is line 543 of a file with a large header. > # This is line 544 of a file with a large header. > # This is line 545 of a file with a large header. > # This is line 546 of a file with a large header. > # This is line 547 of a file with a large header. > # This is line 548 of a file with a large header. > # This is line 549 of a file with a large header. > # This is line 550 of a file with a large header. > # This is line 551 of a file with a large header. > # This is line 552 of a file with a large header. > # This is line 553 of a file with a large header. > # This is line 554 of a file with a large header. > # This is line 555 of a file with a large header. > # This is line 556 of a file with a large header. > # This is line 557 of a file with a large header. > # This is line 558 of a file with a large header. > # This is line 559 of a file with a large header. > # This is line 560 of a file with a large header. > # This is line 561 of a file with a large header. > # This is line 562 of a file with a large header. > # This is line 563 of a file with a large header. > # This is line 564 of a file with a large header. > # This is line 565 of a file with a large header. > # This is line 566 of a file with a large header. > # This is line 567 of a file with a large header. > # This is line 568 of a file with a large header. > # This is line 569 of a file with a large header. > # This is line 570 of a file with a large header. > # This is line 571 of a file with a large header. > # This is line 572 of a file with a large header. > # This is line 573 of a file with a large header. > # This is line 574 of a file with a large header. > # This is line 575 of a file with a large header. > # This is line 576 of a file with a large header. > # This is line 577 of a file with a large header. > # This is line 578 of a file with a large header. > # This is line 579 of a file with a large header. > # This is line 580 of a file with a large header. > # This is line 581 of a file with a large header. > # This is line 582 of a file with a large header. > # This is line 583 of a file with a large header. > # This is line 584 of a file with a large header. > # This is line 585 of a file with a large header. > # This is line 586 of a file with a large header. > # This is line 587 of a file with a large header. > # This is line 588 of a file with a large header. > # This is line 589 of a file with a large header. > # This is line 590 of a file with a large header. > # This is line 591 of a file with a large header. > # This is line 592 of a file with a large header. > # This is line 593 of a file with a large header. > # This is line 594 of a file with a large header. > # This is line 595 of a file with a large header. > # This is line 596 of a file with a large header. > # This is line 597 of a file with a large header. > # This is line 598 of a file with a large header. > # This is line 599 of a file with a large header. > # This is line 600 of a file with a large header. > # This is line 601 of a file with a large header. > # This is line 602 of a file with a large header. > # This is line 603 of a file with a large header. > # This is line 604 of a file with a large header. > # This is line 605 of a file with a large header. > # This is line 606 of a file with a large header. > # This is line 607 of a file with a large header. > # This is line 608 of a file with a large header. > # This is line 609 of a file with a large header. > # This is line 610 of a file with a large header. > # This is line 611 of a file with a large header. > # This is line 612 of a file with a large header. > # This is line 613 of a file with a large header. > # This is line 614 of a file with a large header. > # This is line 615 of a file with a large header. > # This is line 616 of a file with a large header. > # This is line 617 of a file with a large header. > # This is line 618 of a file with a large header. > # This is line 619 of a file with a large header. > # This is line 620 of a file with a large header. > # This is line 621 of a file with a large header. > # This is line 622 of a file with a large header. > # This is line 623 of a file with a large header. > # This is line 624 of a file with a large header. > # This is line 625 of a file with a large header. > # This is line 626 of a file with a large header. > # This is line 627 of a file with a large header. > # This is line 628 of a file with a large header. > # This is line 629 of a file with a large header. > # This is line 630 of a file with a large header. > # This is line 631 of a file with a large header. > # This is line 632 of a file with a large header. > # This is line 633 of a file with a large header. > # This is line 634 of a file with a large header. > # This is line 635 of a file with a large header. > # This is line 636 of a file with a large header. > # This is line 637 of a file with a large header. > # This is line 638 of a file with a large header. > # This is line 639 of a file with a large header. > # This is line 640 of a file with a large header. > # This is line 641 of a file with a large header. > # This is line 642 of a file with a large header. > # This is line 643 of a file with a large header. > # This is line 644 of a file with a large header. > # This is line 645 of a file with a large header. > # This is line 646 of a file with a large header. > # This is line 647 of a file with a large header. > # This is line 648 of a file with a large header. > # This is line 649 of a file with a large header. > # This is line 650 of a file with a large header. > # This is line 651 of a file with a large header. > # This is line 652 of a file with a large header. > # This is line 653 of a file with a large header. > # This is line 654 of a file with a large header. > # This is line 655 of a file with a large header. > # This is line 656 of a file with a large header. > # This is line 657 of a file with a large header. > # This is line 658 of a file with a large header. > # This is line 659 of a file with a large header. > # This is line 660 of a file with a large header. > # This is line 661 of a file with a large header. > # This is line 662 of a file with a large header. > # This is line 663 of a file with a large header. > # This is line 664 of a file with a large header. > # This is line 665 of a file with a large header. > # This is line 666 of a file with a large header. > # This is line 667 of a file with a large header. > # This is line 668 of a file with a large header. > # This is line 669 of a file with a large header. > # This is line 670 of a file with a large header. > # This is line 671 of a file with a large header. > # This is line 672 of a file with a large header. > # This is line 673 of a file with a large header. > # This is line 674 of a file with a large header. > # This is line 675 of a file with a large header. > # This is line 676 of a file with a large header. > # This is line 677 of a file with a large header. > # This is line 678 of a file with a large header. > # This is line 679 of a file with a large header. > # This is line 680 of a file with a large header. > # This is line 681 of a file with a large header. > # This is line 682 of a file with a large header. > # This is line 683 of a file with a large header. > # This is line 684 of a file with a large header. > # This is line 685 of a file with a large header. > # This is line 686 of a file with a large header. > # This is line 687 of a file with a large header. > # This is line 688 of a file with a large header. > # This is line 689 of a file with a large header. > # This is line 690 of a file with a large header. > # This is line 691 of a file with a large header. > # This is line 692 of a file with a large header. > # This is line 693 of a file with a large header. > # This is line 694 of a file with a large header. > # This is line 695 of a file with a large header. > # This is line 696 of a file with a large header. > # This is line 697 of a file with a large header. > # This is line 698 of a file with a large header. > # This is line 699 of a file with a large header. > # This is line 700 of a file with a large header. > # This is line 701 of a file with a large header. > # This is line 702 of a file with a large header. > # This is line 703 of a file with a large header. > # This is line 704 of a file with a large header. > # This is line 705 of a file with a large header. > # This is line 706 of a file with a large header. > # This is line 707 of a file with a large header. > # This is line 708 of a file with a large header. > # This is line 709 of a file with a large header. > # This is line 710 of a file with a large header. > # This is line 711 of a file with a large header. > # This is line 712 of a file with a large header. > # This is line 713 of a file with a large header. > # This is line 714 of a file with a large header. > # This is line 715 of a file with a large header. > # This is line 716 of a file with a large header. > # This is line 717 of a file with a large header. > # This is line 718 of a file with a large header. > # This is line 719 of a file with a large header. > # This is line 720 of a file with a large header. > # This is line 721 of a file with a large header. > # This is line 722 of a file with a large header. > # This is line 723 of a file with a large header. > # This is line 724 of a file with a large header. > # This is line 725 of a file with a large header. > # This is line 726 of a file with a large header. > # This is line 727 of a file with a large header. > # This is line 728 of a file with a large header. > # This is line 729 of a file with a large header. > # This is line 730 of a file with a large header. > # This is line 731 of a file with a large header. > # This is line 732 of a file with a large header. > # This is line 733 of a file with a large header. > # This is line 734 of a file with a large header. > # This is line 735 of a file with a large header. > # This is line 736 of a file with a large header. > # This is line 737 of a file with a large header. > # This is line 738 of a file with a large header. > # This is line 739 of a file with a large header. > # This is line 740 of a file with a large header. > # This is line 741 of a file with a large header. > # This is line 742 of a file with a large header. > # This is line 743 of a file with a large header. > # This is line 744 of a file with a large header. > # This is line 745 of a file with a large header. > # This is line 746 of a file with a large header. > # This is line 747 of a file with a large header. > # This is line 748 of a file with a large header. > # This is line 749 of a file with a large header. > # This is line 750 of a file with a large header. > # This is line 751 of a file with a large header. > # This is line 752 of a file with a large header. > # This is line 753 of a file with a large header. > # This is line 754 of a file with a large header. > # This is line 755 of a file with a large header. > # This is line 756 of a file with a large header. > # This is line 757 of a file with a large header. > # This is line 758 of a file with a large header. > # This is line 759 of a file with a large header. > # This is line 760 of a file with a large header. > # This is line 761 of a file with a large header. > # This is line 762 of a file with a large header. > # This is line 763 of a file with a large header. > # This is line 764 of a file with a large header. > # This is line 765 of a file with a large header. > # This is line 766 of a file with a large header. > # This is line 767 of a file with a large header. > # This is line 768 of a file with a large header. > # This is line 769 of a file with a large header. > # This is line 770 of a file with a large header. > # This is line 771 of a file with a large header. > # This is line 772 of a file with a large header. > # This is line 773 of a file with a large header. > # This is line 774 of a file with a large header. > # This is line 775 of a file with a large header. > # This is line 776 of a file with a large header. > # This is line 777 of a file with a large header. > # This is line 778 of a file with a large header. > # This is line 779 of a file with a large header. > # This is line 780 of a file with a large header. > # This is line 781 of a file with a large header. > # This is line 782 of a file with a large header. > # This is line 783 of a file with a large header. > # This is line 784 of a file with a large header. > # This is line 785 of a file with a large header. > # This is line 786 of a file with a large header. > # This is line 787 of a file with a large header. > # This is line 788 of a file with a large header. > # This is line 789 of a file with a large header. > # This is line 790 of a file with a large header. > # This is line 791 of a file with a large header. > # This is line 792 of a file with a large header. > # This is line 793 of a file with a large header. > # This is line 794 of a file with a large header. > # This is line 795 of a file with a large header. > # This is line 796 of a file with a large header. > # This is line 797 of a file with a large header. > # This is line 798 of a file with a large header. > # This is line 799 of a file with a large header. > # This is line 800 of a file with a large header. > # This is line 801 of a file with a large header. > # This is line 802 of a file with a large header. > # This is line 803 of a file with a large header. > # This is line 804 of a file with a large header. > # This is line 805 of a file with a large header. > # This is line 806 of a file with a large header. > # This is line 807 of a file with a large header. > # This is line 808 of a file with a large header. > # This is line 809 of a file with a large header. > # This is line 810 of a file with a large header. > # This is line 811 of a file with a large header. > # This is line 812 of a file with a large header. > # This is line 813 of a file with a large header. > # This is line 814 of a file with a large header. > # This is line 815 of a file with a large header. > # This is line 816 of a file with a large header. > # This is line 817 of a file with a large header. > # This is line 818 of a file with a large header. > # This is line 819 of a file with a large header. > # This is line 820 of a file with a large header. > # This is line 821 of a file with a large header. > # This is line 822 of a file with a large header. > # This is line 823 of a file with a large header. > # This is line 824 of a file with a large header. > # This is line 825 of a file with a large header. > # This is line 826 of a file with a large header. > # This is line 827 of a file with a large header. > # This is line 828 of a file with a large header. > # This is line 829 of a file with a large header. > # This is line 830 of a file with a large header. > # This is line 831 of a file with a large header. > # This is line 832 of a file with a large header. > # This is line 833 of a file with a large header. > # This is line 834 of a file with a large header. > # This is line 835 of a file with a large header. > # This is line 836 of a file with a large header. > # This is line 837 of a file with a large header. > # This is line 838 of a file with a large header. > # This is line 839 of a file with a large header. > # This is line 840 of a file with a large header. > # This is line 841 of a file with a large header. > # This is line 842 of a file with a large header. > # This is line 843 of a file with a large header. > # This is line 844 of a file with a large header. > # This is line 845 of a file with a large header. > # This is line 846 of a file with a large header. > # This is line 847 of a file with a large header. > # This is line 848 of a file with a large header. > # This is line 849 of a file with a large header. > # This is line 850 of a file with a large header. > # This is line 851 of a file with a large header. > # This is line 852 of a file with a large header. > # This is line 853 of a file with a large header. > # This is line 854 of a file with a large header. > # This is line 855 of a file with a large header. > # This is line 856 of a file with a large header. > # This is line 857 of a file with a large header. > # This is line 858 of a file with a large header. > # This is line 859 of a file with a large header. > # This is line 860 of a file with a large header. > # This is line 861 of a file with a large header. > # This is line 862 of a file with a large header. > # This is line 863 of a file with a large header. > # This is line 864 of a file with a large header. > # This is line 865 of a file with a large header. > # This is line 866 of a file with a large header. > # This is line 867 of a file with a large header. > # This is line 868 of a file with a large header. > # This is line 869 of a file with a large header. > # This is line 870 of a file with a large header. > # This is line 871 of a file with a large header. > # This is line 872 of a file with a large header. > # This is line 873 of a file with a large header. > # This is line 874 of a file with a large header. > # This is line 875 of a file with a large header. > # This is line 876 of a file with a large header. > # This is line 877 of a file with a large header. > # This is line 878 of a file with a large header. > # This is line 879 of a file with a large header. > # This is line 880 of a file with a large header. > # This is line 881 of a file with a large header. > # This is line 882 of a file with a large header. > # This is line 883 of a file with a large header. > # This is line 884 of a file with a large header. > # This is line 885 of a file with a large header. > # This is line 886 of a file with a large header. > # This is line 887 of a file with a large header. > # This is line 888 of a file with a large header. > # This is line 889 of a file with a large header. > # This is line 890 of a file with a large header. > # This is line 891 of a file with a large header. > # This is line 892 of a file with a large header. > # This is line 893 of a file with a large header. > # This is line 894 of a file with a large header. > # This is line 895 of a file with a large header. > # This is line 896 of a file with a large header. > # This is line 897 of a file with a large header. > # This is line 898 of a file with a large header. > # This is line 899 of a file with a large header. > # This is line 900 of a file with a large header. > # This is line 901 of a file with a large header. > # This is line 902 of a file with a large header. > # This is line 903 of a file with a large header. > # This is line 904 of a file with a large header. > # This is line 905 of a file with a large header. > # This is line 906 of a file with a large header. > # This is line 907 of a file with a large header. > # This is line 908 of a file with a large header. > # This is line 909 of a file with a large header. > # This is line 910 of a file with a large header. > # This is line 911 of a file with a large header. > # This is line 912 of a file with a large header. > # This is line 913 of a file with a large header. > # This is line 914 of a file with a large header. > # This is line 915 of a file with a large header. > # This is line 916 of a file with a large header. > # This is line 917 of a file with a large header. > # This is line 918 of a file with a large header. > # This is line 919 of a file with a large header. > # This is line 920 of a file with a large header. > # This is line 921 of a file with a large header. > # This is line 922 of a file with a large header. > # This is line 923 of a file with a large header. > # This is line 924 of a file with a large header. > # This is line 925 of a file with a large header. > # This is line 926 of a file with a large header. > # This is line 927 of a file with a large header. > # This is line 928 of a file with a large header. > # This is line 929 of a file with a large header. > # This is line 930 of a file with a large header. > # This is line 931 of a file with a large header. > # This is line 932 of a file with a large header. > # This is line 933 of a file with a large header. > # This is line 934 of a file with a large header. > # This is line 935 of a file with a large header. > # This is line 936 of a file with a large header. > # This is line 937 of a file with a large header. > # This is line 938 of a file with a large header. > # This is line 939 of a file with a large header. > # This is line 940 of a file with a large header. > # This is line 941 of a file with a large header. > # This is line 942 of a file with a large header. > # This is line 943 of a file with a large header. > # This is line 944 of a file with a large header. > # This is line 945 of a file with a large header. > # This is line 946 of a file with a large header. > # This is line 947 of a file with a large header. > # This is line 948 of a file with a large header. > # This is line 949 of a file with a large header. > # This is line 950 of a file with a large header. > # This is line 951 of a file with a large header. > # This is line 952 of a file with a large header. > # This is line 953 of a file with a large header. > # This is line 954 of a file with a large header. > # This is line 955 of a file with a large header. > # This is line 956 of a file with a large header. > # This is line 957 of a file with a large header. > # This is line 958 of a file with a large header. > # This is line 959 of a file with a large header. > # This is line 960 of a file with a large header. > # This is line 961 of a file with a large header. > # This is line 962 of a file with a large header. > # This is line 963 of a file with a large header. > # This is line 964 of a file with a large header. > # This is line 965 of a file with a large header. > # This is line 966 of a file with a large header. > # This is line 967 of a file with a large header. > # This is line 968 of a file with a large header. > # This is line 969 of a file with a large header. > # This is line 970 of a file with a large header. > # This is line 971 of a file with a large header. > # This is line 972 of a file with a large header. > # This is line 973 of a file with a large header. > # This is line 974 of a file with a large header. > # This is line 975 of a file with a large header. > # This is line 976 of a file with a large header. > # This is line 977 of a file with a large header. > # This is line 978 of a file with a large header. > # This is line 979 of a file with a large header. > # This is line 980 of a file with a large header. > # This is line 981 of a file with a large header. > # This is line 982 of a file with a large header. > # This is line 983 of a file with a large header. > # This is line 984 of a file with a large header. > # This is line 985 of a file with a large header. > # This is line 986 of a file with a large header. > # This is line 987 of a file with a large header. > # This is line 988 of a file with a large header. > # This is line 989 of a file with a large header. > # This is line 990 of a file with a large header. > # This is line 991 of a file with a large header. > # This is line 992 of a file with a large header. > # This is line 993 of a file with a large header. > # This is line 994 of a file with a large header. > # This is line 995 of a file with a large header. > # This is line 996 of a file with a large header. > # This is line 997 of a file with a large header. > # This is line 998 of a file with a large header. > # This is line 999 of a file with a large header. > # This is line 1000 of a file with a large header. > # This is line 1001 of a file with a large header. > # This is line 1002 of a file with a large header. > # This is line 1003 of a file with a large header. > # This is line 1004 of a file with a large header. > # This is line 1005 of a file with a large header. > # This is line 1006 of a file with a large header. > # This is line 1007 of a file with a large header. > # This is line 1008 of a file with a large header. > # This is line 1009 of a file with a large header. > # This is line 1010 of a file with a large header. > # This is line 1011 of a file with a large header. > # This is line 1012 of a file with a large header. > # This is line 1013 of a file with a large header. > # This is line 1014 of a file with a large header. > # This is line 1015 of a file with a large header. > # This is line 1016 of a file with a large header. > # This is line 1017 of a file with a large header. > # This is line 1018 of a file with a large header. > # This is line 1019 of a file with a large header. > # This is line 1020 of a file with a large header. > # This is line 1021 of a file with a large header. > # This is line 1022 of a file with a large header. > # This is line 1023 of a file with a large header. > # This is line 1024 of a file with a large header. > # This is line 1025 of a file with a large header. > # This is line 1026 of a file with a large header. > # This is line 1027 of a file with a large header. > # This is line 1028 of a file with a large header. > # This is line 1029 of a file with a large header. > # This is line 1030 of a file with a large header. > # This is line 1031 of a file with a large header. > # This is line 1032 of a file with a large header. > # This is line 1033 of a file with a large header. > # This is line 1034 of a file with a large header. > # This is line 1035 of a file with a large header. > # This is line 1036 of a file with a large header. > # This is line 1037 of a file with a large header. > # This is line 1038 of a file with a large header. > # This is line 1039 of a file with a large header. > # This is line 1040 of a file with a large header. > # This is line 1041 of a file with a large header. > # This is line 1042 of a file with a large header. > # This is line 1043 of a file with a large header. > # This is line 1044 of a file with a large header. > # This is line 1045 of a file with a large header. > # This is line 1046 of a file with a large header. > # This is line 1047 of a file with a large header. > # This is line 1048 of a file with a large header. > # This is line 1049 of a file with a large header. > # This is line 1050 of a file with a large header. > # This is line 1051 of a file with a large header. > # This is line 1052 of a file with a large header. > # This is line 1053 of a file with a large header. > # This is line 1054 of a file with a large header. > # This is line 1055 of a file with a large header. > # This is line 1056 of a file with a large header. > # This is line 1057 of a file with a large header. > # This is line 1058 of a file with a large header. > # This is line 1059 of a file with a large header. > # This is line 1060 of a file with a large header. > # This is line 1061 of a file with a large header. > # This is line 1062 of a file with a large header. > # This is line 1063 of a file with a large header. > # This is line 1064 of a file with a large header. > # This is line 1065 of a file with a large header. > # This is line 1066 of a file with a large header. > # This is line 1067 of a file with a large header. > # This is line 1068 of a file with a large header. > # This is line 1069 of a file with a large header. > # This is line 1070 of a file with a large header. > # This is line 1071 of a file with a large header. > # This is line 1072 of a file with a large header. > # This is line 1073 of a file with a large header. > # This is line 1074 of a file with a large header. > # This is line 1075 of a file with a large header. > # This is line 1076 of a file with a large header. > # This is line 1077 of a file with a large header. > # This is line 1078 of a file with a large header. > # This is line 1079 of a file with a large header. > # This is line 1080 of a file with a large header. > # This is line 1081 of a file with a large header. > # This is line 1082 of a file with a large header. > # This is line 1083 of a file with a large header. > # This is line 1084 of a file with a large header. > # This is line 1085 of a file with a large header. > # This is line 1086 of a file with a large header. > # This is line 1087 of a file with a large header. > # This is line 1088 of a file with a large header. > # This is line 1089 of a file with a large header. > # This is line 1090 of a file with a large header. > # This is line 1091 of a file with a large header. > # This is line 1092 of a file with a large header. > # This is line 1093 of a file with a large header. > # This is line 1094 of a file with a large header. > # This is line 1095 of a file with a large header. > # This is line 1096 of a file with a large header. > # This is line 1097 of a file with a large header. > # This is line 1098 of a file with a large header. > # This is line 1099 of a file with a large header. > # This is line 1100 of a file with a large header. > # This is line 1101 of a file with a large header. > # This is line 1102 of a file with a large header. > # This is line 1103 of a file with a large header. > # This is line 1104 of a file with a large header. > # This is line 1105 of a file with a large header. > # This is line 1106 of a file with a large header. > # This is line 1107 of a file with a large header. > # This is line 1108 of a file with a large header. > # This is line 1109 of a file with a large header. > # This is line 1110 of a file with a large header. > # This is line 1111 of a file with a large header. > # This is line 1112 of a file with a large header. > # This is line 1113 of a file with a large header. > # This is line 1114 of a file with a large header. > # This is line 1115 of a file with a large header. > # This is line 1116 of a file with a large header. > # This is line 1117 of a file with a large header. > # This is line 1118 of a file with a large header. > # This is line 1119 of a file with a large header. > # This is line 1120 of a file with a large header. > # This is line 1121 of a file with a large header. > # This is line 1122 of a file with a large header. > # This is line 1123 of a file with a large header. > # This is line 1124 of a file with a large header. > # This is line 1125 of a file with a large header. > # This is line 1126 of a file with a large header. > # This is line 1127 of a file with a large header. > # This is line 1128 of a file with a large header. > # This is line 1129 of a file with a large header. > # This is line 1130 of a file with a large header. > # This is line 1131 of a file with a large header. > # This is line 1132 of a file with a large header. > # This is line 1133 of a file with a large header. > # This is line 1134 of a file with a large header. > # This is line 1135 of a file with a large header. > # This is line 1136 of a file with a large header. > # This is line 1137 of a file with a large header. > # This is line 1138 of a file with a large header. > # This is line 1139 of a file with a large header. > # This is line 1140 of a file with a large header. > # This is line 1141 of a file with a large header. > # This is line 1142 of a file with a large header. > # This is line 1143 of a file with a large header. > # This is line 1144 of a file with a large header. > # This is line 1145 of a file with a large header. > # This is line 1146 of a file with a large header. > # This is line 1147 of a file with a large header. > # This is line 1148 of a file with a large header. > # This is line 1149 of a file with a large header. > # This is line 1150 of a file with a large header. > # This is line 1151 of a file with a large header. > # This is line 1152 of a file with a large header. > # This is line 1153 of a file with a large header. > # This is line 1154 of a file with a large header. > # This is line 1155 of a file with a large header. > # This is line 1156 of a file with a large header. > # This is line 1157 of a file with a large header. > # This is line 1158 of a file with a large header. > # This is line 1159 of a file with a large header. > # This is line 1160 of a file with a large header. > # This is line 1161 of a file with a large header. > # This is line 1162 of a file with a large header. > # This is line 1163 of a file with a large header. > # This is line 1164 of a file with a large header. > # This is line 1165 of a file with a large header. > # This is line 1166 of a file with a large header. > # This is line 1167 of a file with a large header. > # This is line 1168 of a file with a large header. > # This is line 1169 of a file with a large header. > # This is line 1170 of a file with a large header. > # This is line 1171 of a file with a large header. > # This is line 1172 of a file with a large header. > # This is line 1173 of a file with a large header. > # This is line 1174 of a file with a large header. > # This is line 1175 of a file with a large header. > # This is line 1176 of a file with a large header. > # This is line 1177 of a file with a large header. > # This is line 1178 of a file with a large header. > # This is line 1179 of a file with a large header. > # This is line 1180 of a file with a large header. > # This is line 1181 of a file with a large header. > # This is line 1182 of a file with a large header. > # This is line 1183 of a file with a large header. > # This is line 1184 of a file with a large header. > # This is line 1185 of a file with a large header. > # This is line 1186 of a file with a large header. > # This is line 1187 of a file with a large header. > # This is line 1188 of a file with a large header. > # This is line 1189 of a file with a large header. > # This is line 1190 of a file with a large header. > # This is line 1191 of a file with a large header. > # This is line 1192 of a file with a large header. > # This is line 1193 of a file with a large header. > # This is line 1194 of a file with a large header. > # This is line 1195 of a file with a large header. > # This is line 1196 of a file with a large header. > # This is line 1197 of a file with a large header. > # This is line 1198 of a file with a large header. > # This is line 1199 of a file with a large header. > # This is line 1200 of a file with a large header. > # This is line 1201 of a file with a large header. > # This is line 1202 of a file with a large header. > # This is line 1203 of a file with a large header. > # This is line 1204 of a file with a large header. > # This is line 1205 of a file with a large header. > # This is line 1206 of a file with a large header. > # This is line 1207 of a file with a large header. > # This is line 1208 of a file with a large header. > # This is line 1209 of a file with a large header. > # This is line 1210 of a file with a large header. > # This is line 1211 of a file with a large header. > # This is line 1212 of a file with a large header. > # This is line 1213 of a file with a large header. > # This is line 1214 of a file with a large header. > # This is line 1215 of a file with a large header. > # This is line 1216 of a file with a large header. > # This is line 1217 of a file with a large header. > # This is line 1218 of a file with a large header. > # This is line 1219 of a file with a large header. > # This is line 1220 of a file with a large header. > # This is line 1221 of a file with a large header. > # This is line 1222 of a file with a large header. > # This is line 1223 of a file with a large header. > # This is line 1224 of a file with a large header. > # This is line 1225 of a file with a large header. > # This is line 1226 of a file with a large header. > # This is line 1227 of a file with a large header. > # This is line 1228 of a file with a large header. > # This is line 1229 of a file with a large header. > # This is line 1230 of a file with a large header. > # This is line 1231 of a file with a large header. > # This is line 1232 of a file with a large header. > # This is line 1233 of a file with a large header. > # This is line 1234 of a file with a large header. > # This is line 1235 of a file with a large header. > # This is line 1236 of a file with a large header. > # This is line 1237 of a file with a large header. > # This is line 1238 of a file with a large header. > # This is line 1239 of a file with a large header. > # This is line 1240 of a file with a large header. > # This is line 1241 of a file with a large header. > # This is line 1242 of a file with a large header. > # This is line 1243 of a file with a large header. > # This is line 1244 of a file with a large header. > # This is line 1245 of a file with a large header. > # This is line 1246 of a file with a large header. > # This is line 1247 of a file with a large header. > # This is line 1248 of a file with a large header. > # This is line 1249 of a file with a large header. > # This is line 1250 of a file with a large header. > # This is line 1251 of a file with a large header. > # This is line 1252 of a file with a large header. > # This is line 1253 of a file with a large header. > # This is line 1254 of a file with a large header. > # This is line 1255 of a file with a large header. > # This is line 1256 of a file with a large header. > # This is line 1257 of a file with a large header. > # This is line 1258 of a file with a large header. > # This is line 1259 of a file with a large header. > # This is line 1260 of a file with a large header. > # This is line 1261 of a file with a large header. > # This is line 1262 of a file with a large header. > # This is line 1263 of a file with a large header. > # This is line 1264 of a file with a large header. > # This is line 1265 of a file with a large header. > # This is line 1266 of a file with a large header. > # This is line 1267 of a file with a large header. > # This is line 1268 of a file with a large header. > # This is line 1269 of a file with a large header. > # This is line 1270 of a file with a large header. > # This is line 1271 of a file with a large header. > # This is line 1272 of a file with a large header. > # This is line 1273 of a file with a large header. > # This is line 1274 of a file with a large header. > # This is line 1275 of a file with a large header. > # This is line 1276 of a file with a large header. > # This is line 1277 of a file with a large header. > # This is line 1278 of a file with a large header. > # This is line 1279 of a file with a large header. > # This is line 1280 of a file with a large header. > # This is line 1281 of a file with a large header. > # This is line 1282 of a file with a large header. > # This is line 1283 of a file with a large header. > # This is line 1284 of a file with a large header. > # This is line 1285 of a file with a large header. > # This is line 1286 of a file with a large header. > # This is line 1287 of a file with a large header. > # This is line 1288 of a file with a large header. > # This is line 1289 of a file with a large header. > # This is line 1290 of a file with a large header. > # This is line 1291 of a file with a large header. > # This is line 1292 of a file with a large header. > # This is line 1293 of a file with a large header. > # This is line 1294 of a file with a large header. > # This is line 1295 of a file with a large header. > # This is line 1296 of a file with a large header. > # This is line 1297 of a file with a large header. > # This is line 1298 of a file with a large header. > # This is line 1299 of a file with a large header. > # This is line 1300 of a file with a large header. > # This is line 1301 of a file with a large header. > # This is line 1302 of a file with a large header. > # This is line 1303 of a file with a large header. > # This is line 1304 of a file with a large header. > # This is line 1305 of a file with a large header. > # This is line 1306 of a file with a large header. > # This is line 1307 of a file with a large header. > # This is line 1308 of a file with a large header. > # This is line 1309 of a file with a large header. > # This is line 1310 of a file with a large header. > # This is line 1311 of a file with a large header. > # This is line 1312 of a file with a large header. > # This is line 1313 of a file with a large header. > # This is line 1314 of a file with a large header. > # This is line 1315 of a file with a large header. > # This is line 1316 of a file with a large header. > # This is line 1317 of a file with a large header. > # This is line 1318 of a file with a large header. > # This is line 1319 of a file with a large header. > # This is line 1320 of a file with a large header. > # This is line 1321 of a file with a large header. > # This is line 1322 of a file with a large header. > # This is line 1323 of a file with a large header. > # This is line 1324 of a file with a large header. > # This is line 1325 of a file with a large header. > # This is line 1326 of a file with a large header. > # This is line 1327 of a file with a large header. > # This is line 1328 of a file with a large header. > # This is line 1329 of a file with a large header. > # This is line 1330 of a file with a large header. > # This is line 1331 of a file with a large header. > # This is line 1332 of a file with a large header. > # This is line 1333 of a file with a large header. > # This is line 1334 of a file with a large header. > # This is line 1335 of a file with a large header. > # This is line 1336 of a file with a large header. > # This is line 1337 of a file with a large header. > # This is line 1338 of a file with a large header. > # This is line 1339 of a file with a large header. > # This is line 1340 of a file with a large header. > # This is line 1341 of a file with a large header. > # This is line 1342 of a file with a large header. > # This is line 1343 of a file with a large header. > # This is line 1344 of a file with a large header. > # This is line 1345 of a file with a large header. > # This is line 1346 of a file with a large header. > # This is line 1347 of a file with a large header. > # This is line 1348 of a file with a large header. > # This is line 1349 of a file with a large header. > # This is line 1350 of a file with a large header. > # This is line 1351 of a file with a large header. > # This is line 1352 of a file with a large header. > # This is line 1353 of a file with a large header. > # This is line 1354 of a file with a large header. > # This is line 1355 of a file with a large header. > # This is line 1356 of a file with a large header. > # This is line 1357 of a file with a large header. > # This is line 1358 of a file with a large header. > # This is line 1359 of a file with a large header. > # This is line 1360 of a file with a large header. > # This is line 1361 of a file with a large header. > # This is line 1362 of a file with a large header. > # This is line 1363 of a file with a large header. > # This is line 1364 of a file with a large header. > # This is line 1365 of a file with a large header. > # This is line 1366 of a file with a large header. > # This is line 1367 of a file with a large header. > # This is line 1368 of a file with a large header. > # This is line 1369 of a file with a large header. > # This is line 1370 of a file with a large header. > # This is line 1371 of a file with a large header. > # This is line 1372 of a file with a large header. > # This is line 1373 of a file with a large header. > # This is line 1374 of a file with a large header. > # This is line 1375 of a file with a large header. > # This is line 1376 of a file with a large header. > # This is line 1377 of a file with a large header. > # This is line 1378 of a file with a large header. > # This is line 1379 of a file with a large header. > # This is line 1380 of a file with a large header. > # This is line 1381 of a file with a large header. > # This is line 1382 of a file with a large header. > # This is line 1383 of a file with a large header. > # This is line 1384 of a file with a large header. > # This is line 1385 of a file with a large header. > # This is line 1386 of a file with a large header. > # This is line 1387 of a file with a large header. > # This is line 1388 of a file with a large header. > # This is line 1389 of a file with a large header. > # This is line 1390 of a file with a large header. > # This is line 1391 of a file with a large header. > # This is line 1392 of a file with a large header. > # This is line 1393 of a file with a large header. > # This is line 1394 of a file with a large header. > # This is line 1395 of a file with a large header. > # This is line 1396 of a file with a large header. > # This is line 1397 of a file with a large header. > # This is line 1398 of a file with a large header. > # This is line 1399 of a file with a large header. > # This is line 1400 of a file with a large header. > # This is line 1401 of a file with a large header. > # This is line 1402 of a file with a large header. > # This is line 1403 of a file with a large header. > # This is line 1404 of a file with a large header. > # This is line 1405 of a file with a large header. > # This is line 1406 of a file with a large header. > # This is line 1407 of a file with a large header. > # This is line 1408 of a file with a large header. > # This is line 1409 of a file with a large header. > # This is line 1410 of a file with a large header. > # This is line 1411 of a file with a large header. > # This is line 1412 of a file with a large header. > # This is line 1413 of a file with a large header. > # This is line 1414 of a file with a large header. > # This is line 1415 of a file with a large header. > # This is line 1416 of a file with a large header. > # This is line 1417 of a file with a large header. > # This is line 1418 of a file with a large header. > # This is line 1419 of a file with a large header. > # This is line 1420 of a file with a large header. > # This is line 1421 of a file with a large header. > # This is line 1422 of a file with a large header. > # This is line 1423 of a file with a large header. > # This is line 1424 of a file with a large header. > # This is line 1425 of a file with a large header. > # This is line 1426 of a file with a large header. > # This is line 1427 of a file with a large header. > # This is line 1428 of a file with a large header. > # This is line 1429 of a file with a large header. > # This is line 1430 of a file with a large header. > # This is line 1431 of a file with a large header. > # This is line 1432 of a file with a large header. > # This is line 1433 of a file with a large header. > # This is line 1434 of a file with a large header. > # This is line 1435 of a file with a large header. > # This is line 1436 of a file with a large header. > # This is line 1437 of a file with a large header. > # This is line 1438 of a file with a large header. > # This is line 1439 of a file with a large header. > # This is line 1440 of a file with a large header. > # This is line 1441 of a file with a large header. > # This is line 1442 of a file with a large header. > # This is line 1443 of a file with a large header. > # This is line 1444 of a file with a large header. > # This is line 1445 of a file with a large header. > # This is line 1446 of a file with a large header. > # This is line 1447 of a file with a large header. > # This is line 1448 of a file with a large header. > # This is line 1449 of a file with a large header. > # This is line 1450 of a file with a large header. > # This is line 1451 of a file with a large header. > # This is line 1452 of a file with a large header. > # This is line 1453 of a file with a large header. > # This is line 1454 of a file with a large header. > # This is line 1455 of a file with a large header. > # This is line 1456 of a file with a large header. > # This is line 1457 of a file with a large header. > # This is line 1458 of a file with a large header. > # This is line 1459 of a file with a large header. > # This is line 1460 of a file with a large header. > # This is line 1461 of a file with a large header. > # This is line 1462 of a file with a large header. > # This is line 1463 of a file with a large header. > # This is line 1464 of a file with a large header. > # This is line 1465 of a file with a large header. > # This is line 1466 of a file with a large header. > # This is line 1467 of a file with a large header. > # This is line 1468 of a file with a large header. > # This is line 1469 of a file with a large header. > # This is line 1470 of a file with a large header. > # This is line 1471 of a file with a large header. > # This is line 1472 of a file with a large header. > # This is line 1473 of a file with a large header. > # This is line 1474 of a file with a large header. > # This is line 1475 of a file with a large header. > # This is line 1476 of a file with a large header. > # This is line 1477 of a file with a large header. > # This is line 1478 of a file with a large header. > # This is line 1479 of a file with a large header. > # This is line 1480 of a file with a large header. > # This is line 1481 of a file with a large header. > # This is line 1482 of a file with a large header. > # This is line 1483 of a file with a large header. > # This is line 1484 of a file with a large header. > # This is line 1485 of a file with a large header. > # This is line 1486 of a file with a large header. > # This is line 1487 of a file with a large header. > # This is line 1488 of a file with a large header. > # This is line 1489 of a file with a large header. > # This is line 1490 of a file with a large header. > # This is line 1491 of a file with a large header. > # This is line 1492 of a file with a large header. > # This is line 1493 of a file with a large header. > # This is line 1494 of a file with a large header. > # This is line 1495 of a file with a large header. > # This is line 1496 of a file with a large header. > # This is line 1497 of a file with a large header. > # This is line 1498 of a file with a large header. > # This is line 1499 of a file with a large header. > # This is line 1500 of a file with a large header. > # This is line 1501 of a file with a large header. > # This is line 1502 of a file with a large header. > # This is line 1503 of a file with a large header. > # This is line 1504 of a file with a large header. > # This is line 1505 of a file with a large header. > # This is line 1506 of a file with a large header. > # This is line 1507 of a file with a large header. > # This is line 1508 of a file with a large header. > # This is line 1509 of a file with a large header. > # This is line 1510 of a file with a large header. > # This is line 1511 of a file with a large header. > # This is line 1512 of a file with a large header. > # This is line 1513 of a file with a large header. > # This is line 1514 of a file with a large header. > # This is line 1515 of a file with a large header. > # This is line 1516 of a file with a large header. > # This is line 1517 of a file with a large header. > # This is line 1518 of a file with a large header. > # This is line 1519 of a file with a large header. > # This is line 1520 of a file with a large header. > # This is line 1521 of a file with a large header. > # This is line 1522 of a file with a large header. > # This is line 1523 of a file with a large header. > # This is line 1524 of a file with a large header. > # This is line 1525 of a file with a large header. > # This is line 1526 of a file with a large header. > # This is line 1527 of a file with a large header. > # This is line 1528 of a file with a large header. > # This is line 1529 of a file with a large header. > # This is line 1530 of a file with a large header. > # This is line 1531 of a file with a large header. > # This is line 1532 of a file with a large header. > # This is line 1533 of a file with a large header. > # This is line 1534 of a file with a large header. > # This is line 1535 of a file with a large header. > # This is line 1536 of a file with a large header. > # This is line 1537 of a file with a large header. > # This is line 1538 of a file with a large header. > # This is line 1539 of a file with a large header. > # This is line 1540 of a file with a large header. > # This is line 1541 of a file with a large header. > # This is line 1542 of a file with a large header. > # This is line 1543 of a file with a large header. > # This is line 1544 of a file with a large header. > # This is line 1545 of a file with a large header. > # This is line 1546 of a file with a large header. > # This is line 1547 of a file with a large header. > # This is line 1548 of a file with a large header. > # This is line 1549 of a file with a large header. > # This is line 1550 of a file with a large header. > # This is line 1551 of a file with a large header. > # This is line 1552 of a file with a large header. > # This is line 1553 of a file with a large header. > # This is line 1554 of a file with a large header. > # This is line 1555 of a file with a large header. > # This is line 1556 of a file with a large header. > # This is line 1557 of a file with a large header. > # This is line 1558 of a file with a large header. > # This is line 1559 of a file with a large header. > # This is line 1560 of a file with a large header. > # This is line 1561 of a file with a large header. > # This is line 1562 of a file with a large header. > # This is line 1563 of a file with a large header. > # This is line 1564 of a file with a large header. > # This is line 1565 of a file with a large header. > # This is line 1566 of a file with a large header. > # This is line 1567 of a file with a large header. > # This is line 1568 of a file with a large header. > # This is line 1569 of a file with a large header. > # This is line 1570 of a file with a large header. > # This is line 1571 of a file with a large header. > # This is line 1572 of a file with a large header. > # This is line 1573 of a file with a large header. > # This is line 1574 of a file with a large header. > # This is line 1575 of a file with a large header. > # This is line 1576 of a file with a large header. > # This is line 1577 of a file with a large header. > # This is line 1578 of a file with a large header. > # This is line 1579 of a file with a large header. > # This is line 1580 of a file with a large header. > # This is line 1581 of a file with a large header. > # This is line 1582 of a file with a large header. > # This is line 1583 of a file with a large header. > # This is line 1584 of a file with a large header. > # This is line 1585 of a file with a large header. > # This is line 1586 of a file with a large header. > # This is line 1587 of a file with a large header. > # This is line 1588 of a file with a large header. > # This is line 1589 of a file with a large header. > # This is line 1590 of a file with a large header. > # This is line 1591 of a file with a large header. > # This is line 1592 of a file with a large header. > # This is line 1593 of a file with a large header. > # This is line 1594 of a file with a large header. > # This is line 1595 of a file with a large header. > # This is line 1596 of a file with a large header. > # This is line 1597 of a file with a large header. > # This is line 1598 of a file with a large header. > # This is line 1599 of a file with a large header. > # This is line 1600 of a file with a large header. > # This is line 1601 of a file with a large header. > # This is line 1602 of a file with a large header. > # This is line 1603 of a file with a large header. > # This is line 1604 of a file with a large header. > # This is line 1605 of a file with a large header. > # This is line 1606 of a file with a large header. > # This is line 1607 of a file with a large header. > # This is line 1608 of a file with a large header. > # This is line 1609 of a file with a large header. > # This is line 1610 of a file with a large header. > # This is line 1611 of a file with a large header. > # This is line 1612 of a file with a large header. > # This is line 1613 of a file with a large header. > # This is line 1614 of a file with a large header. > # This is line 1615 of a file with a large header. > # This is line 1616 of a file with a large header. > # This is line 1617 of a file with a large header. > # This is line 1618 of a file with a large header. > # This is line 1619 of a file with a large header. > # This is line 1620 of a file with a large header. > # This is line 1621 of a file with a large header. > # This is line 1622 of a file with a large header. > # This is line 1623 of a file with a large header. > # This is line 1624 of a file with a large header. > # This is line 1625 of a file with a large header. > # This is line 1626 of a file with a large header. > # This is line 1627 of a file with a large header. > # This is line 1628 of a file with a large header. > # This is line 1629 of a file with a large header. > # This is line 1630 of a file with a large header. > # This is line 1631 of a file with a large header. > # This is line 1632 of a file with a large header. > # This is line 1633 of a file with a large header. > # This is line 1634 of a file with a large header. > # This is line 1635 of a file with a large header. > # This is line 1636 of a file with a large header. > # This is line 1637 of a file with a large header. > # This is line 1638 of a file with a large header. > # This is line 1639 of a file with a large header. > # This is line 1640 of a file with a large header. > # This is line 1641 of a file with a large header. > # This is line 1642 of a file with a large header. > # This is line 1643 of a file with a large header. > # This is line 1644 of a file with a large header. > # This is line 1645 of a file with a large header. > # This is line 1646 of a file with a large header. > # This is line 1647 of a file with a large header. > # This is line 1648 of a file with a large header. > # This is line 1649 of a file with a large header. > # This is line 1650 of a file with a large header. > # This is line 1651 of a file with a large header. > # This is line 1652 of a file with a large header. > # This is line 1653 of a file with a large header. > # This is line 1654 of a file with a large header. > # This is line 1655 of a file with a large header. > # This is line 1656 of a file with a large header. > # This is line 1657 of a file with a large header. > # This is line 1658 of a file with a large header. > # This is line 1659 of a file with a large header. > # This is line 1660 of a file with a large header. > # This is line 1661 of a file with a large header. > # This is line 1662 of a file with a large header. > # This is line 1663 of a file with a large header. > # This is line 1664 of a file with a large header. > # This is line 1665 of a file with a large header. > # This is line 1666 of a file with a large header. > # This is line 1667 of a file with a large header. > # This is line 1668 of a file with a large header. > # This is line 1669 of a file with a large header. > # This is line 1670 of a file with a large header. > # This is line 1671 of a file with a large header. > # This is line 1672 of a file with a large header. > # This is line 1673 of a file with a large header. > # This is line 1674 of a file with a large header. > # This is line 1675 of a file with a large header. > # This is line 1676 of a file with a large header. > # This is line 1677 of a file with a large header. > # This is line 1678 of a file with a large header. > # This is line 1679 of a file with a large header. > # This is line 1680 of a file with a large header. > # This is line 1681 of a file with a large header. > # This is line 1682 of a file with a large header. > # This is line 1683 of a file with a large header. > # This is line 1684 of a file with a large header. > # This is line 1685 of a file with a large header. > # This is line 1686 of a file with a large header. > # This is line 1687 of a file with a large header. > # This is line 1688 of a file with a large header. > # This is line 1689 of a file with a large header. > # This is line 1690 of a file with a large header. > # This is line 1691 of a file with a large header. > # This is line 1692 of a file with a large header. > # This is line 1693 of a file with a large header. > # This is line 1694 of a file with a large header. > # This is line 1695 of a file with a large header. > # This is line 1696 of a file with a large header. > # This is line 1697 of a file with a large header. > # This is line 1698 of a file with a large header. > # This is line 1699 of a file with a large header. > # This is line 1700 of a file with a large header. > # This is line 1701 of a file with a large header. > # This is line 1702 of a file with a large header. > # This is line 1703 of a file with a large header. > # This is line 1704 of a file with a large header. > # This is line 1705 of a file with a large header. > # This is line 1706 of a file with a large header. > # This is line 1707 of a file with a large header. > # This is line 1708 of a file with a large header. > # This is line 1709 of a file with a large header. > # This is line 1710 of a file with a large header. > # This is line 1711 of a file with a large header. > # This is line 1712 of a file with a large header. > # This is line 1713 of a file with a large header. > # This is line 1714 of a file with a large header. > # This is line 1715 of a file with a large header. > # This is line 1716 of a file with a large header. > # This is line 1717 of a file with a large header. > # This is line 1718 of a file with a large header. > # This is line 1719 of a file with a large header. > # This is line 1720 of a file with a large header. > # This is line 1721 of a file with a large header. > # This is line 1722 of a file with a large header. > # This is line 1723 of a file with a large header. > # This is line 1724 of a file with a large header. > # This is line 1725 of a file with a large header. > # This is line 1726 of a file with a large header. > # This is line 1727 of a file with a large header. > # This is line 1728 of a file with a large header. > # This is line 1729 of a file with a large header. > # This is line 1730 of a file with a large header. > # This is line 1731 of a file with a large header. > # This is line 1732 of a file with a large header. > # This is line 1733 of a file with a large header. > # This is line 1734 of a file with a large header. > # This is line 1735 of a file with a large header. > # This is line 1736 of a file with a large header. > # This is line 1737 of a file with a large header. > # This is line 1738 of a file with a large header. > # This is line 1739 of a file with a large header. > # This is line 1740 of a file with a large header. > # This is line 1741 of a file with a large header. > # This is line 1742 of a file with a large header. > # This is line 1743 of a file with a large header. > # This is line 1744 of a file with a large header. > # This is line 1745 of a file with a large header. > # This is line 1746 of a file with a large header. > # This is line 1747 of a file with a large header. > # This is line 1748 of a file with a large header. > # This is line 1749 of a file with a large header. > # This is line 1750 of a file with a large header. > # This is line 1751 of a file with a large header. > # This is line 1752 of a file with a large header. > # This is line 1753 of a file with a large header. > # This is line 1754 of a file with a large header. > # This is line 1755 of a file with a large header. > # This is line 1756 of a file with a large header. > # This is line 1757 of a file with a large header. > # This is line 1758 of a file with a large header. > # This is line 1759 of a file with a large header. > # This is line 1760 of a file with a large header. > # This is line 1761 of a file with a large header. > # This is line 1762 of a file with a large header. > # This is line 1763 of a file with a large header. > # This is line 1764 of a file with a large header. > # This is line 1765 of a file with a large header. > # This is line 1766 of a file with a large header. > # This is line 1767 of a file with a large header. > # This is line 1768 of a file with a large header. > # This is line 1769 of a file with a large header. > # This is line 1770 of a file with a large header. > # This is line 1771 of a file with a large header. > # This is line 1772 of a file with a large header. > # This is line 1773 of a file with a large header. > # This is line 1774 of a file with a large header. > # This is line 1775 of a file with a large header. > # This is line 1776 of a file with a large header. > # This is line 1777 of a file with a large header. > # This is line 1778 of a file with a large header. > # This is line 1779 of a file with a large header. > # This is line 1780 of a file with a large header. > # This is line 1781 of a file with a large header. > # This is line 1782 of a file with a large header. > # This is line 1783 of a file with a large header. > # This is line 1784 of a file with a large header. > # This is line 1785 of a file with a large header. > # This is line 1786 of a file with a large header. > # This is line 1787 of a file with a large header. > # This is line 1788 of a file with a large header. > # This is line 1789 of a file with a large header. > # This is line 1790 of a file with a large header. > # This is line 1791 of a file with a large header. > # This is line 1792 of a file with a large header. > # This is line 1793 of a file with a large header. > # This is line 1794 of a file with a large header. > # This is line 1795 of a file with a large header. > # This is line 1796 of a file with a large header. > # This is line 1797 of a file with a large header. > # This is line 1798 of a file with a large header. > # This is line 1799 of a file with a large header. > # This is line 1800 of a file with a large header. > # This is line 1801 of a file with a large header. > # This is line 1802 of a file with a large header. > # This is line 1803 of a file with a large header. > # This is line 1804 of a file with a large header. > # This is line 1805 of a file with a large header. > # This is line 1806 of a file with a large header. > # This is line 1807 of a file with a large header. > # This is line 1808 of a file with a large header. > # This is line 1809 of a file with a large header. > # This is line 1810 of a file with a large header. > # This is line 1811 of a file with a large header. > # This is line 1812 of a file with a large header. > # This is line 1813 of a file with a large header. > # This is line 1814 of a file with a large header. > # This is line 1815 of a file with a large header. > # This is line 1816 of a file with a large header. > # This is line 1817 of a file with a large header. > # This is line 1818 of a file with a large header. > # This is line 1819 of a file with a large header. > # This is line 1820 of a file with a large header. > # This is line 1821 of a file with a large header. > # This is line 1822 of a file with a large header. > # This is line 1823 of a file with a large header. > # This is line 1824 of a file with a large header. > # This is line 1825 of a file with a large header. > # This is line 1826 of a file with a large header. > # This is line 1827 of a file with a large header. > # This is line 1828 of a file with a large header. > # This is line 1829 of a file with a large header. > # This is line 1830 of a file with a large header. > # This is line 1831 of a file with a large header. > # This is line 1832 of a file with a large header. > # This is line 1833 of a file with a large header. > # This is line 1834 of a file with a large header. > # This is line 1835 of a file with a large header. > # This is line 1836 of a file with a large header. > # This is line 1837 of a file with a large header. > # This is line 1838 of a file with a large header. > # This is line 1839 of a file with a large header. > # This is line 1840 of a file with a large header. > # This is line 1841 of a file with a large header. > # This is line 1842 of a file with a large header. > # This is line 1843 of a file with a large header. > # This is line 1844 of a file with a large header. > # This is line 1845 of a file with a large header. > # This is line 1846 of a file with a large header. > # This is line 1847 of a file with a large header. > # This is line 1848 of a file with a large header. > # This is line 1849 of a file with a large header. > # This is line 1850 of a file with a large header. > # This is line 1851 of a file with a large header. > # This is line 1852 of a file with a large header. > # This is line 1853 of a file with a large header. > # This is line 1854 of a file with a large header. > # This is line 1855 of a file with a large header. > # This is line 1856 of a file with a large header. > # This is line 1857 of a file with a large header. > # This is line 1858 of a file with a large header. > # This is line 1859 of a file with a large header. > # This is line 1860 of a file with a large header. > # This is line 1861 of a file with a large header. > # This is line 1862 of a file with a large header. > # This is line 1863 of a file with a large header. > # This is line 1864 of a file with a large header. > # This is line 1865 of a file with a large header. > # This is line 1866 of a file with a large header. > # This is line 1867 of a file with a large header. > # This is line 1868 of a file with a large header. > # This is line 1869 of a file with a large header. > # This is line 1870 of a file with a large header. > # This is line 1871 of a file with a large header. > # This is line 1872 of a file with a large header. > # This is line 1873 of a file with a large header. > # This is line 1874 of a file with a large header. > # This is line 1875 of a file with a large header. > # This is line 1876 of a file with a large header. > # This is line 1877 of a file with a large header. > # This is line 1878 of a file with a large header. > # This is line 1879 of a file with a large header. > # This is line 1880 of a file with a large header. > # This is line 1881 of a file with a large header. > # This is line 1882 of a file with a large header. > # This is line 1883 of a file with a large header. > # This is line 1884 of a file with a large header. > # This is line 1885 of a file with a large header. > # This is line 1886 of a file with a large header. > # This is line 1887 of a file with a large header. > # This is line 1888 of a file with a large header. > # This is line 1889 of a file with a large header. > # This is line 1890 of a file with a large header. > # This is line 1891 of a file with a large header. > # This is line 1892 of a file with a large header. > # This is line 1893 of a file with a large header. > # This is line 1894 of a file with a large header. > # This is line 1895 of a file with a large header. > # This is line 1896 of a file with a large header. > # This is line 1897 of a file with a large header. > # This is line 1898 of a file with a large header. > # This is line 1899 of a file with a large header. > # This is line 1900 of a file with a large header. > # This is line 1901 of a file with a large header. > # This is line 1902 of a file with a large header. > # This is line 1903 of a file with a large header. > # This is line 1904 of a file with a large header. > # This is line 1905 of a file with a large header. > # This is line 1906 of a file with a large header. > # This is line 1907 of a file with a large header. > # This is line 1908 of a file with a large header. > # This is line 1909 of a file with a large header. > # This is line 1910 of a file with a large header. > # This is line 1911 of a file with a large header. > # This is line 1912 of a file with a large header. > # This is line 1913 of a file with a large header. > # This is line 1914 of a file with a large header. > # This is line 1915 of a file with a large header. > # This is line 1916 of a file with a large header. > # This is line 1917 of a file with a large header. > # This is line 1918 of a file with a large header. > # This is line 1919 of a file with a large header. > # This is line 1920 of a file with a large header. > # This is line 1921 of a file with a large header. > # This is line 1922 of a file with a large header. > # This is line 1923 of a file with a large header. > # This is line 1924 of a file with a large header. > # This is line 1925 of a file with a large header. > # This is line 1926 of a file with a large header. > # This is line 1927 of a file with a large header. > # This is line 1928 of a file with a large header. > # This is line 1929 of a file with a large header. > # This is line 1930 of a file with a large header. > # This is line 1931 of a file with a large header. > # This is line 1932 of a file with a large header. > # This is line 1933 of a file with a large header. > # This is line 1934 of a file with a large header. > # This is line 1935 of a file with a large header. > # This is line 1936 of a file with a large header. > # This is line 1937 of a file with a large header. > # This is line 1938 of a file with a large header. > # This is line 1939 of a file with a large header. > # This is line 1940 of a file with a large header. > # This is line 1941 of a file with a large header. > # This is line 1942 of a file with a large header. > # This is line 1943 of a file with a large header. > # This is line 1944 of a file with a large header. > # This is line 1945 of a file with a large header. > # This is line 1946 of a file with a large header. > # This is line 1947 of a file with a large header. > # This is line 1948 of a file with a large header. > # This is line 1949 of a file with a large header. > # This is line 1950 of a file with a large header. > # This is line 1951 of a file with a large header. > # This is line 1952 of a file with a large header. > # This is line 1953 of a file with a large header. > # This is line 1954 of a file with a large header. > # This is line 1955 of a file with a large header. > # This is line 1956 of a file with a large header. > # This is line 1957 of a file with a large header. > # This is line 1958 of a file with a large header. > # This is line 1959 of a file with a large header. > # This is line 1960 of a file with a large header. > # This is line 1961 of a file with a large header. > # This is line 1962 of a file with a large header. > # This is line 1963 of a file with a large header. > # This is line 1964 of a file with a large header. > # This is line 1965 of a file with a large header. > # This is line 1966 of a file with a large header. > # This is line 1967 of a file with a large header. > # This is line 1968 of a file with a large header. > # This is line 1969 of a file with a large header. > # This is line 1970 of a file with a large header. > # This is line 1971 of a file with a large header. > # This is line 1972 of a file with a large header. > # This is line 1973 of a file with a large header. > # This is line 1974 of a file with a large header. > # This is line 1975 of a file with a large header. > # This is line 1976 of a file with a large header. > # This is line 1977 of a file with a large header. > # This is line 1978 of a file with a large header. > # This is line 1979 of a file with a large header. > # This is line 1980 of a file with a large header. > # This is line 1981 of a file with a large header. > # This is line 1982 of a file with a large header. > # This is line 1983 of a file with a large header. > # This is line 1984 of a file with a large header. > # This is line 1985 of a file with a large header. > # This is line 1986 of a file with a large header. > # This is line 1987 of a file with a large header. > # This is line 1988 of a file with a large header. > # This is line 1989 of a file with a large header. > # This is line 1990 of a file with a large header. > # This is line 1991 of a file with a large header. > # This is line 1992 of a file with a large header. > # This is line 1993 of a file with a large header. > # This is line 1994 of a file with a large header. > # This is line 1995 of a file with a large header. > # This is line 1996 of a file with a large header. > # This is line 1997 of a file with a large header. > # This is line 1998 of a file with a large header. > # This is line 1999 of a file with a large header. > # This is line 2000 of a file with a large header. > # This is line 2001 of a file with a large header. > # This is line 2002 of a file with a large header. > # This is line 2003 of a file with a large header. > # This is line 2004 of a file with a large header. > # This is line 2005 of a file with a large header. > # This is line 2006 of a file with a large header. > # This is line 2007 of a file with a large header. > # This is line 2008 of a file with a large header. > # This is line 2009 of a file with a large header. > # This is line 2010 of a file with a large header. > # This is line 2011 of a file with a large header. > # This is line 2012 of a file with a large header. > # This is line 2013 of a file with a large header. > # This is line 2014 of a file with a large header. > # This is line 2015 of a file with a large header. > # This is line 2016 of a file with a large header. > # This is line 2017 of a file with a large header. > # This is line 2018 of a file with a large header. > # This is line 2019 of a file with a large header. > # This is line 2020 of a file with a large header. > # This is line 2021 of a file with a large header. > # This is line 2022 of a file with a large header. > # This is line 2023 of a file with a large header. > # This is line 2024 of a file with a large header. > # This is line 2025 of a file with a large header. > # This is line 2026 of a file with a large header. > # This is line 2027 of a file with a large header. > # This is line 2028 of a file with a large header. > # This is line 2029 of a file with a large header. > # This is line 2030 of a file with a large header. > # This is line 2031 of a file with a large header. > # This is line 2032 of a file with a large header. > # This is line 2033 of a file with a large header. > # This is line 2034 of a file with a large header. > # This is line 2035 of a file with a large header. > # This is line 2036 of a file with a large header. > # This is line 2037 of a file with a large header. > # This is line 2038 of a file with a large header. > # This is line 2039 of a file with a large header. > # This is line 2040 of a file with a large header. > # This is line 2041 of a file with a large header. > # This is line 2042 of a file with a large header. > # This is line 2043 of a file with a large header. > # This is line 2044 of a file with a large header. > # This is line 2045 of a file with a large header. > # This is line 2046 of a file with a large header. > # This is line 2047 of a file with a large header. > # This is line 2048 of a file with a large header. > # This is line 2049 of a file with a large header. > # This is line 2050 of a file with a large header. > # This is line 2051 of a file with a large header. > # This is line 2052 of a file with a large header. > # This is line 2053 of a file with a large header. > # This is line 2054 of a file with a large header. > # This is line 2055 of a file with a large header. > # This is line 2056 of a file with a large header. > # This is line 2057 of a file with a large header. > # This is line 2058 of a file with a large header. > # This is line 2059 of a file with a large header. > # This is line 2060 of a file with a large header. > # This is line 2061 of a file with a large header. > # This is line 2062 of a file with a large header. > # This is line 2063 of a file with a large header. > # This is line 2064 of a file with a large header. > # This is line 2065 of a file with a large header. > # This is line 2066 of a file with a large header. > # This is line 2067 of a file with a large header. > # This is line 2068 of a file with a large header. > # This is line 2069 of a file with a large header. > # This is line 2070 of a file with a large header. > # This is line 2071 of a file with a large header. > # This is line 2072 of a file with a large header. > # This is line 2073 of a file with a large header. > # This is line 2074 of a file with a large header. > # This is line 2075 of a file with a large header. > # This is line 2076 of a file with a large header. > # This is line 2077 of a file with a large header. > # This is line 2078 of a file with a large header. > # This is line 2079 of a file with a large header. > # This is line 2080 of a file with a large header. > # This is line 2081 of a file with a large header. > # This is line 2082 of a file with a large header. > # This is line 2083 of a file with a large header. > # This is line 2084 of a file with a large header. > # This is line 2085 of a file with a large header. > # This is line 2086 of a file with a large header. > # This is line 2087 of a file with a large header. > # This is line 2088 of a file with a large header. > # This is line 2089 of a file with a large header. > # This is line 2090 of a file with a large header. > # This is line 2091 of a file with a large header. > # This is line 2092 of a file with a large header. > # This is line 2093 of a file with a large header. > # This is line 2094 of a file with a large header. > # This is line 2095 of a file with a large header. > # This is line 2096 of a file with a large header. > # This is line 2097 of a file with a large header. > # This is line 2098 of a file with a large header. > # This is line 2099 of a file with a large header. > # This is line 2100 of a file with a large header. > # This is line 2101 of a file with a large header. > # This is line 2102 of a file with a large header. > # This is line 2103 of a file with a large header. > # This is line 2104 of a file with a large header. > # This is line 2105 of a file with a large header. > # This is line 2106 of a file with a large header. > # This is line 2107 of a file with a large header. > # This is line 2108 of a file with a large header. > # This is line 2109 of a file with a large header. > # This is line 2110 of a file with a large header. > # This is line 2111 of a file with a large header. > # This is line 2112 of a file with a large header. > # This is line 2113 of a file with a large header. > # This is line 2114 of a file with a large header. > # This is line 2115 of a file with a large header. > # This is line 2116 of a file with a large header. > # This is line 2117 of a file with a large header. > # This is line 2118 of a file with a large header. > # This is line 2119 of a file with a large header. > # This is line 2120 of a file with a large header. > # This is line 2121 of a file with a large header. > # This is line 2122 of a file with a large header. > # This is line 2123 of a file with a large header. > # This is line 2124 of a file with a large header. > # This is line 2125 of a file with a large header. > # This is line 2126 of a file with a large header. > # This is line 2127 of a file with a large header. > # This is line 2128 of a file with a large header. > # This is line 2129 of a file with a large header. > # This is line 2130 of a file with a large header. > # This is line 2131 of a file with a large header. > # This is line 2132 of a file with a large header. > # This is line 2133 of a file with a large header. > # This is line 2134 of a file with a large header. > # This is line 2135 of a file with a large header. > # This is line 2136 of a file with a large header. > # This is line 2137 of a file with a large header. > # This is line 2138 of a file with a large header. > # This is line 2139 of a file with a large header. > # This is line 2140 of a file with a large header. > # This is line 2141 of a file with a large header. > # This is line 2142 of a file with a large header. > # This is line 2143 of a file with a large header. > # This is line 2144 of a file with a large header. > # This is line 2145 of a file with a large header. > # This is line 2146 of a file with a large header. > # This is line 2147 of a file with a large header. > # This is line 2148 of a file with a large header. > # This is line 2149 of a file with a large header. > # This is line 2150 of a file with a large header. > # This is line 2151 of a file with a large header. > # This is line 2152 of a file with a large header. > # This is line 2153 of a file with a large header. > # This is line 2154 of a file with a large header. > # This is line 2155 of a file with a large header. > # This is line 2156 of a file with a large header. > # This is line 2157 of a file with a large header. > # This is line 2158 of a file with a large header. > # This is line 2159 of a file with a large header. > # This is line 2160 of a file with a large header. > # This is line 2161 of a file with a large header. > # This is line 2162 of a file with a large header. > # This is line 2163 of a file with a large header. > # This is line 2164 of a file with a large header. > # This is line 2165 of a file with a large header. > # This is line 2166 of a file with a large header. > # This is line 2167 of a file with a large header. > # This is line 2168 of a file with a large header. > # This is line 2169 of a file with a large header. > # This is line 2170 of a file with a large header. > # This is line 2171 of a file with a large header. > # This is line 2172 of a file with a large header. > # This is line 2173 of a file with a large header. > # This is line 2174 of a file with a large header. > # This is line 2175 of a file with a large header. > # This is line 2176 of a file with a large header. > # This is line 2177 of a file with a large header. > # This is line 2178 of a file with a large header. > # This is line 2179 of a file with a large header. > # This is line 2180 of a file with a large header. > # This is line 2181 of a file with a large header. > # This is line 2182 of a file with a large header. > # This is line 2183 of a file with a large header. > # This is line 2184 of a file with a large header. > # This is line 2185 of a file with a large header. > # This is line 2186 of a file with a large header. > # This is line 2187 of a file with a large header. > # This is line 2188 of a file with a large header. > # This is line 2189 of a file with a large header. > # This is line 2190 of a file with a large header. > # This is line 2191 of a file with a large header. > # This is line 2192 of a file with a large header. > # This is line 2193 of a file with a large header. > # This is line 2194 of a file with a large header. > # This is line 2195 of a file with a large header. > # This is line 2196 of a file with a large header. > # This is line 2197 of a file with a large header. > # This is line 2198 of a file with a large header. > # This is line 2199 of a file with a large header. > # This is line 2200 of a file with a large header. > # This is line 2201 of a file with a large header. > # This is line 2202 of a file with a large header. > # This is line 2203 of a file with a large header. > # This is line 2204 of a file with a large header. > # This is line 2205 of a file with a large header. > # This is line 2206 of a file with a large header. > # This is line 2207 of a file with a large header. > # This is line 2208 of a file with a large header. > # This is line 2209 of a file with a large header. > # This is line 2210 of a file with a large header. > # This is line 2211 of a file with a large header. > # This is line 2212 of a file with a large header. > # This is line 2213 of a file with a large header. > # This is line 2214 of a file with a large header. > # This is line 2215 of a file with a large header. > # This is line 2216 of a file with a large header. > # This is line 2217 of a file with a large header. > # This is line 2218 of a file with a large header. > # This is line 2219 of a file with a large header. > # This is line 2220 of a file with a large header. > # This is line 2221 of a file with a large header. > # This is line 2222 of a file with a large header. > # This is line 2223 of a file with a large header. > # This is line 2224 of a file with a large header. > # This is line 2225 of a file with a large header. > # This is line 2226 of a file with a large header. > # This is line 2227 of a file with a large header. > # This is line 2228 of a file with a large header. > # This is line 2229 of a file with a large header. > # This is line 2230 of a file with a large header. > # This is line 2231 of a file with a large header. > # This is line 2232 of a file with a large header. > # This is line 2233 of a file with a large header. > # This is line 2234 of a file with a large header. > # This is line 2235 of a file with a large header. > # This is line 2236 of a file with a large header. > # This is line 2237 of a file with a large header. > # This is line 2238 of a file with a large header. > # This is line 2239 of a file with a large header. > # This is line 2240 of a file with a large header. > # This is line 2241 of a file with a large header. > # This is line 2242 of a file with a large header. > # This is line 2243 of a file with a large header. > # This is line 2244 of a file with a large header. > # This is line 2245 of a file with a large header. > # This is line 2246 of a file with a large header. > # This is line 2247 of a file with a large header. > # This is line 2248 of a file with a large header. > # This is line 2249 of a file with a large header. > # This is line 2250 of a file with a large header. > # This is line 2251 of a file with a large header. > # This is line 2252 of a file with a large header. > # This is line 2253 of a file with a large header. > # This is line 2254 of a file with a large header. > # This is line 2255 of a file with a large header. > # This is line 2256 of a file with a large header. > # This is line 2257 of a file with a large header. > # This is line 2258 of a file with a large header. > # This is line 2259 of a file with a large header. > # This is line 2260 of a file with a large header. > # This is line 2261 of a file with a large header. > # This is line 2262 of a file with a large header. > # This is line 2263 of a file with a large header. > # This is line 2264 of a file with a large header. > # This is line 2265 of a file with a large header. > # This is line 2266 of a file with a large header. > # This is line 2267 of a file with a large header. > # This is line 2268 of a file with a large header. > # This is line 2269 of a file with a large header. > # This is line 2270 of a file with a large header. > # This is line 2271 of a file with a large header. > # This is line 2272 of a file with a large header. > # This is line 2273 of a file with a large header. > # This is line 2274 of a file with a large header. > # This is line 2275 of a file with a large header. > # This is line 2276 of a file with a large header. > # This is line 2277 of a file with a large header. > # This is line 2278 of a file with a large header. > # This is line 2279 of a file with a large header. > # This is line 2280 of a file with a large header. > # This is line 2281 of a file with a large header. > # This is line 2282 of a file with a large header. > # This is line 2283 of a file with a large header. > # This is line 2284 of a file with a large header. > # This is line 2285 of a file with a large header. > # This is line 2286 of a file with a large header. > # This is line 2287 of a file with a large header. > # This is line 2288 of a file with a large header. > # This is line 2289 of a file with a large header. > # This is line 2290 of a file with a large header. > # This is line 2291 of a file with a large header. > # This is line 2292 of a file with a large header. > # This is line 2293 of a file with a large header. > # This is line 2294 of a file with a large header. > # This is line 2295 of a file with a large header. > # This is line 2296 of a file with a large header. > # This is line 2297 of a file with a large header. > # This is line 2298 of a file with a large header. > # This is line 2299 of a file with a large header. > # This is line 2300 of a file with a large header. > # This is line 2301 of a file with a large header. > # This is line 2302 of a file with a large header. > # This is line 2303 of a file with a large header. > # This is line 2304 of a file with a large header. > # This is line 2305 of a file with a large header. > # This is line 2306 of a file with a large header. > # This is line 2307 of a file with a large header. > # This is line 2308 of a file with a large header. > # This is line 2309 of a file with a large header. > # This is line 2310 of a file with a large header. > # This is line 2311 of a file with a large header. > # This is line 2312 of a file with a large header. > # This is line 2313 of a file with a large header. > # This is line 2314 of a file with a large header. > # This is line 2315 of a file with a large header. > # This is line 2316 of a file with a large header. > # This is line 2317 of a file with a large header. > # This is line 2318 of a file with a large header. > # This is line 2319 of a file with a large header. > # This is line 2320 of a file with a large header. > # This is line 2321 of a file with a large header. > # This is line 2322 of a file with a large header. > # This is line 2323 of a file with a large header. > # This is line 2324 of a file with a large header. > # This is line 2325 of a file with a large header. > # This is line 2326 of a file with a large header. > # This is line 2327 of a file with a large header. > # This is line 2328 of a file with a large header. > # This is line 2329 of a file with a large header. > # This is line 2330 of a file with a large header. > # This is line 2331 of a file with a large header. > # This is line 2332 of a file with a large header. > # This is line 2333 of a file with a large header. > # This is line 2334 of a file with a large header. > # This is line 2335 of a file with a large header. > # This is line 2336 of a file with a large header. > # This is line 2337 of a file with a large header. > # This is line 2338 of a file with a large header. > # This is line 2339 of a file with a large header. > # This is line 2340 of a file with a large header. > # This is line 2341 of a file with a large header. > # This is line 2342 of a file with a large header. > # This is line 2343 of a file with a large header. > # This is line 2344 of a file with a large header. > # This is line 2345 of a file with a large header. > # This is line 2346 of a file with a large header. > # This is line 2347 of a file with a large header. > # This is line 2348 of a file with a large header. > # This is line 2349 of a file with a large header. > # This is line 2350 of a file with a large header. > # This is line 2351 of a file with a large header. > # This is line 2352 of a file with a large header. > # This is line 2353 of a file with a large header. > # This is line 2354 of a file with a large header. > # This is line 2355 of a file with a large header. > # This is line 2356 of a file with a large header. > # This is line 2357 of a file with a large header. > # This is line 2358 of a file with a large header. > # This is line 2359 of a file with a large header. > # This is line 2360 of a file with a large header. > # This is line 2361 of a file with a large header. > # This is line 2362 of a file with a large header. > # This is line 2363 of a file with a large header. > # This is line 2364 of a file with a large header. > # This is line 2365 of a file with a large header. > # This is line 2366 of a file with a large header. > # This is line 2367 of a file with a large header. > # This is line 2368 of a file with a large header. > # This is line 2369 of a file with a large header. > # This is line 2370 of a file with a large header. > # This is line 2371 of a file with a large header. > # This is line 2372 of a file with a large header. > # This is line 2373 of a file with a large header. > # This is line 2374 of a file with a large header. > # This is line 2375 of a file with a large header. > # This is line 2376 of a file with a large header. > # This is line 2377 of a file with a large header. > # This is line 2378 of a file with a large header. > # This is line 2379 of a file with a large header. > # This is line 2380 of a file with a large header. > # This is line 2381 of a file with a large header. > # This is line 2382 of a file with a large header. > # This is line 2383 of a file with a large header. > # This is line 2384 of a file with a large header. > # This is line 2385 of a file with a large header. > # This is line 2386 of a file with a large header. > # This is line 2387 of a file with a large header. > # This is line 2388 of a file with a large header. > # This is line 2389 of a file with a large header. > # This is line 2390 of a file with a large header. > # This is line 2391 of a file with a large header. > # This is line 2392 of a file with a large header. > # This is line 2393 of a file with a large header. > # This is line 2394 of a file with a large header. > # This is line 2395 of a file with a large header. > # This is line 2396 of a file with a large header. > # This is line 2397 of a file with a large header. > # This is line 2398 of a file with a large header. > # This is line 2399 of a file with a large header. > # This is line 2400 of a file with a large header. > # This is line 2401 of a file with a large header. > # This is line 2402 of a file with a large header. > # This is line 2403 of a file with a large header. > # This is line 2404 of a file with a large header. > # This is line 2405 of a file with a large header. > # This is line 2406 of a file with a large header. > # This is line 2407 of a file with a large header. > # This is line 2408 of a file with a large header. > # This is line 2409 of a file with a large header. > # This is line 2410 of a file with a large header. > # This is line 2411 of a file with a large header. > # This is line 2412 of a file with a large header. > # This is line 2413 of a file with a large header. > # This is line 2414 of a file with a large header. > # This is line 2415 of a file with a large header. > # This is line 2416 of a file with a large header. > # This is line 2417 of a file with a large header. > # This is line 2418 of a file with a large header. > # This is line 2419 of a file with a large header. > # This is line 2420 of a file with a large header. > # This is line 2421 of a file with a large header. > # This is line 2422 of a file with a large header. > # This is line 2423 of a file with a large header. > # This is line 2424 of a file with a large header. > # This is line 2425 of a file with a large header. > # This is line 2426 of a file with a large header. > # This is line 2427 of a file with a large header. > # This is line 2428 of a file with a large header. > # This is line 2429 of a file with a large header. > # This is line 2430 of a file with a large header. > # This is line 2431 of a file with a large header. > # This is line 2432 of a file with a large header. > # This is line 2433 of a file with a large header. > # This is line 2434 of a file with a large header. > # This is line 2435 of a file with a large header. > # This is line 2436 of a file with a large header. > # This is line 2437 of a file with a large header. > # This is line 2438 of a file with a large header. > # This is line 2439 of a file with a large header. > # This is line 2440 of a file with a large header. > # This is line 2441 of a file with a large header. > # This is line 2442 of a file with a large header. > # This is line 2443 of a file with a large header. > # This is line 2444 of a file with a large header. > # This is line 2445 of a file with a large header. > # This is line 2446 of a file with a large header. > # This is line 2447 of a file with a large header. > # This is line 2448 of a file with a large header. > # This is line 2449 of a file with a large header. > # This is line 2450 of a file with a large header. > # This is line 2451 of a file with a large header. > # This is line 2452 of a file with a large header. > # This is line 2453 of a file with a large header. > # This is line 2454 of a file with a large header. > # This is line 2455 of a file with a large header. > # This is line 2456 of a file with a large header. > # This is line 2457 of a file with a large header. > # This is line 2458 of a file with a large header. > # This is line 2459 of a file with a large header. > # This is line 2460 of a file with a large header. > # This is line 2461 of a file with a large header. > # This is line 2462 of a file with a large header. > # This is line 2463 of a file with a large header. > # This is line 2464 of a file with a large header. > # This is line 2465 of a file with a large header. > # This is line 2466 of a file with a large header. > # This is line 2467 of a file with a large header. > # This is line 2468 of a file with a large header. > # This is line 2469 of a file with a large header. > # This is line 2470 of a file with a large header. > # This is line 2471 of a file with a large header. > # This is line 2472 of a file with a large header. > # This is line 2473 of a file with a large header. > # This is line 2474 of a file with a large header. > # This is line 2475 of a file with a large header. > # This is line 2476 of a file with a large header. > # This is line 2477 of a file with a large header. > # This is line 2478 of a file with a large header. > # This is line 2479 of a file with a large header. > # This is line 2480 of a file with a large header. > # This is line 2481 of a file with a large header. > # This is line 2482 of a file with a large header. > # This is line 2483 of a file with a large header. > # This is line 2484 of a file with a large header. > # This is line 2485 of a file with a large header. > # This is line 2486 of a file with a large header. > # This is line 2487 of a file with a large header. > # This is line 2488 of a file with a large header. > # This is line 2489 of a file with a large header. > # This is line 2490 of a file with a large header. > # This is line 2491 of a file with a large header. > # This is line 2492 of a file with a large header. > # This is line 2493 of a file with a large header. > # This is line 2494 of a file with a large header. > # This is line 2495 of a file with a large header. > # This is line 2496 of a file with a large header. > # This is line 2497 of a file with a large header. > # This is line 2498 of a file with a large header. > # This is line 2499 of a file with a large header. > # This is line 2500 of a file with a large header. > # This is line 2501 of a file with a large header. > # This is line 2502 of a file with a large header. > # This is line 2503 of a file with a large header. > # This is line 2504 of a file with a large header. > # This is line 2505 of a file with a large header. > # This is line 2506 of a file with a large header. > # This is line 2507 of a file with a large header. > # This is line 2508 of a file with a large header. > # This is line 2509 of a file with a large header. > # This is line 2510 of a file with a large header. > # This is line 2511 of a file with a large header. > # This is line 2512 of a file with a large header. > # This is line 2513 of a file with a large header. > # This is line 2514 of a file with a large header. > # This is line 2515 of a file with a large header. > # This is line 2516 of a file with a large header. > # This is line 2517 of a file with a large header. > # This is line 2518 of a file with a large header. > # This is line 2519 of a file with a large header. > # This is line 2520 of a file with a large header. > # This is line 2521 of a file with a large header. > # This is line 2522 of a file with a large header. > # This is line 2523 of a file with a large header. > # This is line 2524 of a file with a large header. > # This is line 2525 of a file with a large header. > # This is line 2526 of a file with a large header. > # This is line 2527 of a file with a large header. > # This is line 2528 of a file with a large header. > # This is line 2529 of a file with a large header. > # This is line 2530 of a file with a large header. > # This is line 2531 of a file with a large header. > # This is line 2532 of a file with a large header. > # This is line 2533 of a file with a large header. > # This is line 2534 of a file with a large header. > # This is line 2535 of a file with a large header. > # This is line 2536 of a file with a large header. > # This is line 2537 of a file with a large header. > # This is line 2538 of a file with a large header. > # This is line 2539 of a file with a large header. > # This is line 2540 of a file with a large header. > # This is line 2541 of a file with a large header. > # This is line 2542 of a file with a large header. > # This is line 2543 of a file with a large header. > # This is line 2544 of a file with a large header. > # This is line 2545 of a file with a large header. > # This is line 2546 of a file with a large header. > # This is line 2547 of a file with a large header. > # This is line 2548 of a file with a large header. > # This is line 2549 of a file with a large header. > # This is line 2550 of a file with a large header. > # This is line 2551 of a file with a large header. > # This is line 2552 of a file with a large header. > # This is line 2553 of a file with a large header. > # This is line 2554 of a file with a large header. > # This is line 2555 of a file with a large header. > # This is line 2556 of a file with a large header. > # This is line 2557 of a file with a large header. > # This is line 2558 of a file with a large header. > # This is line 2559 of a file with a large header. > # This is line 2560 of a file with a large header. > # This is line 2561 of a file with a large header. > # This is line 2562 of a file with a large header. > # This is line 2563 of a file with a large header. > # This is line 2564 of a file with a large header. > # This is line 2565 of a file with a large header. > # This is line 2566 of a file with a large header. > # This is line 2567 of a file with a large header. > # This is line 2568 of a file with a large header. > # This is line 2569 of a file with a large header. > # This is line 2570 of a file with a large header. > # This is line 2571 of a file with a large header. > # This is line 2572 of a file with a large header. > # This is line 2573 of a file with a large header. > # This is line 2574 of a file with a large header. > # This is line 2575 of a file with a large header. > # This is line 2576 of a file with a large header. > # This is line 2577 of a file with a large header. > # This is line 2578 of a file with a large header. > # This is line 2579 of a file with a large header. > # This is line 2580 of a file with a large header. > # This is line 2581 of a file with a large header. > # This is line 2582 of a file with a large header. > # This is line 2583 of a file with a large header. > # This is line 2584 of a file with a large header. > # This is line 2585 of a file with a large header. > # This is line 2586 of a file with a large header. > # This is line 2587 of a file with a large header. > # This is line 2588 of a file with a large header. > # This is line 2589 of a file with a large header. > # This is line 2590 of a file with a large header. > # This is line 2591 of a file with a large header. > # This is line 2592 of a file with a large header. > # This is line 2593 of a file with a large header. > # This is line 2594 of a file with a large header. > # This is line 2595 of a file with a large header. > # This is line 2596 of a file with a large header. > # This is line 2597 of a file with a large header. > # This is line 2598 of a file with a large header. > # This is line 2599 of a file with a large header. > # This is line 2600 of a file with a large header. > # This is line 2601 of a file with a large header. > # This is line 2602 of a file with a large header. > # This is line 2603 of a file with a large header. > # This is line 2604 of a file with a large header. > # This is line 2605 of a file with a large header. > # This is line 2606 of a file with a large header. > # This is line 2607 of a file with a large header. > # This is line 2608 of a file with a large header. > # This is line 2609 of a file with a large header. > # This is line 2610 of a file with a large header. > # This is line 2611 of a file with a large header. > # This is line 2612 of a file with a large header. > # This is line 2613 of a file with a large header. > # This is line 2614 of a file with a large header. > # This is line 2615 of a file with a large header. > # This is line 2616 of a file with a large header. > # This is line 2617 of a file with a large header. > # This is line 2618 of a file with a large header. > # This is line 2619 of a file with a large header. > # This is line 2620 of a file with a large header. > # This is line 2621 of a file with a large header. > # This is line 2622 of a file with a large header. > # This is line 2623 of a file with a large header. > # This is line 2624 of a file with a large header. > # This is line 2625 of a file with a large header. > # This is line 2626 of a file with a large header. > # This is line 2627 of a file with a large header. > # This is line 2628 of a file with a large header. > # This is line 2629 of a file with a large header. > # This is line 2630 of a file with a large header. > # This is line 2631 of a file with a large header. > # This is line 2632 of a file with a large header. > # This is line 2633 of a file with a large header. > # This is line 2634 of a file with a large header. > # This is line 2635 of a file with a large header. > # This is line 2636 of a file with a large header. > # This is line 2637 of a file with a large header. > # This is line 2638 of a file with a large header. > # This is line 2639 of a file with a large header. > # This is line 2640 of a file with a large header. > # This is line 2641 of a file with a large header. > # This is line 2642 of a file with a large header. > # This is line 2643 of a file with a large header. > # This is line 2644 of a file with a large header. > # This is line 2645 of a file with a large header. > # This is line 2646 of a file with a large header. > # This is line 2647 of a file with a large header. > # This is line 2648 of a file with a large header. > # This is line 2649 of a file with a large header. > # This is line 2650 of a file with a large header. > # This is line 2651 of a file with a large header. > # This is line 2652 of a file with a large header. > # This is line 2653 of a file with a large header. > # This is line 2654 of a file with a large header. > # This is line 2655 of a file with a large header. > # This is line 2656 of a file with a large header. > # This is line 2657 of a file with a large header. > # This is line 2658 of a file with a large header. > # This is line 2659 of a file with a large header. > # This is line 2660 of a file with a large header. > # This is line 2661 of a file with a large header. > # This is line 2662 of a file with a large header. > # This is line 2663 of a file with a large header. > # This is line 2664 of a file with a large header. > # This is line 2665 of a file with a large header. > # This is line 2666 of a file with a large header. > # This is line 2667 of a file with a large header. > # This is line 2668 of a file with a large header. > # This is line 2669 of a file with a large header. > # This is line 2670 of a file with a large header. > # This is line 2671 of a file with a large header. > # This is line 2672 of a file with a large header. > # This is line 2673 of a file with a large header. > # This is line 2674 of a file with a large header. > # This is line 2675 of a file with a large header. > # This is line 2676 of a file with a large header. > # This is line 2677 of a file with a large header. > # This is line 2678 of a file with a large header. > # This is line 2679 of a file with a large header. > # This is line 2680 of a file with a large header. > # This is line 2681 of a file with a large header. > # This is line 2682 of a file with a large header. > # This is line 2683 of a file with a large header. > # This is line 2684 of a file with a large header. > # This is line 2685 of a file with a large header. > # This is line 2686 of a file with a large header. > # This is line 2687 of a file with a large header. > # This is line 2688 of a file with a large header. > # This is line 2689 of a file with a large header. > # This is line 2690 of a file with a large header. > # This is line 2691 of a file with a large header. > # This is line 2692 of a file with a large header. > # This is line 2693 of a file with a large header. > # This is line 2694 of a file with a large header. > # This is line 2695 of a file with a large header. > # This is line 2696 of a file with a large header. > # This is line 2697 of a file with a large header. > # This is line 2698 of a file with a large header. > # This is line 2699 of a file with a large header. > # This is line 2700 of a file with a large header. > # This is line 2701 of a file with a large header. > # This is line 2702 of a file with a large header. > # This is line 2703 of a file with a large header. > # This is line 2704 of a file with a large header. > # This is line 2705 of a file with a large header. > # This is line 2706 of a file with a large header. > # This is line 2707 of a file with a large header. > # This is line 2708 of a file with a large header. > # This is line 2709 of a file with a large header. > # This is line 2710 of a file with a large header. > # This is line 2711 of a file with a large header. > # This is line 2712 of a file with a large header. > # This is line 2713 of a file with a large header. > # This is line 2714 of a file with a large header. > # This is line 2715 of a file with a large header. > # This is line 2716 of a file with a large header. > # This is line 2717 of a file with a large header. > # This is line 2718 of a file with a large header. > # This is line 2719 of a file with a large header. > # This is line 2720 of a file with a large header. > # This is line 2721 of a file with a large header. > # This is line 2722 of a file with a large header. > # This is line 2723 of a file with a large header. > # This is line 2724 of a file with a large header. > # This is line 2725 of a file with a large header. > # This is line 2726 of a file with a large header. > # This is line 2727 of a file with a large header. > # This is line 2728 of a file with a large header. > # This is line 2729 of a file with a large header. > # This is line 2730 of a file with a large header. > # This is line 2731 of a file with a large header. > # This is line 2732 of a file with a large header. > # This is line 2733 of a file with a large header. > # This is line 2734 of a file with a large header. > # This is line 2735 of a file with a large header. > # This is line 2736 of a file with a large header. > # This is line 2737 of a file with a large header. > # This is line 2738 of a file with a large header. > # This is line 2739 of a file with a large header. > # This is line 2740 of a file with a large header. > # This is line 2741 of a file with a large header. > # This is line 2742 of a file with a large header. > # This is line 2743 of a file with a large header. > # This is line 2744 of a file with a large header. > # This is line 2745 of a file with a large header. > # This is line 2746 of a file with a large header. > # This is line 2747 of a file with a large header. > # This is line 2748 of a file with a large header. > # This is line 2749 of a file with a large header. > # This is line 2750 of a file with a large header. > # This is line 2751 of a file with a large header. > # This is line 2752 of a file with a large header. > # This is line 2753 of a file with a large header. > # This is line 2754 of a file with a large header. > # This is line 2755 of a file with a large header. > # This is line 2756 of a file with a large header. > # This is line 2757 of a file with a large header. > # This is line 2758 of a file with a large header. > # This is line 2759 of a file with a large header. > # This is line 2760 of a file with a large header. > # This is line 2761 of a file with a large header. > # This is line 2762 of a file with a large header. > # This is line 2763 of a file with a large header. > # This is line 2764 of a file with a large header. > # This is line 2765 of a file with a large header. > # This is line 2766 of a file with a large header. > # This is line 2767 of a file with a large header. > # This is line 2768 of a file with a large header. > # This is line 2769 of a file with a large header. > # This is line 2770 of a file with a large header. > # This is line 2771 of a file with a large header. > # This is line 2772 of a file with a large header. > # This is line 2773 of a file with a large header. > # This is line 2774 of a file with a large header. > # This is line 2775 of a file with a large header. > # This is line 2776 of a file with a large header. > # This is line 2777 of a file with a large header. > # This is line 2778 of a file with a large header. > # This is line 2779 of a file with a large header. > # This is line 2780 of a file with a large header. > # This is line 2781 of a file with a large header. > # This is line 2782 of a file with a large header. > # This is line 2783 of a file with a large header. > # This is line 2784 of a file with a large header. > # This is line 2785 of a file with a large header. > # This is line 2786 of a file with a large header. > # This is line 2787 of a file with a large header. > # This is line 2788 of a file with a large header. > # This is line 2789 of a file with a large header. > # This is line 2790 of a file with a large header. > # This is line 2791 of a file with a large header. > # This is line 2792 of a file with a large header. > # This is line 2793 of a file with a large header. > # This is line 2794 of a file with a large header. > # This is line 2795 of a file with a large header. > # This is line 2796 of a file with a large header. > # This is line 2797 of a file with a large header. > # This is line 2798 of a file with a large header. > # This is line 2799 of a file with a large header. > # This is line 2800 of a file with a large header. > # This is line 2801 of a file with a large header. > # This is line 2802 of a file with a large header. > # This is line 2803 of a file with a large header. > # This is line 2804 of a file with a large header. > # This is line 2805 of a file with a large header. > # This is line 2806 of a file with a large header. > # This is line 2807 of a file with a large header. > # This is line 2808 of a file with a large header. > # This is line 2809 of a file with a large header. > # This is line 2810 of a file with a large header. > # This is line 2811 of a file with a large header. > # This is line 2812 of a file with a large header. > # This is line 2813 of a file with a large header. > # This is line 2814 of a file with a large header. > # This is line 2815 of a file with a large header. > # This is line 2816 of a file with a large header. > # This is line 2817 of a file with a large header. > # This is line 2818 of a file with a large header. > # This is line 2819 of a file with a large header. > # This is line 2820 of a file with a large header. > # This is line 2821 of a file with a large header. > # This is line 2822 of a file with a large header. > # This is line 2823 of a file with a large header. > # This is line 2824 of a file with a large header. > # This is line 2825 of a file with a large header. > # This is line 2826 of a file with a large header. > # This is line 2827 of a file with a large header. > # This is line 2828 of a file with a large header. > # This is line 2829 of a file with a large header. > # This is line 2830 of a file with a large header. > # This is line 2831 of a file with a large header. > # This is line 2832 of a file with a large header. > # This is line 2833 of a file with a large header. > # This is line 2834 of a file with a large header. > # This is line 2835 of a file with a large header. > # This is line 2836 of a file with a large header. > # This is line 2837 of a file with a large header. > # This is line 2838 of a file with a large header. > # This is line 2839 of a file with a large header. > # This is line 2840 of a file with a large header. > # This is line 2841 of a file with a large header. > # This is line 2842 of a file with a large header. > # This is line 2843 of a file with a large header. > # This is line 2844 of a file with a large header. > # This is line 2845 of a file with a large header. > # This is line 2846 of a file with a large header. > # This is line 2847 of a file with a large header. > # This is line 2848 of a file with a large header. > # This is line 2849 of a file with a large header. > # This is line 2850 of a file with a large header. > # This is line 2851 of a file with a large header. > # This is line 2852 of a file with a large header. > # This is line 2853 of a file with a large header. > # This is line 2854 of a file with a large header. > # This is line 2855 of a file with a large header. > # This is line 2856 of a file with a large header. > # This is line 2857 of a file with a large header. > # This is line 2858 of a file with a large header. > # This is line 2859 of a file with a large header. > # This is line 2860 of a file with a large header. > # This is line 2861 of a file with a large header. > # This is line 2862 of a file with a large header. > # This is line 2863 of a file with a large header. > # This is line 2864 of a file with a large header. > # This is line 2865 of a file with a large header. > # This is line 2866 of a file with a large header. > # This is line 2867 of a file with a large header. > # This is line 2868 of a file with a large header. > # This is line 2869 of a file with a large header. > # This is line 2870 of a file with a large header. > # This is line 2871 of a file with a large header. > # This is line 2872 of a file with a large header. > # This is line 2873 of a file with a large header. > # This is line 2874 of a file with a large header. > # This is line 2875 of a file with a large header. > # This is line 2876 of a file with a large header. > # This is line 2877 of a file with a large header. > # This is line 2878 of a file with a large header. > # This is line 2879 of a file with a large header. > # This is line 2880 of a file with a large header. > # This is line 2881 of a file with a large header. > # This is line 2882 of a file with a large header. > # This is line 2883 of a file with a large header. > # This is line 2884 of a file with a large header. > # This is line 2885 of a file with a large header. > # This is line 2886 of a file with a large header. > # This is line 2887 of a file with a large header. > # This is line 2888 of a file with a large header. > # This is line 2889 of a file with a large header. > # This is line 2890 of a file with a large header. > # This is line 2891 of a file with a large header. > # This is line 2892 of a file with a large header. > # This is line 2893 of a file with a large header. > # This is line 2894 of a file with a large header. > # This is line 2895 of a file with a large header. > # This is line 2896 of a file with a large header. > # This is line 2897 of a file with a large header. > # This is line 2898 of a file with a large header. > # This is line 2899 of a file with a large header. > # This is line 2900 of a file with a large header. > # This is line 2901 of a file with a large header. > # This is line 2902 of a file with a large header. > # This is line 2903 of a file with a large header. > # This is line 2904 of a file with a large header. > # This is line 2905 of a file with a large header. > # This is line 2906 of a file with a large header. > # This is line 2907 of a file with a large header. > # This is line 2908 of a file with a large header. > # This is line 2909 of a file with a large header. > # This is line 2910 of a file with a large header. > # This is line 2911 of a file with a large header. > # This is line 2912 of a file with a large header. > # This is line 2913 of a file with a large header. > # This is line 2914 of a file with a large header. > # This is line 2915 of a file with a large header. > # This is line 2916 of a file with a large header. > # This is line 2917 of a file with a large header. > # This is line 2918 of a file with a large header. > # This is line 2919 of a file with a large header. > # This is line 2920 of a file with a large header. > # This is line 2921 of a file with a large header. > # This is line 2922 of a file with a large header. > # This is line 2923 of a file with a large header. > # This is line 2924 of a file with a large header. > # This is line 2925 of a file with a large header. > # This is line 2926 of a file with a large header. > # This is line 2927 of a file with a large header. > # This is line 2928 of a file with a large header. > # This is line 2929 of a file with a large header. > # This is line 2930 of a file with a large header. > # This is line 2931 of a file with a large header. > # This is line 2932 of a file with a large header. > # This is line 2933 of a file with a large header. > # This is line 2934 of a file with a large header. > # This is line 2935 of a file with a large header. > # This is line 2936 of a file with a large header. > # This is line 2937 of a file with a large header. > # This is line 2938 of a file with a large header. > # This is line 2939 of a file with a large header. > # This is line 2940 of a file with a large header. > # This is line 2941 of a file with a large header. > # This is line 2942 of a file with a large header. > # This is line 2943 of a file with a large header. > # This is line 2944 of a file with a large header. > # This is line 2945 of a file with a large header. > # This is line 2946 of a file with a large header. > # This is line 2947 of a file with a large header. > # This is line 2948 of a file with a large header. > # This is line 2949 of a file with a large header. > # This is line 2950 of a file with a large header. > # This is line 2951 of a file with a large header. > # This is line 2952 of a file with a large header. > # This is line 2953 of a file with a large header. > # This is line 2954 of a file with a large header. > # This is line 2955 of a file with a large header. > # This is line 2956 of a file with a large header. > # This is line 2957 of a file with a large header. > # This is line 2958 of a file with a large header. > # This is line 2959 of a file with a large header. > # This is line 2960 of a file with a large header. > # This is line 2961 of a file with a large header. > # This is line 2962 of a file with a large header. > # This is line 2963 of a file with a large header. > # This is line 2964 of a file with a large header. > # This is line 2965 of a file with a large header. > # This is line 2966 of a file with a large header. > # This is line 2967 of a file with a large header. > # This is line 2968 of a file with a large header. > # This is line 2969 of a file with a large header. > # This is line 2970 of a file with a large header. > # This is line 2971 of a file with a large header. > # This is line 2972 of a file with a large header. > # This is line 2973 of a file with a large header. > # This is line 2974 of a file with a large header. > # This is line 2975 of a file with a large header. > # This is line 2976 of a file with a large header. > # This is line 2977 of a file with a large header. > # This is line 2978 of a file with a large header. > # This is line 2979 of a file with a large header. > # This is line 2980 of a file with a large header. > # This is line 2981 of a file with a large header. > # This is line 2982 of a file with a large header. > # This is line 2983 of a file with a large header. > # This is line 2984 of a file with a large header. > # This is line 2985 of a file with a large header. > # This is line 2986 of a file with a large header. > # This is line 2987 of a file with a large header. > # This is line 2988 of a file with a large header. > # This is line 2989 of a file with a large header. > # This is line 2990 of a file with a large header. > # This is line 2991 of a file with a large header. > # This is line 2992 of a file with a large header. > # This is line 2993 of a file with a large header. > # This is line 2994 of a file with a large header. > # This is line 2995 of a file with a large header. > # This is line 2996 of a file with a large header. > # This is line 2997 of a file with a large header. > # This is line 2998 of a file with a large header. > # This is line 2999 of a file with a large header. > # This is line 3000 of a file with a large header. > # This is line 3001 of a file with a large header. > # This is line 3002 of a file with a large header. > # This is line 3003 of a file with a large header. > # This is line 3004 of a file with a large header. > # This is line 3005 of a file with a large header. > # This is line 3006 of a file with a large header. > # This is line 3007 of a file with a large header. > # This is line 3008 of a file with a large header. > # This is line 3009 of a file with a large header. > # This is line 3010 of a file with a large header. > # This is line 3011 of a file with a large header. > # This is line 3012 of a file with a large header. > # This is line 3013 of a file with a large header. > # This is line 3014 of a file with a large header. > # This is line 3015 of a file with a large header. > # This is line 3016 of a file with a large header. > # This is line 3017 of a file with a large header. > # This is line 3018 of a file with a large header. > # This is line 3019 of a file with a large header. > # This is line 3020 of a file with a large header. > # This is line 3021 of a file with a large header. > # This is line 3022 of a file with a large header. > # This is line 3023 of a file with a large header. > # This is line 3024 of a file with a large header. > # This is line 3025 of a file with a large header. > # This is line 3026 of a file with a large header. > # This is line 3027 of a file with a large header. > # This is line 3028 of a file with a large header. > # This is line 3029 of a file with a large header. > # This is line 3030 of a file with a large header. > # This is line 3031 of a file with a large header. > # This is line 3032 of a file with a large header. > # This is line 3033 of a file with a large header. > # This is line 3034 of a file with a large header. > # This is line 3035 of a file with a large header. > # This is line 3036 of a file with a large header. > # This is line 3037 of a file with a large header. > # This is line 3038 of a file with a large header. > # This is line 3039 of a file with a large header. > # This is line 3040 of a file with a large header. > # This is line 3041 of a file with a large header. > # This is line 3042 of a file with a large header. > # This is line 3043 of a file with a large header. > # This is line 3044 of a file with a large header. > # This is line 3045 of a file with a large header. > # This is line 3046 of a file with a large header. > # This is line 3047 of a file with a large header. > # This is line 3048 of a file with a large header. > # This is line 3049 of a file with a large header. > # This is line 3050 of a file with a large header. > # This is line 3051 of a file with a large header. > # This is line 3052 of a file with a large header. > # This is line 3053 of a file with a large header. > # This is line 3054 of a file with a large header. > # This is line 3055 of a file with a large header. > # This is line 3056 of a file with a large header. > # This is line 3057 of a file with a large header. > # This is line 3058 of a file with a large header. > # This is line 3059 of a file with a large header. > # This is line 3060 of a file with a large header. > # This is line 3061 of a file with a large header. > # This is line 3062 of a file with a large header. > # This is line 3063 of a file with a large header. > # This is line 3064 of a file with a large header. > # This is line 3065 of a file with a large header. > # This is line 3066 of a file with a large header. > # This is line 3067 of a file with a large header. > # This is line 3068 of a file with a large header. > # This is line 3069 of a file with a large header. > # This is line 3070 of a file with a large header. > # This is line 3071 of a file with a large header. > # This is line 3072 of a file with a large header. > # This is line 3073 of a file with a large header. > # This is line 3074 of a file with a large header. > # This is line 3075 of a file with a large header. > # This is line 3076 of a file with a large header. > # This is line 3077 of a file with a large header. > # This is line 3078 of a file with a large header. > # This is line 3079 of a file with a large header. > # This is line 3080 of a file with a large header. > # This is line 3081 of a file with a large header. > # This is line 3082 of a file with a large header. > # This is line 3083 of a file with a large header. > # This is line 3084 of a file with a large header. > # This is line 3085 of a file with a large header. > # This is line 3086 of a file with a large header. > # This is line 3087 of a file with a large header. > # This is line 3088 of a file with a large header. > # This is line 3089 of a file with a large header. > # This is line 3090 of a file with a large header. > # This is line 3091 of a file with a large header. > # This is line 3092 of a file with a large header. > # This is line 3093 of a file with a large header. > # This is line 3094 of a file with a large header. > # This is line 3095 of a file with a large header. > # This is line 3096 of a file with a large header. > # This is line 3097 of a file with a large header. > # This is line 3098 of a file with a large header. > # This is line 3099 of a file with a large header. > # This is line 3100 of a file with a large header. > # This is line 3101 of a file with a large header. > # This is line 3102 of a file with a large header. > # This is line 3103 of a file with a large header. > # This is line 3104 of a file with a large header. > # This is line 3105 of a file with a large header. > # This is line 3106 of a file with a large header. > # This is line 3107 of a file with a large header. > # This is line 3108 of a file with a large header. > # This is line 3109 of a file with a large header. > # This is line 3110 of a file with a large header. > # This is line 3111 of a file with a large header. > # This is line 3112 of a file with a large header. > # This is line 3113 of a file with a large header. > # This is line 3114 of a file with a large header. > # This is line 3115 of a file with a large header. > # This is line 3116 of a file with a large header. > # This is line 3117 of a file with a large header. > # This is line 3118 of a file with a large header. > # This is line 3119 of a file with a large header. > # This is line 3120 of a file with a large header. > # This is line 3121 of a file with a large header. > # This is line 3122 of a file with a large header. > # This is line 3123 of a file with a large header. > # This is line 3124 of a file with a large header. > # This is line 3125 of a file with a large header. > # This is line 3126 of a file with a large header. > # This is line 3127 of a file with a large header. > # This is line 3128 of a file with a large header. > # This is line 3129 of a file with a large header. > # This is line 3130 of a file with a large header. > # This is line 3131 of a file with a large header. > # This is line 3132 of a file with a large header. > # This is line 3133 of a file with a large header. > # This is line 3134 of a file with a large header. > # This is line 3135 of a file with a large header. > # This is line 3136 of a file with a large header. > # This is line 3137 of a file with a large header. > # This is line 3138 of a file with a large header. > # This is line 3139 of a file with a large header. > # This is line 3140 of a file with a large header. > # This is line 3141 of a file with a large header. > # This is line 3142 of a file with a large header. > # This is line 3143 of a file with a large header. > # This is line 3144 of a file with a large header. > # This is line 3145 of a file with a large header. > # This is line 3146 of a file with a large header. > # This is line 3147 of a file with a large header. > # This is line 3148 of a file with a large header. > # This is line 3149 of a file with a large header. > # This is line 3150 of a file with a large header. > # This is line 3151 of a file with a large header. > # This is line 3152 of a file with a large header. > # This is line 3153 of a file with a large header. > # This is line 3154 of a file with a large header. > # This is line 3155 of a file with a large header. > # This is line 3156 of a file with a large header. > # This is line 3157 of a file with a large header. > # This is line 3158 of a file with a large header. > # This is line 3159 of a file with a large header. > # This is line 3160 of a file with a large header. > # This is line 3161 of a file with a large header. > # This is line 3162 of a file with a large header. > # This is line 3163 of a file with a large header. > # This is line 3164 of a file with a large header. > # This is line 3165 of a file with a large header. > # This is line 3166 of a file with a large header. > # This is line 3167 of a file with a large header. > # This is line 3168 of a file with a large header. > # This is line 3169 of a file with a large header. > # This is line 3170 of a file with a large header. > # This is line 3171 of a file with a large header. > # This is line 3172 of a file with a large header. > # This is line 3173 of a file with a large header. > # This is line 3174 of a file with a large header. > # This is line 3175 of a file with a large header. > # This is line 3176 of a file with a large header. > # This is line 3177 of a file with a large header. > # This is line 3178 of a file with a large header. > # This is line 3179 of a file with a large header. > # This is line 3180 of a file with a large header. > # This is line 3181 of a file with a large header. > # This is line 3182 of a file with a large header. > # This is line 3183 of a file with a large header. > # This is line 3184 of a file with a large header. > # This is line 3185 of a file with a large header. > # This is line 3186 of a file with a large header. > # This is line 3187 of a file with a large header. > # This is line 3188 of a file with a large header. > # This is line 3189 of a file with a large header. > # This is line 3190 of a file with a large header. > # This is line 3191 of a file with a large header. > # This is line 3192 of a file with a large header. > # This is line 3193 of a file with a large header. > # This is line 3194 of a file with a large header. > # This is line 3195 of a file with a large header. > # This is line 3196 of a file with a large header. > # This is line 3197 of a file with a large header. > # This is line 3198 of a file with a large header. > # This is line 3199 of a file with a large header. > # This is line 3200 of a file with a large header. > # This is line 3201 of a file with a large header. > # This is line 3202 of a file with a large header. > # This is line 3203 of a file with a large header. > # This is line 3204 of a file with a large header. > # This is line 3205 of a file with a large header. > # This is line 3206 of a file with a large header. > # This is line 3207 of a file with a large header. > # This is line 3208 of a file with a large header. > # This is line 3209 of a file with a large header. > # This is line 3210 of a file with a large header. > # This is line 3211 of a file with a large header. > # This is line 3212 of a file with a large header. > # This is line 3213 of a file with a large header. > # This is line 3214 of a file with a large header. > # This is line 3215 of a file with a large header. > # This is line 3216 of a file with a large header. > # This is line 3217 of a file with a large header. > # This is line 3218 of a file with a large header. > # This is line 3219 of a file with a large header. > # This is line 3220 of a file with a large header. > # This is line 3221 of a file with a large header. > # This is line 3222 of a file with a large header. > # This is line 3223 of a file with a large header. > # This is line 3224 of a file with a large header. > # This is line 3225 of a file with a large header. > # This is line 3226 of a file with a large header. > # This is line 3227 of a file with a large header. > # This is line 3228 of a file with a large header. > # This is line 3229 of a file with a large header. > # This is line 3230 of a file with a large header. > # This is line 3231 of a file with a large header. > # This is line 3232 of a file with a large header. > # This is line 3233 of a file with a large header. > # This is line 3234 of a file with a large header. > # This is line 3235 of a file with a large header. > # This is line 3236 of a file with a large header. > # This is line 3237 of a file with a large header. > # This is line 3238 of a file with a large header. > # This is line 3239 of a file with a large header. > # This is line 3240 of a file with a large header. > # This is line 3241 of a file with a large header. > # This is line 3242 of a file with a large header. > # This is line 3243 of a file with a large header. > # This is line 3244 of a file with a large header. > # This is line 3245 of a file with a large header. > # This is line 3246 of a file with a large header. > # This is line 3247 of a file with a large header. > # This is line 3248 of a file with a large header. > # This is line 3249 of a file with a large header. > # This is line 3250 of a file with a large header. > # This is line 3251 of a file with a large header. > # This is line 3252 of a file with a large header. > # This is line 3253 of a file with a large header. > # This is line 3254 of a file with a large header. > # This is line 3255 of a file with a large header. > # This is line 3256 of a file with a large header. > # This is line 3257 of a file with a large header. > # This is line 3258 of a file with a large header. > # This is line 3259 of a file with a large header. > # This is line 3260 of a file with a large header. > # This is line 3261 of a file with a large header. > # This is line 3262 of a file with a large header. > # This is line 3263 of a file with a large header. > # This is line 3264 of a file with a large header. > # This is line 3265 of a file with a large header. > # This is line 3266 of a file with a large header. > # This is line 3267 of a file with a large header. > # This is line 3268 of a file with a large header. > # This is line 3269 of a file with a large header. > # This is line 3270 of a file with a large header. > # This is line 3271 of a file with a large header. > # This is line 3272 of a file with a large header. > # This is line 3273 of a file with a large header. > # This is line 3274 of a file with a large header. > # This is line 3275 of a file with a large header. > # This is line 3276 of a file with a large header. > # This is line 3277 of a file with a large header. > # This is line 3278 of a file with a large header. > # This is line 3279 of a file with a large header. > # This is line 3280 of a file with a large header. > # This is line 3281 of a file with a large header. > # This is line 3282 of a file with a large header. > # This is line 3283 of a file with a large header. > # This is line 3284 of a file with a large header. > # This is line 3285 of a file with a large header. > # This is line 3286 of a file with a large header. > # This is line 3287 of a file with a large header. > # This is line 3288 of a file with a large header. > # This is line 3289 of a file with a large header. > # This is line 3290 of a file with a large header. > # This is line 3291 of a file with a large header. > # This is line 3292 of a file with a large header. > # This is line 3293 of a file with a large header. > # This is line 3294 of a file with a large header. > # This is line 3295 of a file with a large header. > # This is line 3296 of a file with a large header. > # This is line 3297 of a file with a large header. > # This is line 3298 of a file with a large header. > # This is line 3299 of a file with a large header. > # This is line 3300 of a file with a large header. > # This is line 3301 of a file with a large header. > # This is line 3302 of a file with a large header. > # This is line 3303 of a file with a large header. > # This is line 3304 of a file with a large header. > # This is line 3305 of a file with a large header. > # This is line 3306 of a file with a large header. > # This is line 3307 of a file with a large header. > # This is line 3308 of a file with a large header. > # This is line 3309 of a file with a large header. > # This is line 3310 of a file with a large header. > # This is line 3311 of a file with a large header. > # This is line 3312 of a file with a large header. > # This is line 3313 of a file with a large header. > # This is line 3314 of a file with a large header. > # This is line 3315 of a file with a large header. > # This is line 3316 of a file with a large header. > # This is line 3317 of a file with a large header. > # This is line 3318 of a file with a large header. > # This is line 3319 of a file with a large header. > # This is line 3320 of a file with a large header. > # This is line 3321 of a file with a large header. > # This is line 3322 of a file with a large header. > # This is line 3323 of a file with a large header. > # This is line 3324 of a file with a large header. > # This is line 3325 of a file with a large header. > # This is line 3326 of a file with a large header. > # This is line 3327 of a file with a large header. > # This is line 3328 of a file with a large header. > # This is line 3329 of a file with a large header. > # This is line 3330 of a file with a large header. > # This is line 3331 of a file with a large header. > # This is line 3332 of a file with a large header. > # This is line 3333 of a file with a large header. > # This is line 3334 of a file with a large header. > # This is line 3335 of a file with a large header. > # This is line 3336 of a file with a large header. > # This is line 3337 of a file with a large header. > # This is line 3338 of a file with a large header. > # This is line 3339 of a file with a large header. > # This is line 3340 of a file with a large header. > # This is line 3341 of a file with a large header. > # This is line 3342 of a file with a large header. > # This is line 3343 of a file with a large header. > # This is line 3344 of a file with a large header. > # This is line 3345 of a file with a large header. > # This is line 3346 of a file with a large header. > # This is line 3347 of a file with a large header. > # This is line 3348 of a file with a large header. > # This is line 3349 of a file with a large header. > # This is line 3350 of a file with a large header. > # This is line 3351 of a file with a large header. > # This is line 3352 of a file with a large header. > # This is line 3353 of a file with a large header. > # This is line 3354 of a file with a large header. > # This is line 3355 of a file with a large header. > # This is line 3356 of a file with a large header. > # This is line 3357 of a file with a large header. > # This is line 3358 of a file with a large header. > # This is line 3359 of a file with a large header. > # This is line 3360 of a file with a large header. > # This is line 3361 of a file with a large header. > # This is line 3362 of a file with a large header. > # This is line 3363 of a file with a large header. > # This is line 3364 of a file with a large header. > # This is line 3365 of a file with a large header. > # This is line 3366 of a file with a large header. > # This is line 3367 of a file with a large header. > # This is line 3368 of a file with a large header. > # This is line 3369 of a file with a large header. > # This is line 3370 of a file with a large header. > # This is line 3371 of a file with a large header. > # This is line 3372 of a file with a large header. > # This is line 3373 of a file with a large header. > # This is line 3374 of a file with a large header. > # This is line 3375 of a file with a large header. > # This is line 3376 of a file with a large header. > # This is line 3377 of a file with a large header. > # This is line 3378 of a file with a large header. > # This is line 3379 of a file with a large header. > # This is line 3380 of a file with a large header. > # This is line 3381 of a file with a large header. > # This is line 3382 of a file with a large header. > # This is line 3383 of a file with a large header. > # This is line 3384 of a file with a large header. > # This is line 3385 of a file with a large header. > # This is line 3386 of a file with a large header. > # This is line 3387 of a file with a large header. > # This is line 3388 of a file with a large header. > # This is line 3389 of a file with a large header. > # This is line 3390 of a file with a large header. > # This is line 3391 of a file with a large header. > # This is line 3392 of a file with a large header. > # This is line 3393 of a file with a large header. > # This is line 3394 of a file with a large header. > # This is line 3395 of a file with a large header. > # This is line 3396 of a file with a large header. > # This is line 3397 of a file with a large header. > # This is line 3398 of a file with a large header. > # This is line 3399 of a file with a large header. > # This is line 3400 of a file with a large header. > # This is line 3401 of a file with a large header. > # This is line 3402 of a file with a large header. > # This is line 3403 of a file with a large header. > # This is line 3404 of a file with a large header. > # This is line 3405 of a file with a large header. > # This is line 3406 of a file with a large header. > # This is line 3407 of a file with a large header. > # This is line 3408 of a file with a large header. > # This is line 3409 of a file with a large header. > # This is line 3410 of a file with a large header. > # This is line 3411 of a file with a large header. > # This is line 3412 of a file with a large header. > # This is line 3413 of a file with a large header. > # This is line 3414 of a file with a large header. > # This is line 3415 of a file with a large header. > # This is line 3416 of a file with a large header. > # This is line 3417 of a file with a large header. > # This is line 3418 of a file with a large header. > # This is line 3419 of a file with a large header. > # This is line 3420 of a file with a large header. > # This is line 3421 of a file with a large header. > # This is line 3422 of a file with a large header. > # This is line 3423 of a file with a large header. > # This is line 3424 of a file with a large header. > # This is line 3425 of a file with a large header. > # This is line 3426 of a file with a large header. > # This is line 3427 of a file with a large header. > # This is line 3428 of a file with a large header. > # This is line 3429 of a file with a large header. > # This is line 3430 of a file with a large header. > # This is line 3431 of a file with a large header. > # This is line 3432 of a file with a large header. > # This is line 3433 of a file with a large header. > # This is line 3434 of a file with a large header. > # This is line 3435 of a file with a large header. > # This is line 3436 of a file with a large header. > # This is line 3437 of a file with a large header. > # This is line 3438 of a file with a large header. > # This is line 3439 of a file with a large header. > # This is line 3440 of a file with a large header. > # This is line 3441 of a file with a large header. > # This is line 3442 of a file with a large header. > # This is line 3443 of a file with a large header. > # This is line 3444 of a file with a large header. > # This is line 3445 of a file with a large header. > # This is line 3446 of a file with a large header. > # This is line 3447 of a file with a large header. > # This is line 3448 of a file with a large header. > # This is line 3449 of a file with a large header. > # This is line 3450 of a file with a large header. > # This is line 3451 of a file with a large header. > # This is line 3452 of a file with a large header. > # This is line 3453 of a file with a large header. > # This is line 3454 of a file with a large header. > # This is line 3455 of a file with a large header. > # This is line 3456 of a file with a large header. > # This is line 3457 of a file with a large header. > # This is line 3458 of a file with a large header. > # This is line 3459 of a file with a large header. > # This is line 3460 of a file with a large header. > # This is line 3461 of a file with a large header. > # This is line 3462 of a file with a large header. > # This is line 3463 of a file with a large header. > # This is line 3464 of a file with a large header. > # This is line 3465 of a file with a large header. > # This is line 3466 of a file with a large header. > # This is line 3467 of a file with a large header. > # This is line 3468 of a file with a large header. > # This is line 3469 of a file with a large header. > # This is line 3470 of a file with a large header. > # This is line 3471 of a file with a large header. > # This is line 3472 of a file with a large header. > # This is line 3473 of a file with a large header. > # This is line 3474 of a file with a large header. > # This is line 3475 of a file with a large header. > # This is line 3476 of a file with a large header. > # This is line 3477 of a file with a large header. > # This is line 3478 of a file with a large header. > # This is line 3479 of a file with a large header. > # This is line 3480 of a file with a large header. > # This is line 3481 of a file with a large header. > # This is line 3482 of a file with a large header. > # This is line 3483 of a file with a large header. > # This is line 3484 of a file with a large header. > # This is line 3485 of a file with a large header. > # This is line 3486 of a file with a large header. > # This is line 3487 of a file with a large header. > # This is line 3488 of a file with a large header. > # This is line 3489 of a file with a large header. > # This is line 3490 of a file with a large header. > # This is line 3491 of a file with a large header. > # This is line 3492 of a file with a large header. > # This is line 3493 of a file with a large header. > # This is line 3494 of a file with a large header. > # This is line 3495 of a file with a large header. > # This is line 3496 of a file with a large header. > # This is line 3497 of a file with a large header. > # This is line 3498 of a file with a large header. > # This is line 3499 of a file with a large header. > # This is line 3500 of a file with a large header. > # This is line 3501 of a file with a large header. > # This is line 3502 of a file with a large header. > # This is line 3503 of a file with a large header. > # This is line 3504 of a file with a large header. > # This is line 3505 of a file with a large header. > # This is line 3506 of a file with a large header. > # This is line 3507 of a file with a large header. > # This is line 3508 of a file with a large header. > # This is line 3509 of a file with a large header. > # This is line 3510 of a file with a large header. > # This is line 3511 of a file with a large header. > # This is line 3512 of a file with a large header. > # This is line 3513 of a file with a large header. > # This is line 3514 of a file with a large header. > # This is line 3515 of a file with a large header. > # This is line 3516 of a file with a large header. > # This is line 3517 of a file with a large header. > # This is line 3518 of a file with a large header. > # This is line 3519 of a file with a large header. > # This is line 3520 of a file with a large header. > # This is line 3521 of a file with a large header. > # This is line 3522 of a file with a large header. > # This is line 3523 of a file with a large header. > # This is line 3524 of a file with a large header. > # This is line 3525 of a file with a large header. > # This is line 3526 of a file with a large header. > # This is line 3527 of a file with a large header. > # This is line 3528 of a file with a large header. > # This is line 3529 of a file with a large header. > # This is line 3530 of a file with a large header. > # This is line 3531 of a file with a large header. > # This is line 3532 of a file with a large header. > # This is line 3533 of a file with a large header. > # This is line 3534 of a file with a large header. > # This is line 3535 of a file with a large header. > # This is line 3536 of a file with a large header. > # This is line 3537 of a file with a large header. > # This is line 3538 of a file with a large header. > # This is line 3539 of a file with a large header. > # This is line 3540 of a file with a large header. > # This is line 3541 of a file with a large header. > # This is line 3542 of a file with a large header. > # This is line 3543 of a file with a large header. > # This is line 3544 of a file with a large header. > # This is line 3545 of a file with a large header. > # This is line 3546 of a file with a large header. > # This is line 3547 of a file with a large header. > # This is line 3548 of a file with a large header. > # This is line 3549 of a file with a large header. > # This is line 3550 of a file with a large header. > # This is line 3551 of a file with a large header. > # This is line 3552 of a file with a large header. > # This is line 3553 of a file with a large header. > # This is line 3554 of a file with a large header. > # This is line 3555 of a file with a large header. > # This is line 3556 of a file with a large header. > # This is line 3557 of a file with a large header. > # This is line 3558 of a file with a large header. > # This is line 3559 of a file with a large header. > # This is line 3560 of a file with a large header. > # This is line 3561 of a file with a large header. > # This is line 3562 of a file with a large header. > # This is line 3563 of a file with a large header. > # This is line 3564 of a file with a large header. > # This is line 3565 of a file with a large header. > # This is line 3566 of a file with a large header. > # This is line 3567 of a file with a large header. > # This is line 3568 of a file with a large header. > # This is line 3569 of a file with a large header. > # This is line 3570 of a file with a large header. > # This is line 3571 of a file with a large header. > # This is line 3572 of a file with a large header. > # This is line 3573 of a file with a large header. > # This is line 3574 of a file with a large header. > # This is line 3575 of a file with a large header. > # This is line 3576 of a file with a large header. > # This is line 3577 of a file with a large header. > # This is line 3578 of a file with a large header. > # This is line 3579 of a file with a large header. > # This is line 3580 of a file with a large header. > # This is line 3581 of a file with a large header. > # This is line 3582 of a file with a large header. > # This is line 3583 of a file with a large header. > # This is line 3584 of a file with a large header. > # This is line 3585 of a file with a large header. > # This is line 3586 of a file with a large header. > # This is line 3587 of a file with a large header. > # This is line 3588 of a file with a large header. > # This is line 3589 of a file with a large header. > # This is line 3590 of a file with a large header. > # This is line 3591 of a file with a large header. > # This is line 3592 of a file with a large header. > # This is line 3593 of a file with a large header. > # This is line 3594 of a file with a large header. > # This is line 3595 of a file with a large header. > # This is line 3596 of a file with a large header. > # This is line 3597 of a file with a large header. > # This is line 3598 of a file with a large header. > # This is line 3599 of a file with a large header. > # This is line 3600 of a file with a large header. > # This is line 3601 of a file with a large header. > # This is line 3602 of a file with a large header. > # This is line 3603 of a file with a large header. > # This is line 3604 of a file with a large header. > # This is line 3605 of a file with a large header. > # This is line 3606 of a file with a large header. > # This is line 3607 of a file with a large header. > # This is line 3608 of a file with a large header. > # This is line 3609 of a file with a large header. > # This is line 3610 of a file with a large header. > # This is line 3611 of a file with a large header. > # This is line 3612 of a file with a large header. > # This is line 3613 of a file with a large header. > # This is line 3614 of a file with a large header. > # This is line 3615 of a file with a large header. > # This is line 3616 of a file with a large header. > # This is line 3617 of a file with a large header. > # This is line 3618 of a file with a large header. > # This is line 3619 of a file with a large header. > # This is line 3620 of a file with a large header. > # This is line 3621 of a file with a large header. > # This is line 3622 of a file with a large header. > # This is line 3623 of a file with a large header. > # This is line 3624 of a file with a large header. > # This is line 3625 of a file with a large header. > # This is line 3626 of a file with a large header. > # This is line 3627 of a file with a large header. > # This is line 3628 of a file with a large header. > # This is line 3629 of a file with a large header. > # This is line 3630 of a file with a large header. > # This is line 3631 of a file with a large header. > # This is line 3632 of a file with a large header. > # This is line 3633 of a file with a large header. > # This is line 3634 of a file with a large header. > # This is line 3635 of a file with a large header. > # This is line 3636 of a file with a large header. > # This is line 3637 of a file with a large header. > # This is line 3638 of a file with a large header. > # This is line 3639 of a file with a large header. > # This is line 3640 of a file with a large header. > # This is line 3641 of a file with a large header. > # This is line 3642 of a file with a large header. > # This is line 3643 of a file with a large header. > # This is line 3644 of a file with a large header. > # This is line 3645 of a file with a large header. > # This is line 3646 of a file with a large header. > # This is line 3647 of a file with a large header. > # This is line 3648 of a file with a large header. > # This is line 3649 of a file with a large header. > # This is line 3650 of a file with a large header. > # This is line 3651 of a file with a large header. > # This is line 3652 of a file with a large header. > # This is line 3653 of a file with a large header. > # This is line 3654 of a file with a large header. > # This is line 3655 of a file with a large header. > # This is line 3656 of a file with a large header. > # This is line 3657 of a file with a large header. > # This is line 3658 of a file with a large header. > # This is line 3659 of a file with a large header. > # This is line 3660 of a file with a large header. > # This is line 3661 of a file with a large header. > # This is line 3662 of a file with a large header. > # This is line 3663 of a file with a large header. > # This is line 3664 of a file with a large header. > # This is line 3665 of a file with a large header. > # This is line 3666 of a file with a large header. > # This is line 3667 of a file with a large header. > # This is line 3668 of a file with a large header. > # This is line 3669 of a file with a large header. > # This is line 3670 of a file with a large header. > # This is line 3671 of a file with a large header. > # This is line 3672 of a file with a large header. > # This is line 3673 of a file with a large header. > # This is line 3674 of a file with a large header. > # This is line 3675 of a file with a large header. > # This is line 3676 of a file with a large header. > # This is line 3677 of a file with a large header. > # This is line 3678 of a file with a large header. > # This is line 3679 of a file with a large header. > # This is line 3680 of a file with a large header. > # This is line 3681 of a file with a large header. > # This is line 3682 of a file with a large header. > # This is line 3683 of a file with a large header. terminate called after throwing an instance of 'BamTools::Internal::BamException' > # This is line 3684 of a file with a large header. > # This is line 3685 of a file with a large header. > # This is line 3686 of a file with a large header. > # This is line 3687 of a file with a large header. > # This is line 3688 of a file with a large header. > # This is line 3689 of a file with a large header. what(): BgzfStream::ReadBlock: invalid block header contents > # This is line 3690 of a file with a large header. > # This is line 3691 of a file with a large header. > # This is line 3692 of a file with a large header. > # This is line 3693 of a file with a large header. > # This is line 3694 of a file with a large header. > # This is line 3695 of a file with a large header. > # This is line 3696 of a file with a large header. > # This is line 3697 of a file with a large header. > # This is line 3698 of a file with a large header. > # This is line 3699 of a file with a large header. > # This is line 3700 of a file with a large header. > # This is line 3701 of a file with a large header. > # This is line 3702 of a file with a large header. > # This is line 3703 of a file with a large header. > # This is line 3704 of a file with a large header. > # This is line 3705 of a file with a large header. > # This is line 3706 of a file with a large header. > # This is line 3707 of a file with a large header. > # This is line 3708 of a file with a large header. > # This is line 3709 of a file with a large header. > # This is line 3710 of a file with a large header. > # This is line 3711 of a file with a large header. > # This is line 3712 of a file with a large header. > # This is line 3713 of a file with a large header. > # This is line 3714 of a file with a large header. > # This is line 3715 of a file with a large header. > # This is line 3716 of a file with a large header. > # This is line 3717 of a file with a large header. > # This is line 3718 of a file with a large header. > # This is line 3719 of a file with a large header. > # This is line 3720 of a file with a large header. > # This is line 3721 of a file with a large header. > # This is line 3722 of a file with a large header. > # This is line 3723 of a file with a large header. > # This is line 3724 of a file with a large header. > # This is line 3725 of a file with a large header. > # This is line 3726 of a file with a large header. > # This is line 3727 of a file with a large header. > # This is line 3728 of a file with a large header. > # This is line 3729 of a file with a large header. > # This is line 3730 of a file with a large header. > # This is line 3731 of a file with a large header. > # This is line 3732 of a file with a large header. > # This is line 3733 of a file with a large header. > # This is line 3734 of a file with a large header. > # This is line 3735 of a file with a large header. > # This is line 3736 of a file with a large header. > # This is line 3737 of a file with a large header. > # This is line 3738 of a file with a large header. > # This is line 3739 of a file with a large header. > # This is line 3740 of a file with a large header. > # This is line 3741 of a file with a large header. > # This is line 3742 of a file with a large header. > # This is line 3743 of a file with a large header. > # This is line 3744 of a file with a large header. > # This is line 3745 of a file with a large header. > # This is line 3746 of a file with a large header. > # This is line 3747 of a file with a large header. > # This is line 3748 of a file with a large header. > # This is line 3749 of a file with a large header. > # This is line 3750 of a file with a large header. > # This is line 3751 of a file with a large header. > # This is line 3752 of a file with a large header. > # This is line 3753 of a file with a large header. > # This is line 3754 of a file with a large header. > # This is line 3755 of a file with a large header. > # This is line 3756 of a file with a large header. > # This is line 3757 of a file with a large header. > # This is line 3758 of a file with a large header. > # This is line 3759 of a file with a large header. new_test-intersect.sh: line 640: 15681 Aborted $BT intersect -a gdc.bam -b gdc.bam -bed > obs > # This is line 3760 of a file with a large header. > # This is line 3761 of a file with a large header. > # This is line 3762 of a file with a large header. > # This is line 3763 of a file with a large header. > # This is line 3764 of a file with a large header. > # This is line 3765 of a file with a large header. > # This is line 3766 of a file with a large header. > # This is line 3767 of a file with a large header. > # This is line 3768 of a file with a large header. > # This is line 3769 of a file with a large header. > # This is line 3770 of a file with a large header. > # This is line 3771 of a file with a large header. > # This is line 3772 of a file with a large header. > # This is line 3773 of a file with a large header. > # This is line 3774 of a file with a large header. > # This is line 3775 of a file with a large header. > # This is line 3776 of a file with a large header. > # This is line 3777 of a file with a large header. > # This is line 3778 of a file with a large header. > # This is line 3779 of a file with a large header. > # This is line 3780 of a file with a large header. > # This is line 3781 of a file with a large header. > # This is line 3782 of a file with a large header. > # This is line 3783 of a file with a large header. > # This is line 3784 of a file with a large header. > # This is line 3785 of a file with a large header. > # This is line 3786 of a file with a large header. > # This is line 3787 of a file with a large header. > # This is line 3788 of a file with a large header. > # This is line 3789 of a file with a large header. > # This is line 3790 of a file with a large header. > # This is line 3791 of a file with a large header. > # This is line 3792 of a file with a large header. > # This is line 3793 of a file with a large header. > # This is line 3794 of a file with a large header. > # This is line 3795 of a file with a large header. > # This is line 3796 of a file with a large header. > # This is line 3797 of a file with a large header. > # This is line 3798 of a file with a large header. > # This is line 3799 of a file with a large header. > # This is line 3800 of a file with a large header. > # This is line 3801 of a file with a large header. > # This is line 3802 of a file with a large header. > # This is line 3803 of a file with a large header. > # This is line 3804 of a file with a large header. > # This is line 3805 of a file with a large header. > # This is line 3806 of a file with a large header. > # This is line 3807 of a file with a large header. > # This is line 3808 of a file with a large header. > # This is line 3809 of a file with a large header. > # This is line 3810 of a file with a large header. > # This is line 3811 of a file with a large header. > # This is line 3812 of a file with a large header. > # This is line 3813 of a file with a large header. > # This is line 3814 of a file with a large header. > # This is line 3815 of a file with a large header. > # This is line 3816 of a file with a large header. > # This is line 3817 of a file with a large header. > # This is line 3818 of a file with a large header. > # This is line 3819 of a file with a large header. > # This is line 3820 of a file with a large header. > # This is line 3821 of a file with a large header. > # This is line 3822 of a file with a large header. > # This is line 3823 of a file with a large header. > # This is line 3824 of a file with a large header. > # This is line 3825 of a file with a large header. > # This is line 3826 of a file with a large header. > # This is line 3827 of a file with a large header. > # This is line 3828 of a file with a large header. > # This is line 3829 of a file with a large header. > # This is line 3830 of a file with a large header. > # This is line 3831 of a file with a large header. > # This is line 3832 of a file with a large header. > # This is line 3833 of a file with a large header. > # This is line 3834 of a file with a large header. > # This is line 3835 of a file with a large header. > # This is line 3836 of a file with a large header. > # This is line 3837 of a file with a large header. > # This is line 3838 of a file with a large header. > # This is line 3839 of a file with a large header. > # This is line 3840 of a file with a large header. > # This is line 3841 of a file with a large header. > # This is line 3842 of a file with a large header. > # This is line 3843 of a file with a large header. > # This is line 3844 of a file with a large header. > # This is line 3845 of a file with a large header. > # This is line 3846 of a file with a large header. > # This is line 3847 of a file with a large header. > # This is line 3848 of a file with a large header. > # This is line 3849 of a file with a large header. > # This is line 3850 of a file with a large header. > # This is line 3851 of a file with a large header. > # This is line 3852 of a file with a large header. > # This is line 3853 of a file with a large header. > # This is line 3854 of a file with a large header. > # This is line 3855 of a file with a large header. > # This is line 3856 of a file with a large header. > # This is line 3857 of a file with a large header. > # This is line 3858 of a file with a large header. > # This is line 3859 of a file with a large header. > # This is line 3860 of a file with a large header. > # This is line 3861 of a file with a large header. > # This is line 3862 of a file with a large header. > # This is line 3863 of a file with a large header. > # This is line 3864 of a file with a large header. > # This is line 3865 of a file with a large header. > # This is line 3866 of a file with a large header. > # This is line 3867 of a file with a large header. > # This is line 3868 of a file with a large header. > # This is line 3869 of a file with a large header. > # This is line 3870 of a file with a large header. > # This is line 3871 of a file with a large header. > # This is line 3872 of a file with a large header. > # This is line 3873 of a file with a large header. > # This is line 3874 of a file with a large header. > # This is line 3875 of a file with a large header. > # This is line 3876 of a file with a large header. > # This is line 3877 of a file with a large header. > # This is line 3878 of a file with a large header. > # This is line 3879 of a file with a large header. > # This is line 3880 of a file with a large header. > # This is line 3881 of a file with a large header. > # This is line 3882 of a file with a large header. > # This is line 3883 of a file with a large header. > # This is line 3884 of a file with a large header. > # This is line 3885 of a file with a large header. > # This is line 3886 of a file with a large header. > # This is line 3887 of a file with a large header. > # This is line 3888 of a file with a large header. > # This is line 3889 of a file with a large header. > # This is line 3890 of a file with a large header. > # This is line 3891 of a file with a large header. > # This is line 3892 of a file with a large header. > # This is line 3893 of a file with a large header. > # This is line 3894 of a file with a large header. > # This is line 3895 of a file with a large header. > # This is line 3896 of a file with a large header. > # This is line 3897 of a file with a large header. > # This is line 3898 of a file with a large header. > # This is line 3899 of a file with a large header. > # This is line 3900 of a file with a large header. > # This is line 3901 of a file with a large header. > # This is line 3902 of a file with a large header. > # This is line 3903 of a file with a large header. > # This is line 3904 of a file with a large header. > # This is line 3905 of a file with a large header. > # This is line 3906 of a file with a large header. > # This is line 3907 of a file with a large header. > # This is line 3908 of a file with a large header. > # This is line 3909 of a file with a large header. > # This is line 3910 of a file with a large header. > # This is line 3911 of a file with a large header. > # This is line 3912 of a file with a large header. > # This is line 3913 of a file with a large header. > # This is line 3914 of a file with a large header. > # This is line 3915 of a file with a large header. > # This is line 3916 of a file with a large header. > # This is line 3917 of a file with a large header. > # This is line 3918 of a file with a large header. > # This is line 3919 of a file with a large header. > # This is line 3920 of a file with a large header. > # This is line 3921 of a file with a large header. > # This is line 3922 of a file with a large header. > # This is line 3923 of a file with a large header. > # This is line 3924 of a file with a large header. > # This is line 3925 of a file with a large header. > # This is line 3926 of a file with a large header. > # This is line 3927 of a file with a large header. > # This is line 3928 of a file with a large header. > # This is line 3929 of a file with a large header. > # This is line 3930 of a file with a large header. > # This is line 3931 of a file with a large header. > # This is line 3932 of a file with a large header. > # This is line 3933 of a file with a large header. > # This is line 3934 of a file with a large header. > # This is line 3935 of a file with a large header. > # This is line 3936 of a file with a large header. > # This is line 3937 of a file with a large header. > # This is line 3938 of a file with a large header. > # This is line 3939 of a file with a large header. > # This is line 3940 of a file with a large header. > # This is line 3941 of a file with a large header. > # This is line 3942 of a file with a large header. > # This is line 3943 of a file with a large header. > # This is line 3944 of a file with a large header. > # This is line 3945 of a file with a large header. > # This is line 3946 of a file with a large header. > # This is line 3947 of a file with a large header. > # This is line 3948 of a file with a large header. > # This is line 3949 of a file with a large header. > # This is line 3950 of a file with a large header. > # This is line 3951 of a file with a large header. > # This is line 3952 of a file with a large header. > # This is line 3953 of a file with a large header. > # This is line 3954 of a file with a large header. > # This is line 3955 of a file with a large header. > # This is line 3956 of a file with a large header. > # This is line 3957 of a file with a large header. > # This is line 3958 of a file with a large header. > # This is line 3959 of a file with a large header. > # This is line 3960 of a file with a large header. > # This is line 3961 of a file with a large header. > # This is line 3962 of a file with a large header. > # This is line 3963 of a file with a large header. > # This is line 3964 of a file with a large header. > # This is line 3965 of a file with a large header. > # This is line 3966 of a file with a large header. > # This is line 3967 of a file with a large header. > # This is line 3968 of a file with a large header. > # This is line 3969 of a file with a large header. > # This is line 3970 of a file with a large header. > # This is line 3971 of a file with a large header. > # This is line 3972 of a file with a large header. > # This is line 3973 of a file with a large header. > # This is line 3974 of a file with a large header. > # This is line 3975 of a file with a large header. > # This is line 3976 of a file with a large header. > # This is line 3977 of a file with a large header. > # This is line 3978 of a file with a large header. > # This is line 3979 of a file with a large header. > # This is line 3980 of a file with a large header. > # This is line 3981 of a file with a large header. > # This is line 3982 of a file with a large header. > # This is line 3983 of a file with a large header. > # This is line 3984 of a file with a large header. > # This is line 3985 of a file with a large header. > # This is line 3986 of a file with a large header. > # This is line 3987 of a file with a large header. > # This is line 3988 of a file with a large header. > # This is line 3989 of a file with a large header. > # This is line 3990 of a file with a large header. > # This is line 3991 of a file with a large header. > # This is line 3992 of a file with a large header. > # This is line 3993 of a file with a large header. > # This is line 3994 of a file with a large header. > # This is line 3995 of a file with a large header. > # This is line 3996 of a file with a large header. > # This is line 3997 of a file with a large header. > # This is line 3998 of a file with a large header. > # This is line 3999 of a file with a large header. > chr1 100 101 a2 2 - > chr1 100 110 a2 2 - fail intersect.new.t48...\c ok intersect.new.t49...\c ok intersect.new.t50...\c ok intersect.new.t51...\c ok intersect.new.t52...\c ok intersect.new.t53...\c 0a1,12 > chr2L 10 15 None 255 + 10 15 0,0,0 1 5, 0, > chr2L 70 75 None 255 - 70 75 0,0,0 1 5, 0, > chr2L 70 75 None 255 - 70 75 0,0,0 1 5, 0, > chr2L 140 145 None 255 - 140 145 0,0,0 1 5, 0, > chr2L 140 145 None 255 - 140 145 0,0,0 1 5, 0, > chr2L 150 155 None 255 - 150 155 0,0,0 1 5, 0, > chr2L 210 215 None 255 + 210 215 0,0,0 1 5, 0, > chr2L 70 75 None 255 + 70 75 0,0,0 1 5, 0, > chr2L 70 75 None 255 + 70 75 0,0,0 1 5, 0, > chr2L 140 145 None 255 + 140 145 0,0,0 1 5, 0, > chr2L 140 145 None 255 + 140 145 0,0,0 1 5, 0, > chr2L 160 165 None 255 + 160 165 0,0,0 1 5, 0, fail intersect.new.t54...\c 1c1 < what(): BgzfStream::ReadBlock: invalid block header contents --- > ***** ERROR: writeAllOverlap option is not valid with BAM query input, unless bed output is specified with -bed option. ***** fail intersect.new.t55...\c ok intersect.new.t56...\c ok intersect.new.t57...\c ok intersect.new.t58...\c ok intersect.new.t59...\c ok intersect.new.t60...\c ok intersect.new.t61...\c new_test-intersect.sh: line 731: bgzip: command not found Error: Unable to open file dummy.txt.gz. Exiting. 0a1 > #Random Header fail rm: cannot remove 'dummy.txt.gz': No such file or directory intersect.new.t62...\c ok intersect.new.t63...\c ok intersect.new.t64...\c ok intersect.new.t65...\c ok intersect.new.t66...\c ok intersect.new.t67...\c ok intersect.new.t68...\c ok Testing bedtools jaccard: jaccard.t01...\c ok jaccard.t02...\c ok jaccard.t03...\c ok jaccard.t05...\c ok jaccard.t06...\c ok jaccard.t07...\c ok jaccard.t08...\c ok jaccard.t09...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-jaccard.sh: line 93: 15764 Aborted $BT jaccard -a a.bam -b three_blocks_match.bam -bed > obs 1,2d0 < intersection union-intersection jaccard n_intersections < 10 150 0.0666667 1 fail jaccard.t10...\c ok jaccard.t11...\c ok jaccard.t12...\c ok jaccard.t13...\c ok Testing bedtools map: map.t01...\c ok map.t02...\c ok map.t03...\c ok map.t04...\c ok map.t05...\c ok map.t06...\c ok map.t07...\c ok map.t08...\c ok map.t09...\c ok map.t10...\c ok map.t11...\c ok map.t12...\c ok map.t13...\c ok map.t14...\c ok map.t15...\c ok map.t16...\c ok map.t17...\c ok map.t18...\c ok map.t19...\c ok map.t20...\c ok map.t21...\c ok map.t22..\c ok map.t23..\c ok map.t24..\c ok map.t25..\c ok map.t26..\c ok map.t27..\c ok map.t28..\c ok map.t29..\c ok map.t30..\c ok map.t31..\c ok map.t32..\c ok map.t33..\c ok map.t33..\c ok map.t33..\c ok map.t34..\c ok map.t35..\c ok map.t36..\c ok map.t37..\c ok map.t38..\c ok map.t39..\c ok map.t40..\c ok map.t41..\c ok map.t42..\c ok map.t43..\c ok map.t44...\c ok map.t45...\c ok map.t46...\c ok map.t47...\c ok map.t48...\c ok map.t49...\c ok map.t50...\c ok map.t51...\c ok map.t52...\c ok map.t53...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-map.sh: line 808: 15937 Aborted $BT map -a d.bed -b fullFields.bam -c 5 -o mean > obs 1,2d0 < chr1 10000 12000 2.5 < chr1 15000 20000 11.44444444 fail map.t54...\c ok map.t55...\c ok Testing bedtools merge: merge.t1...\c ok merge.t2...\c ok merge.t3...\c ok merge.t4...\c ok merge.t5...\c ok merge.t6...\c ok merge.t7...\c ok merge.t8...\c ok merge.t9...\c ok merge.t10...\c ok merge.t11...\c ok merge.t12...\c ok merge.t13...\c ok merge.t14...\c ok merge.t15...\c ok merge.t16...\c ok merge.t17...\c ok merge.t18...\c ok merge.t19...\c ok merge.t20...\c ok merge.t21...\c ok merge.t22...\c ok merge.t23a...\c ok merge.t23b...\c ok merge.t24...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 337: 16025 Aborted $BT merge -i fullFields.bam -c 1 -o collapse > obs 0a1,112 > chr1 10003 10143 FCC1MK2ACXX:2:2110:4301:28831#/1,FCC1MK2ACXX:2:2110:4301:28831#/2 > chr1 10358 10428 FCC21NUACXX:5:2103:2764:46055#/2 > chr1 11780 11921 FCC1MK2ACXX:2:1105:2715:51181#/1,FCD243JACXX:5:1216:17736:35719#/1 > chr1 11996 12101 FCC1MK2ACXX:2:2304:9851:96789#/1,FCD243JACXX:5:2314:4768:97687#/2 > chr1 12136 12347 FCC1MK2ACXX:2:1105:2715:51181#/2,FCD243JACXX:5:1301:1537:86102#/1,FCD243JACXX:5:1216:17736:35719#/2,FCC21NUACXX:5:1212:12308:57061#/1 > chr1 12400 12503 FCC1MK2ACXX:2:2304:9851:96789#/2,FCD243JACXX:5:2314:4768:97687#/1 > chr1 12635 12779 FCD243JACXX:5:1301:1537:86102#/2,FCC21NUACXX:5:1212:12308:57061#/2,FCC21NUACXX:5:1112:9784:5716#/1 > chr1 12819 12919 FCC21NUACXX:5:2206:3702:42671#/1 > chr1 13039 13139 FCC21NUACXX:5:1112:9784:5716#/2 > chr1 13165 13287 FCC1MK2ACXX:2:2303:7698:86735#/1,FCC21NUACXX:5:2206:3702:42671#/2 > chr1 13561 13731 FCC1MK2ACXX:2:2303:7698:86735#/2,FCC21NUACXX:5:2314:9596:94920#/2 > chr1 14025 14125 FCC21NUACXX:5:2314:9596:94920#/1 > chr1 14221 14340 FCC1MK2ACXX:1:1102:8457:72597#/1,FCC1MK2ACXX:2:2112:4058:13620#/1 > chr1 14440 14715 FCC21NUACXX:5:1111:11242:55963#/2,FCC1MK2ACXX:1:1305:10748:71369#/1,FCC1MK2ACXX:2:1301:6022:22944#/1,FCC21NUACXX:5:2302:8976:47710#/1,FCC1MK2ACXX:2:2112:4058:13620#/2,FCC1MK2ACXX:1:1102:8457:72597#/2 > chr1 14805 15172 FCC21NUACXX:5:1111:11242:55963#/1,FCC1MK2ACXX:1:2312:10383:17891#/1,FCC1MK2ACXX:2:1301:6022:22944#/2,FCC1MK2ACXX:1:1305:10748:71369#/2,FCC21NUACXX:5:2302:8976:47710#/2,FCD243JACXX:5:2101:5803:26445#/2,FCD243JACXX:5:1306:3361:79162#/1 > chr1 15250 15350 FCC1MK2ACXX:1:2312:10383:17891#/2 > chr1 15470 15603 FCD243JACXX:5:2101:5803:26445#/1,FCD243JACXX:5:1306:3361:79162#/2 > chr1 15924 16065 FCC1MK2ACXX:2:2307:8459:94884#/2,FCC21NUACXX:5:2306:5997:33003#/1 > chr1 16155 16255 FCC1MK2ACXX:1:2113:15434:7030#/2 > chr1 16314 16438 FCC1MK2ACXX:2:2307:8459:94884#/1,FCC21NUACXX:5:2306:5997:33003#/2 > chr1 16561 16661 FCC1MK2ACXX:1:2113:15434:7030#/1 > chr1 16945 17038 FCD243JACXX:5:1116:14466:64207#/2 > chr1 17372 17472 FCD243JACXX:5:1116:14466:64207#/1 > chr1 17525 17625 FCC1MK2ACXX:2:1103:5984:72352#/1 > chr1 17634 17734 FCC21NUACXX:5:2308:4380:13608#/1 > chr1 17908 18008 FCC1MK2ACXX:2:1103:5984:72352#/2 > chr1 18033 18133 FCC21NUACXX:5:2308:4380:13608#/2 > chr1 18152 18252 FCC1MK2ACXX:1:2312:1386:94004#/1 > chr1 18264 18364 FCC1MK2ACXX:2:2202:3770:94682#/2 > chr1 18577 18742 FCC1MK2ACXX:1:2312:1386:94004#/2,FCC1MK2ACXX:2:2202:3770:94682#/1 > chr1 19658 19758 FCC21NUACXX:5:2304:1410:22583#/2 > chr1 19819 19966 FCD243JACXX:5:1211:5529:13528#/2,FCC21NUACXX:5:1203:9494:8389#/2 > chr1 20059 20320 FCC21NUACXX:5:2304:1410:22583#/1,FCC1MK2ACXX:1:1208:13559:62335#/2,FCC21NUACXX:5:2305:4114:54016#/1,FCC21NUACXX:5:2310:12288:39217#/2,FCC21NUACXX:5:1203:9494:8389#/1,FCD243JACXX:5:1211:5529:13528#/1 > chr1 20457 20627 FCC1MK2ACXX:1:1208:13559:62335#/1,FCC21NUACXX:5:2305:4114:54016#/2,FCC21NUACXX:5:2310:12288:39217#/1 > chr1 20641 20741 FCC21NUACXX:5:2202:3364:43471#/2 > chr1 20754 20854 FCD243JACXX:5:1109:11059:8948#/2 > chr1 21047 21139 FCC21NUACXX:5:2202:3364:43471#/1 > chr1 21177 21277 FCD243JACXX:5:1109:11059:8948#/1 > chr1 21449 21549 FCC21NUACXX:5:2102:15551:71760#/1 > chr1 21834 22029 FCC21NUACXX:5:2102:15551:71760#/2,FCC21NUACXX:5:1213:10990:48576#/1,FCC1MK2ACXX:1:1204:5539:11398#/1,FCD243JACXX:5:2310:5628:73793#/2 > chr1 22061 22149 FCD243JACXX:5:1310:4328:99408#/2 > chr1 22242 22448 FCC21NUACXX:5:1213:10990:48576#/2,FCC21NUACXX:5:2213:17167:65551#/2,FCC21NUACXX:5:2213:17167:65551#/1,FCC1MK2ACXX:1:1204:5539:11398#/2,FCD243JACXX:5:2310:5628:73793#/1 > chr1 22512 22566 FCD243JACXX:5:1310:4328:99408#/1 > chr1 22748 22848 FCC1MK2ACXX:1:2305:2692:50678#/2 > chr1 22870 22970 FCC1MK2ACXX:2:2214:11805:76913#/1 > chr1 23130 23228 FCC1MK2ACXX:1:2305:2692:50678#/1 > chr1 23250 23350 FCC1MK2ACXX:2:2214:11805:76913#/2 > chr1 23557 23615 FCC1MK2ACXX:2:1114:5825:36701#/2 > chr1 24000 24120 FCC1MK2ACXX:2:1114:5825:36701#/1,FCD243JACXX:5:2201:8592:8770#/1 > chr1 24248 24612 FCD243JACXX:5:2315:13027:60427#/1,FCC1MK2ACXX:2:1209:11103:92852#/1,FCD243JACXX:5:1312:20719:89268#/1,FCC1MK2ACXX:2:1209:11103:92852#/2,FCD243JACXX:5:2201:8592:8770#/2,FCC1MK2ACXX:1:2310:10881:15393#/1 > chr1 24683 24850 FCD243JACXX:5:2315:13027:60427#/2,FCC21NUACXX:5:2112:11980:18488#/2,FCD243JACXX:5:1312:20719:89268#/2 > chr1 24921 25011 FCC1MK2ACXX:1:2310:10881:15393#/2 > chr1 25055 25291 FCC21NUACXX:5:2112:11980:18488#/1,FCD243JACXX:5:2206:12649:46794#/1,FCC21NUACXX:5:2205:15793:62044#/2,FCD243JACXX:5:2201:18078:18754#/2 > chr1 25403 25740 FCC21NUACXX:5:1216:7574:73145#/1,FCD243JACXX:5:2206:12649:46794#/2,FCC21NUACXX:5:2205:15793:62044#/1,FCD243JACXX:5:2201:18078:18754#/1,FCD243JACXX:5:1112:4148:89702#/2 > chr1 25767 25867 FCC21NUACXX:5:1216:7574:73145#/2 > chr1 26053 26153 FCD243JACXX:5:1112:4148:89702#/1 > chr1 26406 26506 FCC1MK2ACXX:2:2307:2158:37901#/1 > chr1 26680 26883 FCC1MK2ACXX:1:2213:6949:42393#/2,FCC1MK2ACXX:1:2315:18190:6749#/1,FCD243JACXX:5:1105:21169:9826#/1,FCC1MK2ACXX:2:2307:2158:37901#/2 > chr1 27102 27252 FCC1MK2ACXX:1:2213:6949:42393#/1,FCC1MK2ACXX:1:2315:18190:6749#/2,FCD243JACXX:5:1105:21169:9826#/2 > chr1 27582 27785 FCC1MK2ACXX:1:2114:20853:3283#/2,FCC1MK2ACXX:1:1316:3838:11731#/2,FCD243JACXX:5:2201:11248:70268#/1,FCC21NUACXX:5:1202:18034:57963#/1 > chr1 27995 28187 FCC1MK2ACXX:1:2114:20853:3283#/1,FCD243JACXX:5:1202:13909:65993#/2,FCC1MK2ACXX:1:1316:3838:11731#/1,FCC1MK2ACXX:1:1111:9873:22822#/1,FCC21NUACXX:5:1202:18034:57963#/2,FCD243JACXX:5:2201:11248:70268#/2 > chr1 28198 28298 FCC21NUACXX:5:1303:10255:6040#/1 > chr1 28439 28545 FCC1MK2ACXX:1:1111:9873:22822#/2,FCD243JACXX:5:1202:13909:65993#/1 > chr1 28577 28674 FCC21NUACXX:5:1303:10255:6040#/2 > chr1 28679 28808 FCC1MK2ACXX:1:1106:8013:94636#/2,FCC1MK2ACXX:2:2304:3217:85023#/2 > chr1 29089 29191 FCC1MK2ACXX:2:2304:3217:85023#/1,FCC1MK2ACXX:1:1106:8013:94636#/1 > chr1 29331 29431 FCC1MK2ACXX:2:2210:9985:83633#/2 > chr1 29686 29786 FCC1MK2ACXX:2:2210:9985:83633#/1 > chr1 30409 30509 FCC1MK2ACXX:1:1301:14019:75418#/2 > chr1 30809 30909 FCC1MK2ACXX:1:1301:14019:75418#/1 > chr1 31781 31881 FCC1MK2ACXX:1:1112:12970:36191#/1 > chr1 32173 32273 FCC1MK2ACXX:1:1112:12970:36191#/2 > chr1 32519 32619 FCD243JACXX:5:1311:16724:97626#/1 > chr1 32732 32832 FCD243JACXX:5:1316:15289:11879#/1 > chr1 32926 33120 FCD243JACXX:5:1311:16724:97626#/2,FCD243JACXX:5:1313:2205:21712#/2 > chr1 33143 33289 FCD243JACXX:5:1316:15289:11879#/2,FCC1MK2ACXX:2:2208:1230:20957#/2 > chr1 33449 33669 FCD243JACXX:5:1313:2205:21712#/1,FCD243JACXX:5:1308:6016:8271#/1,FCC1MK2ACXX:2:2208:1230:20957#/1 > chr1 33842 33931 FCD243JACXX:5:2105:19228:7972#/2 > chr1 33933 34044 FCD243JACXX:5:1308:6016:8271#/2,FCD243JACXX:5:2203:17722:60737#/1 > chr1 34070 34162 FCD243JACXX:5:1209:17228:30349#/2 > chr1 34268 34451 FCD243JACXX:5:2105:19228:7972#/1,FCD243JACXX:5:2203:17722:60737#/2 > chr1 34511 34606 FCD243JACXX:5:1209:17228:30349#/1 > chr1 35413 35513 FCC21NUACXX:5:1114:16408:27052#/2 > chr1 35792 35892 FCC21NUACXX:5:1114:16408:27052#/1 > chr1 36101 36201 FCC1MK2ACXX:1:2208:4266:7960#/1,FCC1MK2ACXX:1:2311:20336:8033#/2 > chr1 36528 36625 FCC1MK2ACXX:1:2311:20336:8033#/1,FCC1MK2ACXX:1:2208:4266:7960#/2 > chr1 37129 37229 FCC21NUACXX:5:1313:17033:48410#/1 > chr1 37516 37616 FCC21NUACXX:5:1313:17033:48410#/2 > chr1 37904 37996 FCC1MK2ACXX:2:2205:6549:50320#/1 > chr1 38283 38380 FCC1MK2ACXX:2:2205:6549:50320#/2 > chr1 38609 38709 FCC1MK2ACXX:2:2210:2576:92182#/1 > chr1 38980 39088 FCC1MK2ACXX:2:2210:2576:92182#/2,FCC1MK2ACXX:1:1109:10008:32249#/1 > chr1 39099 39199 FCC1MK2ACXX:2:2101:9586:58935#/1 > chr1 39418 39585 FCC1MK2ACXX:1:1109:10008:32249#/2,FCC1MK2ACXX:2:2101:9586:58935#/2,FCC1MK2ACXX:1:2107:2708:16186#/1 > chr1 39920 40020 FCC1MK2ACXX:1:2107:2708:16186#/2 > chr1 43646 43746 FCC1MK2ACXX:1:2210:18159:79187#/1 > chr1 43974 44074 FCC1MK2ACXX:1:2206:14818:54615#/2 > chr1 44085 44185 FCC1MK2ACXX:1:2210:18159:79187#/2 > chr1 44304 44504 FCC1MK2ACXX:2:1111:10402:8042#/1,FCC1MK2ACXX:1:2206:14818:54615#/1 > chr1 44688 44788 FCC1MK2ACXX:2:1111:10402:8042#/2 > chr1 45372 45472 FCC21NUACXX:5:1213:14336:15983#/2 > chr1 45738 45867 FCC21NUACXX:5:1213:14336:15983#/1,FCC21NUACXX:5:2111:4349:47495#/2,FCC21NUACXX:5:2310:9277:44573#/1 > chr1 46111 46212 FCC21NUACXX:5:2111:4349:47495#/1,FCC21NUACXX:5:2310:9277:44573#/2 > chr1 47250 47346 FCD243JACXX:5:1109:13398:97939#/1 > chr1 47593 47693 FCD243JACXX:5:1109:13398:97939#/2 > chr1 47820 47920 FCC1MK2ACXX:2:1315:1607:59533#/1 > chr1 48088 48193 FCC1MK2ACXX:2:1315:1607:59533#/2,FCC21NUACXX:5:2202:18282:16519#/1 > chr1 48445 48677 FCD243JACXX:5:1102:1566:2621#/2,FCC21NUACXX:5:2202:18282:16519#/2,FCC1MK2ACXX:1:2313:6915:61276#/1 > chr1 48681 48781 FCC21NUACXX:5:2110:14255:7805#/1 > chr1 48832 48932 FCD243JACXX:5:1102:1566:2621#/1 > chr1 48967 49067 FCC1MK2ACXX:1:2313:6915:61276#/2 > chr1 49092 49192 FCC21NUACXX:5:2110:14255:7805#/2 fail merge.t25...\c 1c1 < ***** ERROR: Requested column 2 of a BAM file, which is the Flags field. --- > what(): BgzfStream::ReadBlock: invalid block header contents fail merge.t26...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 355: 16033 Aborted $BT merge -i fullFields.bam -c 3 -o collapse > obs 0a1,112 > chr1 10003 10143 chr1,chr1 > chr1 10358 10428 chr1 > chr1 11780 11921 chr1,chr1 > chr1 11996 12101 chr1,chr1 > chr1 12136 12347 chr1,chr1,chr1,chr1 > chr1 12400 12503 chr1,chr1 > chr1 12635 12779 chr1,chr1,chr1 > chr1 12819 12919 chr1 > chr1 13039 13139 chr1 > chr1 13165 13287 chr1,chr1 > chr1 13561 13731 chr1,chr1 > chr1 14025 14125 chr1 > chr1 14221 14340 chr1,chr1 > chr1 14440 14715 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 14805 15172 chr1,chr1,chr1,chr1,chr1,chr1,chr1 > chr1 15250 15350 chr1 > chr1 15470 15603 chr1,chr1 > chr1 15924 16065 chr1,chr1 > chr1 16155 16255 chr1 > chr1 16314 16438 chr1,chr1 > chr1 16561 16661 chr1 > chr1 16945 17038 chr1 > chr1 17372 17472 chr1 > chr1 17525 17625 chr1 > chr1 17634 17734 chr1 > chr1 17908 18008 chr1 > chr1 18033 18133 chr1 > chr1 18152 18252 chr1 > chr1 18264 18364 chr1 > chr1 18577 18742 chr1,chr1 > chr1 19658 19758 chr1 > chr1 19819 19966 chr1,chr1 > chr1 20059 20320 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 20457 20627 chr1,chr1,chr1 > chr1 20641 20741 chr1 > chr1 20754 20854 chr1 > chr1 21047 21139 chr1 > chr1 21177 21277 chr1 > chr1 21449 21549 chr1 > chr1 21834 22029 chr1,chr1,chr1,chr1 > chr1 22061 22149 chr1 > chr1 22242 22448 chr1,chr1,chr1,chr1,chr1 > chr1 22512 22566 chr1 > chr1 22748 22848 chr1 > chr1 22870 22970 chr1 > chr1 23130 23228 chr1 > chr1 23250 23350 chr1 > chr1 23557 23615 chr1 > chr1 24000 24120 chr1,chr1 > chr1 24248 24612 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 24683 24850 chr1,chr1,chr1 > chr1 24921 25011 chr1 > chr1 25055 25291 chr1,chr1,chr1,chr1 > chr1 25403 25740 chr1,chr1,chr1,chr1,chr1 > chr1 25767 25867 chr1 > chr1 26053 26153 chr1 > chr1 26406 26506 chr1 > chr1 26680 26883 chr1,chr1,chr1,chr1 > chr1 27102 27252 chr1,chr1,chr1 > chr1 27582 27785 chr1,chr1,chr1,chr1 > chr1 27995 28187 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 28198 28298 chr1 > chr1 28439 28545 chr1,chr1 > chr1 28577 28674 chr1 > chr1 28679 28808 chr1,chr1 > chr1 29089 29191 chr1,chr1 > chr1 29331 29431 chr1 > chr1 29686 29786 chr1 > chr1 30409 30509 chr1 > chr1 30809 30909 chr1 > chr1 31781 31881 chr1 > chr1 32173 32273 chr1 > chr1 32519 32619 chr1 > chr1 32732 32832 chr1 > chr1 32926 33120 chr1,chr1 > chr1 33143 33289 chr1,chr1 > chr1 33449 33669 chr1,chr1,chr1 > chr1 33842 33931 chr1 > chr1 33933 34044 chr1,chr1 > chr1 34070 34162 chr1 > chr1 34268 34451 chr1,chr1 > chr1 34511 34606 chr1 > chr1 35413 35513 chr1 > chr1 35792 35892 chr1 > chr1 36101 36201 chr1,chr1 > chr1 36528 36625 chr1,chr1 > chr1 37129 37229 chr1 > chr1 37516 37616 chr1 > chr1 37904 37996 chr1 > chr1 38283 38380 chr1 > chr1 38609 38709 chr1 > chr1 38980 39088 chr1,chr1 > chr1 39099 39199 chr1 > chr1 39418 39585 chr1,chr1,chr1 > chr1 39920 40020 chr1 > chr1 43646 43746 chr1 > chr1 43974 44074 chr1 > chr1 44085 44185 chr1 > chr1 44304 44504 chr1,chr1 > chr1 44688 44788 chr1 > chr1 45372 45472 chr1 > chr1 45738 45867 chr1,chr1,chr1 > chr1 46111 46212 chr1,chr1 > chr1 47250 47346 chr1 > chr1 47593 47693 chr1 > chr1 47820 47920 chr1 > chr1 48088 48193 chr1,chr1 > chr1 48445 48677 chr1,chr1,chr1 > chr1 48681 48781 chr1 > chr1 48832 48932 chr1 > chr1 48967 49067 chr1 > chr1 49092 49192 chr1 fail merge.t27...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 363: 16036 Aborted $BT merge -i fullFields.bam -c 4 -o mean > obs 0a1,112 > chr1 10003 10143 10024.5 > chr1 10358 10428 10358 > chr1 11780 11921 11800.5 > chr1 11996 12101 11998.5 > chr1 12136 12347 12213.25 > chr1 12400 12503 12401.5 > chr1 12635 12779 12661 > chr1 12819 12919 12819 > chr1 13039 13139 13039 > chr1 13165 13287 13176 > chr1 13561 13731 13595 > chr1 14025 14125 14025 > chr1 14221 14340 14230.5 > chr1 14440 14715 14553.66667 > chr1 14805 15172 14944.71429 > chr1 15250 15350 15250 > chr1 15470 15603 15486.5 > chr1 15924 16065 15944.5 > chr1 16155 16255 16155 > chr1 16314 16438 16326 > chr1 16561 16661 16561 > chr1 16945 17038 16945 > chr1 17372 17472 17372 > chr1 17525 17625 17525 > chr1 17634 17734 17634 > chr1 17908 18008 17908 > chr1 18033 18133 18033 > chr1 18152 18252 18152 > chr1 18264 18364 18264 > chr1 18577 18742 18610 > chr1 19658 19758 19658 > chr1 19819 19966 19842.5 > chr1 20059 20320 20143.33333 > chr1 20457 20627 20494 > chr1 20641 20741 20641 > chr1 20754 20854 20754 > chr1 21047 21139 21047 > chr1 21177 21277 21177 > chr1 21449 21549 21449 > chr1 21834 22029 21876 > chr1 22061 22149 22061 > chr1 22242 22448 22297.8 > chr1 22512 22566 22512 > chr1 22748 22848 22748 > chr1 22870 22970 22870 > chr1 23130 23228 23130 > chr1 23250 23350 23250 > chr1 23557 23615 23557 > chr1 24000 24120 24010 > chr1 24248 24612 24351.66667 > chr1 24683 24850 24711 > chr1 24921 25011 24921 > chr1 25055 25291 25128.5 > chr1 25403 25740 25542.8 > chr1 25767 25867 25767 > chr1 26053 26153 26053 > chr1 26406 26506 26406 > chr1 26680 26883 26730.5 > chr1 27102 27252 27125 > chr1 27582 27785 27637 > chr1 27995 28187 28038 > chr1 28198 28298 28198 > chr1 28439 28545 28442 > chr1 28577 28674 28577 > chr1 28679 28808 28693.5 > chr1 29089 29191 29090 > chr1 29331 29431 29331 > chr1 29686 29786 29686 > chr1 30409 30509 30409 > chr1 30809 30909 30809 > chr1 31781 31881 31781 > chr1 32173 32273 32173 > chr1 32519 32619 32519 > chr1 32732 32832 32732 > chr1 32926 33120 32973 > chr1 33143 33289 33189.5 > chr1 33449 33669 33502.33333 > chr1 33842 33931 33842 > chr1 33933 34044 33938.5 > chr1 34070 34162 34070 > chr1 34268 34451 34309.5 > chr1 34511 34606 34511 > chr1 35413 35513 35413 > chr1 35792 35892 35792 > chr1 36101 36201 36101.5 > chr1 36528 36625 36530.5 > chr1 37129 37229 37129 > chr1 37516 37616 37516 > chr1 37904 37996 37904 > chr1 38283 38380 38283 > chr1 38609 38709 38609 > chr1 38980 39088 38984 > chr1 39099 39199 39099 > chr1 39418 39585 39478 > chr1 39920 40020 39920 > chr1 43646 43746 43646 > chr1 43974 44074 43974 > chr1 44085 44185 44085 > chr1 44304 44504 44354 > chr1 44688 44788 44688 > chr1 45372 45472 45372 > chr1 45738 45867 45750.33333 > chr1 46111 46212 46111.5 > chr1 47250 47346 47250 > chr1 47593 47693 47593 > chr1 47820 47920 47820 > chr1 48088 48193 48090.5 > chr1 48445 48677 48500 > chr1 48681 48781 48681 > chr1 48832 48932 48832 > chr1 48967 49067 48967 > chr1 49092 49192 49092 fail merge.t28...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 373: 16039 Aborted $BT merge -i fullFields.bam -c 5 -o mean > obs 0a1,112 > chr1 10003 10143 0 > chr1 10358 10428 6 > chr1 11780 11921 3 > chr1 11996 12101 1.5 > chr1 12136 12347 3 > chr1 12400 12503 1.5 > chr1 12635 12779 12 > chr1 12819 12919 3 > chr1 13039 13139 30 > chr1 13165 13287 2 > chr1 13561 13731 2 > chr1 14025 14125 3 > chr1 14221 14340 14.5 > chr1 14440 14715 14.5 > chr1 14805 15172 12.14285714 > chr1 15250 15350 21 > chr1 15470 15603 3 > chr1 15924 16065 12 > chr1 16155 16255 26 > chr1 16314 16438 12 > chr1 16561 16661 26 > chr1 16945 17038 26 > chr1 17372 17472 26 > chr1 17525 17625 1 > chr1 17634 17734 3 > chr1 17908 18008 1 > chr1 18033 18133 3 > chr1 18152 18252 3 > chr1 18264 18364 0 > chr1 18577 18742 1.5 > chr1 19658 19758 25 > chr1 19819 19966 26 > chr1 20059 20320 31.33333333 > chr1 20457 20627 37 > chr1 20641 20741 1 > chr1 20754 20854 1 > chr1 21047 21139 1 > chr1 21177 21277 1 > chr1 21449 21549 1 > chr1 21834 22029 0.75 > chr1 22061 22149 1 > chr1 22242 22448 0.8 > chr1 22512 22566 1 > chr1 22748 22848 3 > chr1 22870 22970 0 > chr1 23130 23228 3 > chr1 23250 23350 0 > chr1 23557 23615 0 > chr1 24000 24120 0.5 > chr1 24248 24612 0.8333333333 > chr1 24683 24850 0.6666666667 > chr1 24921 25011 1 > chr1 25055 25291 1 > chr1 25403 25740 1.4 > chr1 25767 25867 3 > chr1 26053 26153 1 > chr1 26406 26506 1 > chr1 26680 26883 0.75 > chr1 27102 27252 0.6666666667 > chr1 27582 27785 1 > chr1 27995 28187 1 > chr1 28198 28298 13 > chr1 28439 28545 1 > chr1 28577 28674 13 > chr1 28679 28808 1.5 > chr1 29089 29191 1.5 > chr1 29331 29431 3 > chr1 29686 29786 3 > chr1 30409 30509 50 > chr1 30809 30909 50 > chr1 31781 31881 1 > chr1 32173 32273 1 > chr1 32519 32619 1 > chr1 32732 32832 3 > chr1 32926 33120 1 > chr1 33143 33289 2 > chr1 33449 33669 1.333333333 > chr1 33842 33931 1 > chr1 33933 34044 1 > chr1 34070 34162 1 > chr1 34268 34451 0.5 > chr1 34511 34606 1 > chr1 35413 35513 3 > chr1 35792 35892 3 > chr1 36101 36201 0.5 > chr1 36528 36625 0.5 > chr1 37129 37229 1 > chr1 37516 37616 1 > chr1 37904 37996 1 > chr1 38283 38380 1 > chr1 38609 38709 1 > chr1 38980 39088 1 > chr1 39099 39199 3 > chr1 39418 39585 1.666666667 > chr1 39920 40020 1 > chr1 43646 43746 3 > chr1 43974 44074 3 > chr1 44085 44185 3 > chr1 44304 44504 3 > chr1 44688 44788 3 > chr1 45372 45472 1 > chr1 45738 45867 1 > chr1 46111 46212 1 > chr1 47250 47346 30 > chr1 47593 47693 30 > chr1 47820 47920 26 > chr1 48088 48193 28 > chr1 48445 48677 12 > chr1 48681 48781 3 > chr1 48832 48932 3 > chr1 48967 49067 3 > chr1 49092 49192 3 fail merge.t29...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 381: 16042 Aborted $BT merge -i fullFields.bam -c 6 -o collapse > obs 0a1,112 > chr1 10003 10143 M100,S3M97 > chr1 10358 10428 M5I1M65S29 > chr1 11780 11921 M100,M100 > chr1 11996 12101 M100,M100 > chr1 12136 12347 M100,M100,M100,M100 > chr1 12400 12503 M100,M100 > chr1 12635 12779 M100,S46M54,M98S2 > chr1 12819 12919 M100 > chr1 13039 13139 M100 > chr1 13165 13287 M100,M100 > chr1 13561 13731 M100,M27D2M73 > chr1 14025 14125 M100 > chr1 14221 14340 M100,M100 > chr1 14440 14715 M100,M100,M95S5,M100,M100,S6M94 > chr1 14805 15172 M100,M100,M100,M100,M100,M100,M100 > chr1 15250 15350 M100 > chr1 15470 15603 M100,M100 > chr1 15924 16065 M100,M100 > chr1 16155 16255 M100 > chr1 16314 16438 M100,M100 > chr1 16561 16661 M100 > chr1 16945 17038 M93S7 > chr1 17372 17472 M100 > chr1 17525 17625 M100 > chr1 17634 17734 M100 > chr1 17908 18008 M100 > chr1 18033 18133 M100 > chr1 18152 18252 M100 > chr1 18264 18364 M100 > chr1 18577 18742 M100,S1M99 > chr1 19658 19758 M100 > chr1 19819 19966 M100,M100 > chr1 20059 20320 M100,M100,M100,M100,M96S4,M96S4 > chr1 20457 20627 M100,S12M88,M98S2 > chr1 20641 20741 M100 > chr1 20754 20854 M100 > chr1 21047 21139 S8M92 > chr1 21177 21277 M100 > chr1 21449 21549 M100 > chr1 21834 22029 S10M90,M100,M100,M100 > chr1 22061 22149 M88S12 > chr1 22242 22448 S1M99,M100,M100,M100,M100 > chr1 22512 22566 S46M54 > chr1 22748 22848 M100 > chr1 22870 22970 M100 > chr1 23130 23228 S2M98 > chr1 23250 23350 M100 > chr1 23557 23615 M58S42 > chr1 24000 24120 S40M60,M100 > chr1 24248 24612 M100,M100,M99S1,M100,M100,M100 > chr1 24683 24850 S25M75,M100,S12M88 > chr1 24921 25011 S10M90 > chr1 25055 25291 M100,M100,M100,M100 > chr1 25403 25740 M100,M100,M100,M100,M100 > chr1 25767 25867 M100 > chr1 26053 26153 M100 > chr1 26406 26506 M100 > chr1 26680 26883 M100,M100,M100,S8M92 > chr1 27102 27252 M100,M100,M100 > chr1 27582 27785 M100,M100,M100,M100 > chr1 27995 28187 M100,M100,M100,M100,M100,S3M97 > chr1 28198 28298 M100 > chr1 28439 28545 S5M95,M100 > chr1 28577 28674 M13I3M84 > chr1 28679 28808 M100,M100 > chr1 29089 29191 M100,M100 > chr1 29331 29431 M100 > chr1 29686 29786 M100 > chr1 30409 30509 M100 > chr1 30809 30909 M100 > chr1 31781 31881 M100 > chr1 32173 32273 M100 > chr1 32519 32619 M100 > chr1 32732 32832 M100 > chr1 32926 33120 M100,M100 > chr1 33143 33289 M100,M53S47 > chr1 33449 33669 S14M71I2M13,M100,M100 > chr1 33842 33931 M89S11 > chr1 33933 34044 S3M96S1,M100 > chr1 34070 34162 M92S8 > chr1 34268 34451 M100,M100 > chr1 34511 34606 S5M95 > chr1 35413 35513 M100 > chr1 35792 35892 M100 > chr1 36101 36201 M100,M97S3 > chr1 36528 36625 S3M97,S16M84 > chr1 37129 37229 M100 > chr1 37516 37616 M100 > chr1 37904 37996 M92S8 > chr1 38283 38380 S3M97 > chr1 38609 38709 M100 > chr1 38980 39088 M100,M100 > chr1 39099 39199 M100 > chr1 39418 39585 M69I1M30,S4M96,M57S43 > chr1 39920 40020 M100 > chr1 43646 43746 M100 > chr1 43974 44074 M100 > chr1 44085 44185 M100 > chr1 44304 44504 M100,M100 > chr1 44688 44788 M100 > chr1 45372 45472 M100 > chr1 45738 45867 M100,M100,M100 > chr1 46111 46212 M100,M100 > chr1 47250 47346 M96S4 > chr1 47593 47693 M100 > chr1 47820 47920 M100 > chr1 48088 48193 M100,M100 > chr1 48445 48677 M100,M100,M100 > chr1 48681 48781 M100 > chr1 48832 48932 M100 > chr1 48967 49067 M100 > chr1 49092 49192 M100 fail merge.t30...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 389: 16045 Aborted $BT merge -i fullFields.bam -c 7 -o collapse > obs 0a1,112 > chr1 10003 10143 chr1,chr1 > chr1 10358 10428 chr10 > chr1 11780 11921 chr1,chr1 > chr1 11996 12101 chr1,chr1 > chr1 12136 12347 chr1,chr1,chr1,chr1 > chr1 12400 12503 chr1,chr1 > chr1 12635 12779 chr1,chr1,chr1 > chr1 12819 12919 chr1 > chr1 13039 13139 chr1 > chr1 13165 13287 chr1,chr1 > chr1 13561 13731 chr1,chr1 > chr1 14025 14125 chr1 > chr1 14221 14340 chr1,chr1 > chr1 14440 14715 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 14805 15172 chr1,chr1,chr1,chr1,chr1,chr1,chr1 > chr1 15250 15350 chr1 > chr1 15470 15603 chr1,chr1 > chr1 15924 16065 chr1,chr1 > chr1 16155 16255 chr1 > chr1 16314 16438 chr1,chr1 > chr1 16561 16661 chr1 > chr1 16945 17038 chr1 > chr1 17372 17472 chr1 > chr1 17525 17625 chr1 > chr1 17634 17734 chr1 > chr1 17908 18008 chr1 > chr1 18033 18133 chr1 > chr1 18152 18252 chr1 > chr1 18264 18364 chr1 > chr1 18577 18742 chr1,chr1 > chr1 19658 19758 chr1 > chr1 19819 19966 chr1,chr1 > chr1 20059 20320 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 20457 20627 chr1,chr1,chr1 > chr1 20641 20741 chr1 > chr1 20754 20854 chr1 > chr1 21047 21139 chr1 > chr1 21177 21277 chr1 > chr1 21449 21549 chr1 > chr1 21834 22029 chr1,chr1,chr1,chr1 > chr1 22061 22149 chr1 > chr1 22242 22448 chr1,chr1,chr1,chr1,chr1 > chr1 22512 22566 chr1 > chr1 22748 22848 chr1 > chr1 22870 22970 chr1 > chr1 23130 23228 chr1 > chr1 23250 23350 chr1 > chr1 23557 23615 chr1 > chr1 24000 24120 chr1,chr1 > chr1 24248 24612 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 24683 24850 chr1,chr1,chr1 > chr1 24921 25011 chr1 > chr1 25055 25291 chr1,chr1,chr1,chr1 > chr1 25403 25740 chr1,chr1,chr1,chr1,chr1 > chr1 25767 25867 chr1 > chr1 26053 26153 chr1 > chr1 26406 26506 chr1 > chr1 26680 26883 chr1,chr1,chr1,chr1 > chr1 27102 27252 chr1,chr1,chr1 > chr1 27582 27785 chr1,chr1,chr1,chr1 > chr1 27995 28187 chr1,chr1,chr1,chr1,chr1,chr1 > chr1 28198 28298 chr1 > chr1 28439 28545 chr1,chr1 > chr1 28577 28674 chr1 > chr1 28679 28808 chr1,chr1 > chr1 29089 29191 chr1,chr1 > chr1 29331 29431 chr1 > chr1 29686 29786 chr1 > chr1 30409 30509 chr1 > chr1 30809 30909 chr1 > chr1 31781 31881 chr1 > chr1 32173 32273 chr1 > chr1 32519 32619 chr1 > chr1 32732 32832 chr1 > chr1 32926 33120 chr1,chr1 > chr1 33143 33289 chr1,chr1 > chr1 33449 33669 chr1,chr1,chr1 > chr1 33842 33931 chr1 > chr1 33933 34044 chr1,chr1 > chr1 34070 34162 chr1 > chr1 34268 34451 chr1,chr1 > chr1 34511 34606 chr1 > chr1 35413 35513 chr1 > chr1 35792 35892 chr1 > chr1 36101 36201 chr1,chr1 > chr1 36528 36625 chr1,chr1 > chr1 37129 37229 chr1 > chr1 37516 37616 chr1 > chr1 37904 37996 chr1 > chr1 38283 38380 chr1 > chr1 38609 38709 chr1 > chr1 38980 39088 chr1,chr1 > chr1 39099 39199 chr1 > chr1 39418 39585 chr1,chr1,chr1 > chr1 39920 40020 chr1 > chr1 43646 43746 chr1 > chr1 43974 44074 chr1 > chr1 44085 44185 chr1 > chr1 44304 44504 chr1,chr1 > chr1 44688 44788 chr1 > chr1 45372 45472 chr1 > chr1 45738 45867 chr1,chr1,chr1 > chr1 46111 46212 chr1,chr1 > chr1 47250 47346 chr1 > chr1 47593 47693 chr1 > chr1 47820 47920 chr1 > chr1 48088 48193 chr1,chr1 > chr1 48445 48677 chr1,chr1,chr1 > chr1 48681 48781 chr1 > chr1 48832 48932 chr1 > chr1 48967 49067 chr1 > chr1 49092 49192 chr1 fail merge.t31...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 397: 16048 Aborted $BT merge -i fullFields.bam -c 8 -o mean > obs 0a1,112 > chr1 10003 10143 10024.5 > chr1 10358 10428 135524043 > chr1 11780 11921 12189 > chr1 11996 12101 12401.5 > chr1 12136 12347 12225.75 > chr1 12400 12503 11998.5 > chr1 12635 12779 12504.66667 > chr1 12819 12919 13187 > chr1 13039 13139 12681 > chr1 13165 13287 13190 > chr1 13561 13731 13595 > chr1 14025 14125 13629 > chr1 14221 14340 14607.5 > chr1 14440 14715 14683.33333 > chr1 14805 15172 14904.28571 > chr1 15250 15350 14837 > chr1 15470 15603 15068.5 > chr1 15924 16065 16326 > chr1 16155 16255 16561 > chr1 16314 16438 15944.5 > chr1 16561 16661 16155 > chr1 16945 17038 17372 > chr1 17372 17472 16945 > chr1 17525 17625 17908 > chr1 17634 17734 18033 > chr1 17908 18008 17525 > chr1 18033 18133 17634 > chr1 18152 18252 18577 > chr1 18264 18364 18643 > chr1 18577 18742 18208 > chr1 19658 19758 20059 > chr1 19819 19966 20224 > chr1 20059 20320 20137.5 > chr1 20457 20627 20117.66667 > chr1 20641 20741 21047 > chr1 20754 20854 21177 > chr1 21047 21139 20641 > chr1 21177 21277 20754 > chr1 21449 21549 21834 > chr1 21834 22029 22086.25 > chr1 22061 22149 22512 > chr1 22242 22448 22052.6 > chr1 22512 22566 22061 > chr1 22748 22848 23130 > chr1 22870 22970 23250 > chr1 23130 23228 22748 > chr1 23250 23350 22870 > chr1 23557 23615 24000 > chr1 24000 24120 23989 > chr1 24248 24612 24499.33333 > chr1 24683 24850 24540.66667 > chr1 24921 25011 24512 > chr1 25055 25291 25339.75 > chr1 25403 25740 25455.8 > chr1 25767 25867 25403 > chr1 26053 26153 25640 > chr1 26406 26506 26791 > chr1 26680 26883 26945.25 > chr1 27102 27252 26710.33333 > chr1 27582 27785 28041.5 > chr1 27995 28187 27905.33333 > chr1 28198 28298 28577 > chr1 28439 28545 28031 > chr1 28577 28674 28198 > chr1 28679 28808 29090 > chr1 29089 29191 28693.5 > chr1 29331 29431 29686 > chr1 29686 29786 29331 > chr1 30409 30509 30809 > chr1 30809 30909 30409 > chr1 31781 31881 32173 > chr1 32173 32273 31781 > chr1 32519 32619 32926 > chr1 32732 32832 33143 > chr1 32926 33120 32984 > chr1 33143 33289 33150.5 > chr1 33449 33669 33396.33333 > chr1 33842 33931 34268 > chr1 33933 34044 33920 > chr1 34070 34162 34511 > chr1 34268 34451 33893 > chr1 34511 34606 34070 > chr1 35413 35513 35792 > chr1 35792 35892 35413 > chr1 36101 36201 36530.5 > chr1 36528 36625 36101.5 > chr1 37129 37229 37516 > chr1 37516 37616 37129 > chr1 37904 37996 38283 > chr1 38283 38380 37904 > chr1 38609 38709 38980 > chr1 38980 39088 39013.5 > chr1 39099 39199 39488 > chr1 39418 39585 39335.66667 > chr1 39920 40020 39528 > chr1 43646 43746 44085 > chr1 43974 44074 44404 > chr1 44085 44185 43646 > chr1 44304 44504 44331 > chr1 44688 44788 44304 > chr1 45372 45472 45738 > chr1 45738 45867 45865 > chr1 46111 46212 45756.5 > chr1 47250 47346 47593 > chr1 47593 47693 47250 > chr1 47820 47920 48088 > chr1 48088 48193 48149 > chr1 48445 48677 48630.66667 > chr1 48681 48781 49092 > chr1 48832 48932 48445 > chr1 48967 49067 48577 > chr1 49092 49192 48681 fail merge.t32...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 405: 16051 Aborted $BT merge -i fullFields.bam -c 9 -o mean > obs 0a1,112 > chr1 10003 10143 0 > chr1 10358 10428 0 > chr1 11780 11921 488.5 > chr1 11996 12101 503 > chr1 12136 12347 1 > chr1 12400 12503 -503 > chr1 12635 12779 -174.3333333 > chr1 12819 12919 468 > chr1 13039 13139 -458 > chr1 13165 13287 14 > chr1 13561 13731 0 > chr1 14025 14125 -496 > chr1 14221 14340 474 > chr1 14440 14715 164 > chr1 14805 15172 -54.71428571 > chr1 15250 15350 -513 > chr1 15470 15603 -518 > chr1 15924 16065 481.5 > chr1 16155 16255 506 > chr1 16314 16438 -481.5 > chr1 16561 16661 -506 > chr1 16945 17038 527 > chr1 17372 17472 -527 > chr1 17525 17625 483 > chr1 17634 17734 499 > chr1 17908 18008 -483 > chr1 18033 18133 -499 > chr1 18152 18252 525 > chr1 18264 18364 478 > chr1 18577 18742 -501.5 > chr1 19658 19758 501 > chr1 19819 19966 477.5 > chr1 20059 20320 -6.833333333 > chr1 20457 20627 -471.6666667 > chr1 20641 20741 498 > chr1 20754 20854 523 > chr1 21047 21139 -498 > chr1 21177 21277 -523 > chr1 21449 21549 475 > chr1 21834 22029 262.5 > chr1 22061 22149 505 > chr1 22242 22448 -305 > chr1 22512 22566 -505 > chr1 22748 22848 480 > chr1 22870 22970 480 > chr1 23130 23228 -480 > chr1 23250 23350 -480 > chr1 23557 23615 503 > chr1 24000 24120 -1 > chr1 24248 24612 173.1666667 > chr1 24683 24850 -191.3333333 > chr1 24921 25011 -499 > chr1 25055 25291 261.25 > chr1 25403 25740 -107 > chr1 25767 25867 -464 > chr1 26053 26153 -513 > chr1 26406 26506 477 > chr1 26680 26883 266.75 > chr1 27102 27252 -514.6666667 > chr1 27582 27785 503.75 > chr1 27995 28187 -166.3333333 > chr1 28198 28298 476 > chr1 28439 28545 -508.5 > chr1 28577 28674 -476 > chr1 28679 28808 496.5 > chr1 29089 29191 -496.5 > chr1 29331 29431 455 > chr1 29686 29786 -455 > chr1 30409 30509 500 > chr1 30809 30909 -500 > chr1 31781 31881 492 > chr1 32173 32273 -492 > chr1 32519 32619 507 > chr1 32732 32832 511 > chr1 32926 33120 3 > chr1 33143 33289 -39 > chr1 33449 33669 -135.3333333 > chr1 33842 33931 526 > chr1 33933 34044 -16.5 > chr1 34070 34162 536 > chr1 34268 34451 -516.5 > chr1 34511 34606 -536 > chr1 35413 35513 479 > chr1 35792 35892 -479 > chr1 36101 36201 519.5 > chr1 36528 36625 -519.5 > chr1 37129 37229 487 > chr1 37516 37616 -487 > chr1 37904 37996 476 > chr1 38283 38380 -476 > chr1 38609 38709 471 > chr1 38980 39088 29 > chr1 39099 39199 485 > chr1 39418 39585 -174 > chr1 39920 40020 -492 > chr1 43646 43746 539 > chr1 43974 44074 530 > chr1 44085 44185 -539 > chr1 44304 44504 -23 > chr1 44688 44788 -484 > chr1 45372 45472 466 > chr1 45738 45867 148 > chr1 46111 46212 -455 > chr1 47250 47346 443 > chr1 47593 47693 -443 > chr1 47820 47920 368 > chr1 48088 48193 58.5 > chr1 48445 48677 164 > chr1 48681 48781 511 > chr1 48832 48932 -487 > chr1 48967 49067 -490 > chr1 49092 49192 -511 fail merge.t33...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 413: 16054 Aborted $BT merge -i fullFields.bam -c 10 -o collapse > obs 0a1,112 > chr1 10003 10143 CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT,AACCCTACCCCTACCCCTAACCCTACCCCTACCCCTACCCCTACCCCTACCCCTACCCCTACCCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCC > chr1 10358 10428 ACCCTAAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCGAACCCGAACCCGAACCCGAACCCTAG > chr1 11780 11921 CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCAGCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCG,TTAAACGAGATTGCCAGCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATT > chr1 11996 12101 TCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCT,ATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGT > chr1 12136 12347 TCTGCATGTAACTTAATACCACAACCAGGCGTAGGGGAAAGATTGGAGGAAAGATGAGTGACAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGT,TAAGTAGTGCTTCTGCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTGGACCGCTACCTGCCGTCTGCTGCCATCGGAGCCCAAA,GCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCGGGCTGTGACT,TCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTGGACCGCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCGGGCTCTGACTGCTCA > chr1 12400 12503 GCAGGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTGGCCTAGGTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGC,GGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTGGCCTAGGTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGCAGA > chr1 12635 12779 CCTTCCCCAGCATCAGGTCTCCAGAGCTGCAGAAGACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAGAGGAGAGTA,GATGCCCGGCATGCCCTTCCCCAGCATCAGATCTCCAGAGAGGCAGAAGACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAG,CTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAGAGGAGAGTAGACAGTGAGTGGGAGTGGCGTCGCCCCTAGGGCTCTACGGGGCCGG > chr1 12819 12919 CACCCTCTTGATCTTCCCTGTGATGTCATCTGGAGCCCTGCTGCTTGCGGTGGCCTATAAAGCCTCCTAGTCTGGCTCCAAGGCCTGGCAGAGTCTTTCC > chr1 13039 13139 AACCAGTCCATAGGCAAGCCTGGCTGCCTCCAGCTGGGTCGACAGACAGGGGCTGGAGAAGGGGAGAAGAGGAAAGTGAGGTTGCCTGCCCTGTCTCCTA > chr1 13165 13287 TGCACTGTTGGGGAGGCAGCTGTAACTCAAAGCCTTAGCCTCTGTTCCCACGAAGGCAGGGCCATCAGGCACCAAAGGGATTCTGCCAGCATAGTGCTCC,TAACTCAAAGCCTGAGCCTCTGTTCCCACGAAGGCAGGGCCATCAGGCACCAAAGGGATTCTGCCAGCATAGTGCTCCTGGACCAGTGATACACCCGGCA > chr1 13561 13731 CAGGGATCCTGCTACAAAGGTGAAACCCAGGAGAGTGTGGAGTCCAGAGTGTTGCCAGGACCCAGGCACAGGCATTAGTGCCCGTTGGAGAAAACAGGGG,CAGGCATTAGTGCCCGTTGGAGAAAACGGGAATCCCGAAGAAATGGTGGGTCCTGGCCATCCGTGAGATCTTCCCAGGGCAGCTCCCCTCTGTGGAATCC > chr1 14025 14125 TTCTATCTCCCTGGCTTGGTGCCAGTTCCTCCAAGTCGATGGCACCTCCCTCCCTCTCAACCACTTGAGCAAACTCCAAGACATCTTCTACCCCAACACC > chr1 14221 14340 CATCTGCAACAGCTGCCCCTGCTGACTGCCCTTCTCTCCTCCCTCTCATCCCAGAGAAACAGGTCAGCTGGGAGCTTCTGCCCCCACTGCCTAGGGACCA,TGCTGACTGCCCTTCTCTCCTCCCTCTCATCCCAGAGAAACAGGTCAGCTGGGAGCTTCTGCCCCCACTGCCTAGGGACCAACAGGGGCAGGAGGCAGTC > chr1 14440 14715 CTCTGGAAGCCTCTTAAGAACACAGTGGCGCAGGCTGGGTGGAGCCGTCCCCCCATGGAGCACAGGCAGACAGAAGTCCCCGCCCCAGCTGTGTGGCCTC,CCTCAAGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCACACAGTGCTGGTTCCGTCACCCCCTCCCAAGGAAGTAGGTCTGAGCAGCTTGTCCTGGCTGT,AAGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCACACAGTGCTGGTTCCGTCACCCCCTCCCAAGGAAGTAGGTCTGAGCAGCTTGTCCTGGCTGTGTCC,CACCCCCTCCCAAGGAAGTAGGTCTGAGCAGCTTGTCCTGGCTGTGTCCATGTCAGAGCAACGGCCCAAGTCTGGGTCTGGGGGGGGAGGTGTCATGGAG,CCCCTCCCAAGGAAGTAGGTCTGAGCAGCTTGTCCTGGCTGTGTCCATGTCAGAGCAACGGCCCAAGTCTGGGTCTGGGGGGGAAGGTGTCATGGAGCCC,TGAGCAGCTTGTCCTGGCTGTGTCCATGTCAGAGCAACGGCCCAAGTCTGGGTCTGGGGGGGAAGGTGTCATGGAGCCCCCTACGATTCCCAGTCGTCCT > chr1 14805 15172 CCCCAGGTCCTTTCCCAGAGATGCCTGGAGGGAAAAGGCTGAGTGAGGGTGGTTGGTGGGAAACCCTGGTTCCCCCAGCCCCCGGAGACTTAAATACAGG,AAAAGGCTGAGTGAGGGTGGTTGGTGGGAAACCCTGGTTCCCCCAGCCCCCGGAGACTTAAATACAGGAAGAAAAAGGCAGGACAGAATTACAAGGTGCT,TTACAAGGTGCTGGCCCAGGGCGGGCAGCGGCCCTGCCTCCTACCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGACATCAAGTGCCCACCTTGG,GGCGGGCAGCGGCCCTGCCTCCTACCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGACATCAAGTGCCCACCTTGGCTCGTGGCTCTCACTGCAA,CTACCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGACATCAAGTGCCCACCTTGGCTCGTGGCTCTCACTGCAACGGGAAAGCCACAGACTGGGG,TGAAGAGTTCAGTCACATGCGACCGGTGACTCCCTGTCCCCACCCCCATGACACTCCCCAGCCCTCCAAGGCCACTGTGTTTCCCAGTTAGCTCAGAGCC,TTCAGTCACATGCGACCGGTGACTCCCTGTCCCCACCCCCATGACACTCCCCAGCCCTCCAAGGCCACTGTGTTTCCCAGTTAGCTCAGAGCCTCAGTCG > chr1 15250 15350 CAGGGTGTGCAGCACCACTGTACGATGGGGAAACTGGCCCAGAGAGGTGAGGCAGCTTGCCTGGGGTCACAGAGCAAGGCAAAAGCAGCGCTGGGTACAA > chr1 15470 15603 AAATATCTCAGGAGGCTGCAGTGGCTGACCATTGCCTTGGACCGCTCTTGGCAGTCGAAGAAGATTCTCCTGTCAGTTTGAGCTGGGTGAGCTTAGAGAG,GCCTTGGACCGCTCTTGGCAGTCGAAGAAGATTCTCCTGTCAGTTTGAGCTGGGTGAGCTTAGAGAGGAAAGCTCCACTATGGCTCCCAAACCAGGAAGG > chr1 15924 16065 CACTTCCCTGGGAGCTCCCTGGACTGGAGCCGGGAGGTGGGGAACAGGGCAAGGAGGAAAGGCTGCTCAGGCAGGGCTGGGGAAGCTTACTGTGTCCAAG,GAACAGGGCAAGGAGGAAAGGCTGCTCAGGCAGGGCTGGGGAAGCTTACTGTGTCCAAGAGCCTGCTGGGAGGGAAGTCACCTCCCCTCAAACGAGGAGC > chr1 16155 16255 CAGATACTCCCTGCTTCCTCTCTAGCCCCCACCCTGCAGAGCTGGACCCCTGAGCTAGCCATGCTCTGACAGTCTCAGTTGCACACACGAGCCAGCAGAG > chr1 16314 16438 AATGAAAAATGTGTTGCTGTAGTTTGTTATTAGACCCCTTCTTTCCATTGGTTTAATTAGGAATGGGGAACCCAGAGCCTCACTTGTTCAGGCTCCCTCT,TGTTATTAGACCCCTTCTTTCCATTGGTTTAATTAGGAACGGGGAACCCAGAGCCTCACTTGTTCAGGCTCCCTCTGCCCTAGAAGTGAGAAGTCCAGAG > chr1 16561 16661 ACTGAGCACACCAGAAATCAGGTGGCCTCAAAGAGCTGCTCCCACCTGAAGGAGACGCGCTGCTGCTGCTGTCGTCCTGCCTGGCGCCTTGGCCTACAGG > chr1 16945 17038 GCAATGTACATGAGGTCGTTGGCAATGCCGGGCAGGTCAGGCAGGTAGGATGGAACATCAATCTCAGGCACCTGGCCCAGGTCTGGCACATAGAAATAGT > chr1 17372 17472 AGAGGCGACATGGGGGTCAGGCAAGCTGACACCCGCTGTCCTGAGCCCATGTTCCTCTCCCACATCATCAGGGGCACAGCGTGCACTGTGGGGTCCCAGG > chr1 17525 17625 CTGTGTCTGATGCCCTGGGTCCCCACTAAGCCAGGCCGGGCCTCCCGCCCACACCCCTCGGCCCTGCCCTCTGGCCATACAGGTTCTCGGTGGTGTTGAA > chr1 17634 17734 GGAGCTGACAGAGCTGATGTTGCTGGGAAGACCCCCAAGTCCCTCTTCTGCATCGTCCTCGGGCTCCGGCTTGGTGCTCACACACACAGGAAAGTCCTTC > chr1 17908 18008 GCAGACCTGCAGGGCCCGCTCGTCCAGGGGGCGGTGCTTGCTCTGGATCCTGTGGCGGGGGCGTCTCTGCAGGCCAGGGTCCTGGGCGCCCGTGAAGATG > chr1 18033 18133 GAGCAGGGTACTTGGCACTGGAGAACACCTGTGGACACAGGGACAAGTCTGAGGGGGTCCCAAGAGGCTCAGAGGGCTAGGATTGCTTGGCAGGAGAGGG > chr1 18152 18252 GAGAAGAGAGCTCAAGGTACAGGTGGGCAGCAGGGCAGAGACTGGGCAGCCTCAGAGGCACGGGGAAATGGAGGGACTGCCCAGTAGCCTCAGGACACAG > chr1 18264 18364 TACCTTGATGGCCTTCTTGCTGCCCTTGATCTTCTCAATCTTGGCCTGGGCCAAGGAGACCTTCTCTCCAATGGCCTGCACCTGGCTCCGGCTCTGCTCT > chr1 18577 18742 TGCTGAGTTCCCTGCACTCTCAGTAGGGACAGGCCCTATGCTGCCACCTGTACATGCTATCTGAAGGACAGCCTCCAGGGCACACAGAGGATGGTATTTA,AGACAGCCTCCAGGGCACACAGAGGATGGTATTTACACATGCACACATGGCTACTGATGGGGCAAGCACTTCACAACCCCTCATGATCACGTGCAGCAGA > chr1 19658 19758 TGGGAGTACCAGCAGGCACTCAAGCGGCTTAAGTGTTCCATGACAGACTGGTATGAAGGTGGCCACAATTCAGAAAGAAAAAAGAAGAGCACCATCTCCT > chr1 19819 19966 CCTTCATCTGCTGTAAAGGGTCCTCCAGCACAAGCTGTCTTAATTGACCCTAGTTCCCAGGGCAGCCTCGTTCTGCCTTGGGTGCTGACACGACCTTCGG,CCCTAGTTCCCAGGGCAGCCTCGTTCTGCCTTGGGTGCTGACACGACCTTCGGTAGGTGCATAAGCTCTGCATTCGAGGTCCACAGGGGCAGTGGGAGGG > chr1 20059 20320 CAATGAGCCCTGGAAAATTTCTGGAATGGATTATTAAACAGAGAGTCTGTAAGCACTTAGAAAAGGCCGCGGTGAGTCCCAGGGGCCAGCACTGCTCGAA,AAAATTTCTGGAATGGATTATTAAACAGAGAGTCTGTAAGCACTTAGAAAAGGCCGCGGTGAGTCCCAGGGGCCAGCACTGCTCGAAATGTACAGCATTT,CTTAGAAAAGGCCGCGGTGAGTCCCAGGGACCAGCACTGCTCGAAATGTACAGCATTTCTCTTTGTAACAGGATTATTAGCCTGCTGTGCCCGGGGAAAA,CATTTCTCTTTGTAACAGGATTATTAGCCTGCTGTGCCCGGGGAAAACATGCAGCACAGTGCATCTCGAGTCAGCAGGATTTTGACGGCTTCTAACAAAA,AGTGCATCTCGAGTCAGCAGGATTTTGACGGCTTCTAACAAAATCTTGTAGACAAGATGGAGCTATGGGGGTTGGAGGACAGAACATATAGGAAAACTCA,AGTGCATCTCGAGTCAGCAGGATTTTGACGGCTTCTAACAAAATCTTGTAGACAAGATGGAGCTATGGGGGTTGGAGGACAGAACATATAGGAAAACTCA > chr1 20457 20627 AAGGGTAAGCTGGTTTCATGATCGAATCAAGGCTCAGACAATTTTTAAAGGCCAGAGGGTAGACTGCAATCACCAAGATGAAATTTACAAGGAACAAATG,CAAGGCTCAGACAATTTTTAAAGGCCAGAGGGTAGACTGCAATCACCAAGATGAAATTTACAAGGAACAAATGTGAAGCCCAACATTTAGGTTTTAAAAA,CCAAGATGAAATTTACAAGGAACAAATGTGAAGCCCAACATTTAGGTTTTAAAAATCAAGCGTATGAATACAGAAGGTGGAGGGAACTTGCTTTAGACGC > chr1 20641 20741 GAAAGACCTGGAAACTTCTGTTAATTATAAGCTCAGTAGGGGCTAAAAGCATGTTAATCGGCATAAAAAGGCAATGAGATCTTAGGGCACACAGCTCCCC > chr1 20754 20854 CCTTCATCCTTCTTTCAATCAGCAGGGACCGTGCACTCTCTTGGAGCCACCACAGAAAACAGAGGTGCATCCAGCACCACAGAAAACAGAGCCACCACAG > chr1 21047 21139 AGTCTCTCCCCTGCCCCTGTCTCTTCCGTGCAGGAGGAGCATGTTTAAGGGGACGGGTTCAAAGCTGGTCACATCCCCACCGAAAAAGCCCATGGACAAC > chr1 21177 21277 AAGTGGAGGAGGAGAGGTGGCGGTGCTCCCCACTCCACTGCCAGTCGTCACTGGCTCTCCCTTCCCTTCATCCTCGTTCCCTATCTGTCACCATTTCCTG > chr1 21449 21549 CTCTTCTGTCCCATCCCTGCCCTGCTCAAAATCCAATCACAGCTCCCTAACACGCCTGAATCAACTTGAAGTCCTGTCTTGAGTAATCCGTGGGCCCTAA > chr1 21834 22029 GCCACACTGAGGCCTCCCTCCAAGCCTGCAGCCCCCATTTCCAGACCCTGCCAGGGCAACCTGCATATCCACCTCCCTACCCTGCCCCCCTCTTCCAGGA,CCCATTTCCAGACCCCACCAGGGCAACCTGCATATCCACCTCCCTACCCTGCCCCCCTCTTCCAGGAGTCTGCCCTATGTGGAGTAAGCACGTGGTTTTC,CTGCATATCCACCTCCCTACCCTGCCCCCCTCTTCCAGGAGTCTGCCCTATGTGGAGTAAGCACGTGGTTTTCCTCTTCAGCAACTATTTCCTTTTTACT,CCCTATGTGGAGTAAGCACGTGGTTTTCCTCTTCAGCAACTATTTCCTTTTTACTCAAGCAATGGCCCCATTTCCCTTGGGGAATCCATCTCTCTCGCAG > chr1 22061 22149 ACAGAGCTTCTCAGTCTAAGCCAAGTGATGTGTCATAGTCCCCTGGCCCCAGTAATGGATTCTGGGATAGACGTGAGGACCAAGCCAGGGGGGATGGGTG > chr1 22242 22448 ACCACGAGAGCATGGCCTGTCTGGGAATGCAGCCAGACCCAAAGAAGCAAACTGACATGGAAGGAAAGCAAAACCAGGCCCTGAGGACATCATTTTAGCC,TGACATGGAAGGAAAGCAAAACCAGGCCCTGAGGACATCATTTTAGCCCTTACTCCGAAGGCTGCTCTACTGATTGGTTAATTTTTGCTTAGCTTGGTCT,GAAGGAAAGCAAAACCAGGCCCTGAGGACATCATTTTAGCCCTTACTCCGAAGGCTGCTCTACTGATTGGTTAATTTTTGCTTAGCTTGGTCTGGGGAGT,AAGCAAAACCAGGCCCTGAGGACATCATTTTAGCCCTTACTCCGAAGGCTGCTCTACTGATTGGTTAATTTTTGCTTAGCTTGGTCTGGGGAGTTCTGAC,CGAAGGCTGCTCTACTGATTGGTTAATTTTTGCTTAGCTTGGTCTGGGGAGTTCTGACAGGCGTGCCACCAATTCTTACCGATTTCTCTCCACTCTAGAC > chr1 22512 22566 TTCATGCTAGAAGTTATCAATCAACCTCGCCCTAGGTGTTCCCTTCCCAGCCTCTAGGACACAGTGTCAGCCACATAATTGGTATCTCTTAAGGTCCAGC > chr1 22748 22848 TCTCCTCATCCCATCCCTGGGCAGGGGACATGCAACTGTCTACAAGGTGCCAAGTACCAGGACAGGAAAGGAAAGACGCCAAAAATCCAGCGCTGCCCTC > chr1 22870 22970 CCCATCTTGGCAAGGAAACACAATTTCCGAGGGAATGGTTTTGGCCTCCATTCTAAGTGCTGGACATGGGGTGGCCATAATCTGGAGCTGCTGGCTCTTA > chr1 23130 23228 ATTTCCTGAAGGCTTCCTAGGTGCCAGGCACTGTTCCATTCCTTTGCATGTTTTGATTAATTTAATATTTAAAATAATTCTACCAGGAAGCTACCATTAT > chr1 23250 23350 ACACCGAGGCTTAGAGGGGTTGGGTTGCCCAAGGTTACAGAGGAAGAAAACAGGGGAGCTGGATCTGAGCCAAGGCATCAACTCCAAGGTAACCCCTCAG > chr1 23557 23615 CTGAGACAGGCGGACACATACGTCCCACTGGGGACTACCATGTGAGGCATGGTGTGGGAGCCTGGGAAGGAGACCAAGCCTCATTTCAGTTAGCTTATGG > chr1 24000 24120 TGTCATTTCCTCACATCTGCCTTCCCGGCCCTGAGCCCAAGCCAGGCTTCCCATGACGAGCCTCACAGTACCCCATCTCCCCTGAACAGATGCAGTAATA,CCTCACAGTACCCCATCTCCCCTGAACAGATGCAGTAATAACCTACATAACCCGGGGCCATGATCTATGGCTTTGAATCCTGGCTCTGTCACTAGGCCAG > chr1 24248 24612 TACAAAATATTATCAATAGACCTTGTCACAACTGTTATTGAAGAACTAATCATCTATTGCTTATTTAGGTCTTTCTCTCCTGCCAGAATGTGCGCTCCAG,ATCAATAGACCTTGTCACAATTGTTATTGAAGAACTAATCATCTATTGCTTATTTAGGTCTTTCTCTCCTGCCAGAATGTGCGCTCCAGGTGGAGAGGTA,TTTCTCTCCTGCCAGAATGTGCGCTCCAGGAGGAGAGGGATGTTGCCTTATCCGTGGCTGGGTATATAGAGATTCCCACACTGCCTTGCACACGAGCACT,GAGAGGTATGTTGCCTTATCCGTGGCTGGATATATAGAGATTCCCACACTGCCTTGCACACGAGCACTGCTGGGTAAATATTTGTTGGCTGCAGGAAAAC,TGGGTAAATATTTGTTGGCTGCAGGAAAACGTGAAGGAATAGGCCCTCCAATGGGAGGAAAAGCATGAGTTGTGAGAGCAGAGCCACCACAGGAAACCAG,GGAAACCAGGAGGCTAAGTGGGGTGGAAGGGAGTGAGCTCTCGGACTCCCAGGAGTAAAAGCTTCCAAGTTGGGCTCTCACTTCAGCCCCTCCCACACAG > chr1 24683 24850 CTCCCAGAGGGTGTGTTGCTGGGATTGCCCAGGACAGGGATGGCCCTCTCATCAGGTGGGGGTGAGTGGCAGCACCCACCTGCTGAAGATGTCTCCAGAG,AGGACAGGGATGGCCCTCTCATCAGGTGGGGGTGAGTGGCAGCACCCACCTGCTGAAGATGTCTCCAGAGACCTTCTGCAGGTACTGCAGGGCATCCGCC,CTCCAGAGACCTTCTGCAGGTACTGCAGGGCATCCGCCATCTGCTGGACGGCCTCCTCTCGCCGCAGGTCTGGCTGGATGAAGGGCACGGCATAGGTCTG > chr1 24921 25011 ATCAGAGCCACCCACGACCACCGGCACGCCCCCACCACAGGGCAGCGTGGTGTTGAGACAACACAGCCCTCATCCCAACTATGCACATAGCTTCAGCCTG > chr1 25055 25291 GAGCGCATAGATGGGACTCTGCTGATGCCTGCTGAGTGAATGAGGGAAAGGGCAGGGCCCGGGACTGGGGAATCTGTAGGGTCAATGGAGGAGTTCAGAG,AGGGAAAGGGCAGGGCCCGGGACTGGGGAATCTGTAGGGTCAATGGAGGAGTTCAGAGAAGGTGCAACATTTCTGACCCCCTACAAGGTGCTTGCTACCT,GACCCCCTACAAGGTGCTTGCTACCTGCCAGGCACCCTTTCCATACCTTGTCTCAGTTCAGCTCCCCACCTTGGATAAACAAGAAACCTTGGTTGCAGAG,CTACCTGCCAGGCACCCTTTCCATACCGTGTCTCAGCTCAGCTCCCCACCTTGGATAAACAAGAAACCTTGGTTGCAGAGGAAAAAAGAGGCTGGAAACA > chr1 25403 25740 TGAGGAATCTGAGGCCTGCTCCTGAAACAGACTGGGCAGTGGCTAGTGACTCTAGGTATAGGAGTATCCAGCCCTGCTCACCCAGGCTAGAGCTTAGGGG,TTAGGGGGCCAAGAGGAAAGAGGTGCCTGTGGGGGTGGAGGACAGGAAGGAAAAATACTCCTGGAATCGCAAAGTGAGGGCAGAGTCTATTTATATTGGG,GGAATTGCAAAGTGAGGGCAGAGTCTATTTATATTGGGTTTAATTAACTCCTCTCCCTGGTGCCACTAAAGCAGCAATCACACTGCAGACAGCACTGATT,GTGCCACTAAAGCAGCAATCACACTGCAGACAGCACTGATTTGATTGGCAAGAGATGCACCAGGCAGAATATTAAGGGACCAGGCCCCTATAAATAGGCC,CTGCAGACAGCACTGATTTGATTGGCAAGAGATGCACCAGGCAGAATATTAAGGGACCAGGCCCCTATAAATAGGCCTAATCACAGCCCCTCACTGGAAA > chr1 25767 25867 GGCACTGTGCCCTAGACCTGCTCCCCTAGGCACTACAGTGGGGCCCTTGGTTGCACCACAAGTAGGTAGGGATGGATGAGTGTGGCATGAAGGGCCTAGG > chr1 26053 26153 TTGCTCCCGCTGCTGGCTTCCCCAGCCCTCCCTTCTGCCCTCCTCAGGCCAGCACTTTTCAGTGAGTTCCTCCTTTGCATACAGGCTTTCCAGATCTGTA > chr1 26406 26506 AGATGCAAGATATTTCCTGTGCACATCTTCAGATGAATTTCTTGTTAGTGTGTGTGTGTTTGCTCACACATATGCGTGAAAGAAGAGTACATACACAGAT > chr1 26680 26883 TCAAATTAAATTCATTCTACTCCAGTCATGGGTACAAAGCTAAGGAGTGACAAATCCCTCTTGGAGTTAGGGGAGTCAGGAAAAAGCTCTTAGCAGAATG,ACAAAGCTAAGGAGTGACAAATCCCTCTTGGAGTTAGGGGAGTCAGGAAAAAGCTCTTAGCAGAATGTGTGCCTCTCGGCCGGGCGCAGCGGCTCACGCC,TCTTGGAGTTAGGGGAGTCAGGAAAAAGCTCTTAGCAGAATGTGTGCCTCTCGGCCGGGCGCAGCGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGCG,CCCTCTCGGCCGGGCGCAGCGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGCGAAGGCAGGCAGATCACCTGAGGTCGGGAGTTCGAGACCAGTCTGA > chr1 27102 27252 AAAGAAACAGCTTGAACAAAAAGTGTGTAGGGGAACCGCAAGCGGTCTTGAGTGCTGAGGGTACAATCATCCTTGGGGAAGTACTAGAAGAAAGAATGAT,AAAGTGTGTAGGGGAACCGCAAGCGGTCTTGAGTGCTGAGGGTACAATCATCCTTGGGGAAGTACTAGAAGAAAGAATGATAAACAGAGGCCAGTTTGTT,AGTGCTGAGGGTACAATCATCCTTGGGGAAGTACTAGAAGAAAGAATGATAAACAGAGGCCAGTTTGTTAAAAACACTCAAAATTAAAGCTAGGAGTTTG > chr1 27582 27785 ATGCCAAAGAAATGAGTCTCTGCTGTTTTTGGGCAGCAGATATCCTAGAATGGACTCTGACCTAAGCATCAAAATTAATCATCATAACGTTATCATTTTA,CCTAGAATGGACTCTGACCTAAGCATCAAAATTAATCATCATAACGTTATCATTTTATGGCCCCTTCTTCCTATATCTGGTAGCTTTTAAATGATGACCA,TTAATCATCATAACGTTATCATTTTATGGCCCCTTCTTCCTATATCTGGTAGCTTTTAAATGATGACCATGTAGATAATCTTTATTGTCCCTCTTTCAGC,CCCCTTCTTCCTATATCTGGTAGCTTTTAAATGATGACCATGTAGATAATCTTTATTGTCCCTCTTTCAGCAGACGGTATTTTCTTATGCTACAGTATGA > chr1 27995 28187 TATTGATATGTTTTGTTGTTTTCATGCAATAATGCAAATCTTAGCCCAAACATTTTGTTAGTAGTACCAACTGTAAGTCACCTTATCTTCATACTTTGTC,GCAATAATGCAAATCTTAGCCCAAACATTTTGTTAGTAGTACCAACTATAAGTCACCTTATCTTGATACTTTGTCTTTATGTAAACCTAAATTAGATCTG,ATGCAAATCTTAGCCCAAACATTTTGTTAGTAGTACCAACTGTAAGTCACCCTATCTTCATACTTTGTCTTTATGTAAACCTAAATTAGATCTGTTTTTG,AAACATTTTGTTAGTAGTACCAACTGTAAGTCACCTTATCTTCATACTTTGTCTTTATGTAAACCTAAATTAGATCTGTTTTTGATACTGAGGGAAAAAC,GTAGTACCAACTGTAAGTCACCCTATCTTCATACTTTGTCTTTATGTAAACCTAAATTAGATCTGTTTTTGATACTGAGGGAAAAACAAGGGAATCTAAC,CCTTTGTCTTTATGTAAACCTAAATTAGATCTGTTTTTGATACTGAGGGAAAAACAAGGGAATCTAACACTAACCAGCCCGTAGTGTGTGGTCAACACTT > chr1 28198 28298 GTATACATCACCCCAATTGTTTGTCTTCACCACACACTTTGGAGTTAGGTAGCAGTATCTATTTTTACAAATAAGAAAACCCAGGCACAAAGGAGTTGAT > chr1 28439 28545 TCTTCTATCAGGGAGTTTTATGAGAAACCCTAGCTCCTCAGTTCCACAGTGGGTAACTGTAATTCATTCTAGGTCTGCGATATTTCCTGCCTATCCATTT,GGAGTTTTATGAGAAACCCTAGCTCCTCAGTTCCACAGTGGGTAACTGCAATTCATTCTAGGTCTGCGATATTTCCTGCCTATCCATTTTGTTAACTCTT > chr1 28577 28674 AATAATGGTGGTTTGGTTTTTTTTTTTTTGCATCTATGAAGTTTTTTCAAATTCTTTTTAAGTGACAAAACTTGTACATGTGTATCGCACAATATTTCTA > chr1 28679 28808 CAGCACTGCTTTCGAGAATGTAAACCGTGCACTCCCAGGAAAATGCAGACACAGCACGCCTCTTTGGGACCGCGGTTTATACTTTCGAAGTGCTCGGAGC,CACTCCCAGGAAAATGCAGACACAGCACGCCTCTTTGGGACCGCGGTTTATACTTTCGAAGTGCTCGGAGCCCTTCCTCCAGACCGTTCTCCCACACCCC > chr1 29089 29191 AAGCTCCGGGGCGAGCCCAAGACGCCTCCCGGGCGGTCGGGGCCCAGCGGCGGCGTTCGCAGTGGAGCCGGGCACCGGGCAGCGGCCGCGGAACACCAGC,GCTCCGGGGCGAGCCCAAGACGCCTCCCGGGCGGTCGGGGCCCAGCGGCGGCGTTCGCAGTGGAGCCGGGCACCGGGCAGCGGCCGCGGAACACCAGCTT > chr1 29331 29431 CCTCCCGGAAGCTCCCGCCGCCGCTTCCGCTCTGCCGGAGCCGCTGGGTCCTAGCCCCGCCGCCCCCAGTCCGCCCGCGCCTCCGGGTCCTAACGCCGCC > chr1 29686 29786 TGTCCGCCAACCTCGGCTCCTCCGGGCAGCCCTCGCCCGGGGTGCGCCCCGGGGCAGGACCCCCAGCCCACGCCCAGGGCCCGCCCCTGCCCTCCAGCCC > chr1 30409 30509 CGTAGCATAAATATGTCCCAAGCTTAGTTTGGGACATACTTATGCTAAAAAACATTATTGGTTGTTTATCTGAGATTCAGAATTAAGCATTTTATATTTT > chr1 30809 30909 GGGGTGGGGCCCTCATTATAGATCTGGTAAGAAAAGAGAGCATTGTCTCTGTGTCTCCCTCTCTCTCTCTCTCTCTCTCTCTCATTTCTCTCTATCTCAT > chr1 31781 31881 ATATGCTCCACGATGCCTGTGAATATACAAACACACCACATCATATACCAAGCCTGGCTGTGTCTTCTCACAAATGCACTGCTAGGCACCACCCCCAGTT > chr1 32173 32273 CTCCTGGATTTGCCAGGATCCAAGAGCATGGACTTTAGGAATTCCTGGTGGAGGAGTGAAGAAAATGTGACAGGGTGTCCTAAGCCCCGATCTACAGGAA > chr1 32519 32619 TGAGGTTTCTAATGTATTTGAAAGAGGCCTGGGTCTAGAAGTCTACCCAGAGGGCTCTGTGTTGTGCACGCTAAGATAAGAACCTTCCCTGTGGGAGTTC > chr1 32732 32832 CAGCCCAGGAACCTCCCCTTATCGGAAATGAACAGCATTTGAAGCTTCACCAGACAGACCAGACAGCTTAGCCCTCGTGTTGTGCCATGTGGGTTGTTCT > chr1 32926 33120 TGATCCTAGGCATGTTACCTGTGCCTCAGTTTTCACTCTGTCAATATGTAATAACTGAATCTGTCTTTGTGGTGAGGATTCAGTGAGTTAACATATTTGA,ATTTGAAGTGCTTAAAAATGAGGCTTGTGTCCACAGATTAATGAGTGAATACACAAATGGTGATATGGACATACAGTGGAGTATTAGTCATAAAAAGGAA > chr1 33143 33289 TGTGACAGAACCTCAAAAGCATTAGGTTAAGTGGAAGAAGCCAGACACAGGTCACCTATTGTGTAATTCCATTTATAGGAAATATACAGAATATGTAAAT,TGTAAATCCGTGGAGAAAGAAAGCCGATTTCCAGGGGCTAAGGGGAGGGGAGACTGGGAAGAGGCTGACTCATGGGGAGAAGGATTCAGTTTGAGGAGGT > chr1 33449 33669 TTTTACCCCCATTAAAAAAAAAAAAAAAAGGACCAGATGTGGTTGCTCACACCCATAATCCCAACACTTTGGAAAAAGGTGAAAGATTTTTTTTTTCTTT,ATAATCCCAACACTTTGGAAAAAGGTGAAAGATTTTTTTTTTCTTTTTTTTTATATACTTAAGTTCTAGGGTACATGTGCATAATGTGCAGGTTGGATAC,ATAATGTGCAGGTTGGATACATAGATATGCGTGTGCCATGTTGGTTTGCTGCACCCATCAACTTGTCATTTACATTAGGTATTTCTCCTAATGCTATCCC > chr1 33842 33931 AAAGGACATGAACTCATCCTTTTTAATGGCTGCATAGTATCCCATGGAATATATGTGCCACATTCTCTTAATCCAGTCTGTCATTGATGGACTTTTGGGT > chr1 33933 34044 GGACATTTGGGGTGGTTCAAAGTCTTTGCTATTGTGAATACTGCCACAATAAACATCCATGTGCATGTGTCTTTATAGTAGCACGATTTATAATCCTTTT,GTTCAAAGTCTTTGCTATTGTGAATACTGCCACAATAAACATACATGTGCATGTGTCTTTATAGTAGCACGATTTATAATCCTTTTGGTATATACCCTAA > chr1 34070 34162 GTAAAGAGACATTTATAGCACTAAATGCCCACAAGAGACCTCTGCCTGAGAACGTGGGTTTCAGCCTAAGAGTTGTAATATGTGTGCCCATTCACAGGTG > chr1 34268 34451 GAATCTCCACCCAGCGACTTGCTCTCACATCTTCTTGGCCAGCACTGGACCACACAACTCCTTCTAGATACAGAGGAGTCCTAGGATTCTATGAGAAAGA,GGATTCTATGAGAAAGAAGGGGAGGGTGGGCAAAGGGCAGCCAGCTGTGCAGCATCTGCTGGAGACACCTAACCCTTGGTGGAGGGGTTGTGGTGCTGGG > chr1 34511 34606 TTACCCTGGTGAAGCAGGGCAGGGTTACAAGCATTCCAGCAACATGAAGCAGCAGGAGTGTTTTAATTAAAAGAAGGCAGTTGCTGTAACCAACTATAAA > chr1 35413 35513 TGAGGTGGGAGGATCGCTTGAGGCCAGGAGTTCAAGACCAGCCTGAGCAACATAGTGAGACTTTGTCTCTATAAAAAATAAATAAATAAATAAAAACAAC > chr1 35792 35892 TGGCTCTCCCAGGTGAGAGAGGACTCCATTTTCACAGGCAGGCGTGGGAGCTTCAGCACCCATCTCTGGGCCCAGAATGACCCACTGGAGACCTTACAGC > chr1 36101 36201 AGGACTAATCCTTGGAACAGCTCAGGGAGGATTATCCCAGCCACTGTCAGCAGCGGTGCAGCTGGCTCATTCCCATATAGGGGGAGGCCAGAGCCAGGGG,GGACTAATCCTTGGAACAGCTCAGGGAGGATTATCCCAGCCACTGTCAGCAGCGGTGCAGCTGGCTCATTCCCATATAGGGGGAGGCCAGAGCCAGGGGC > chr1 36528 36625 CTTTCCCACCCAAGTGCTGGCATCCTCCCTGTCCTGCTTCACCTGAGACACCCCTTGTCTCATTAGACATGCAACTACGGGAGGGGTGACAGGAAGACAA,CCTCAAACCTCTACCACCCAAGTGCTGGCATCCTCCCTGTCCTGCTTCACCTGAGACCCCCCTTGTCTCATTAGACATGCAACTACGGGAGGGGTGACAG > chr1 37129 37229 GTGAAATCTAAGTGCAGATCCCATATTTCCAATAAAAAGGTAACATCCAAACTCAGATGTCCTATGAGTATAAAATACACAAAGATCTTCTGGACTTAGT > chr1 37516 37616 AGGGCAGGGCCAAGGGCGGCTTGGTGGGGTGGGGATGGGATGCACAGAGATAACTCCAACCCTTAAGAAGGTGTTTCCTAGAGCAGGCTGTGACCTGTCA > chr1 37904 37996 TTAAGGAGGGGAGACCAGGTCCTGAGTAAAGTTGAAGGGGAGGGGCTGAGTCCTGCTAGCCAGGAGTCTCATCCCCTGGGGAAGTTCCAGGGACCCCTCA > chr1 38283 38380 GGCTCGGAGGACTCGCCACTGCTCAAAGGCAGTGAGGATTTTCGCACTAGAAGCTGGAGGACAGGGATCCTTGTTAGGTAGGAGCAGAAAGCTTAGAAAA > chr1 38609 38709 AGATGCTGAAATTAACAAATGGCTTCTGAGCATGTGGCATAGGGTGTAACTGTACAGTCTTTTGTGATTATGCATAAAGATCAAAGGATGGGAGTAGCAA > chr1 38980 39088 GGACAGAGTGCAAAATGAAAGAAGACTGTCAGAGACCCCAAACTCTGCTGTCAAGAAGAAGGCTGATAAAACTACTTGGCTGCAAACACGTGGATCTTTC,TGCAAAATGAAAGAAGACTGTCAGAGACCCCAAACTCTGCTGTCAAGAAGAAGGCTGATAAAACTACTTGGCTGCAAACACGTGGATCTTTCGTGAGAAA > chr1 39099 39199 CCAGAGGCAGAAGCCCAGAAGGCAGAGCCAAGAGACATGGAATCTTCCCACATCTTAAAACCTGTTTAGGGAACACCAGCATCTGTCCAGCTGGATTTCA > chr1 39418 39585 GTTTTGCATGCACAAGGGACAGGAGTCTTGGGGACAGAGGACAGGCTGTGGTGGCAGATACTAAGGTGACCCCCCACAACCCCCACCTCTGCCATTCACA,GACCCCCCACACCCCCCACCTCTGCCATTCACACCCTTGAATAATCCCCTTCTCTGGTTGTAAGCAGAACCTGTGGCTTGCTTATGAAGGAGGCGGTATA,TCCCCTTCTCTGGTTGTAAGCAGAACCTGTGGCTTGCTTATGAAGGAGGCGGTATATATGTGATTCATGTACTGATCATATTGTATAAGATCACTGGCTG > chr1 39920 40020 AAAATGTTAAGATCATAACCTGTCTTTCTGGGGACTCTCTCTTGACGCCTTTGAAGAAGCAGGCTGCCATGTTGCAAGCTGCCTCATGGAGGGGATCAGC > chr1 43646 43746 TGCTATTTCTATTCCATATCGTACTAAAAGTCCTAGCCAGGACAATTAGACAAAATAAAAATAAAAACACCCAAATTGGAAAGATAGAAGCAAACTTTTC > chr1 43974 44074 ACCAAACATCTGTACACTAAAAACTATAAAACATTGAAAAAAGAAGTTGAATAAGACACATATAAATAGAAAGCTATCTCATGTTAATAGATTAGAAAAA > chr1 44085 44185 AAGATGTCCTCACTACTTAAAGCAATTTATAGATCTAATGCATTTATTGCAATCTCTTCAAAATCCCAAAGGTATTTTTGACAGAAATAAAAAAAAAATT > chr1 44304 44504 CAAAGCAACATGATACTGTCATAAAAACACACAGATAAACCTATGGAATGGAATAAAGAGCACAGAAATAAGTCCACACATTTACATTCAATTGATTTTC,AACAACAATGTCAAGAAGACAATGGGGAAAAGACAATCTCTTCAATAAATGATGCTGGAAAAACTATATATCCACATGCAGAAGAATGCAGTTGAATCCT > chr1 44688 44788 GCCAAATTAAAAAATTTCTAACAACAAAAGAAACGATCAATAGAGTGAAAAAGATAACCTCTTGAATGGGAGAAATATTTGCAAACTACTCATCCAACCG > chr1 45372 45472 GAAATAAGCTAGACACAGAAAGACAAATATTGCATGATCTCACTTAGAATCTAAAAAATCTGAACTCATAGAAGCAGAGAATAGTATGATGGTTACTAGG > chr1 45738 45867 TCAATTAAAAAATAATTTTTAAAAATGAGAAACAAAAAAGCTGACATTTTCAGATTAAAAAAATTATACAGAAGAATTAATTCATTAAAGTAAAAACAAA,AAAATAATTTTTAAAAATGAGAAACAAAAAAGCTGACATTTTCAGATTAAAAAAATTATACAGAAGAATTAATTCATTAAAGTAAAAACAAATGTGGGAA,AAACAAAAAAGCTGACATTTTCAGATTAAAAAAATTATACAGAAGAATTAATTCATTAAAGTAAAAACAAATGTGGGAAAATGGTTTTTAAATATAATTT > chr1 46111 46212 AGCTTGATGGTGGTCACTGTTTCACGATAAATATACATATGTATCAAAACATCACATTACACACCATAAAGATATATAACTTGTTATCAAAAAGAAATAT,GCTTGATGGTGGTCACTGTTTCACGATAAATATACATATGTATCAAAACATCACATTACACACCATAAAGATATATAACTTGTTATCAAAAAGAAATATA > chr1 47250 47346 ATGATAAATTTTGGAATAGTTAACAGATGATAAAAGTGTTGTTTTCAGTCATCCCTATCCAATGAAGTAAAAAAAAAAGTGTTGAATGGGAAGAAATCAA > chr1 47593 47693 TAACTCTTCTGATATTTTTTCTCTTGAGAAAATTAATATGACTCATAGATCTGGTTCCCAAGAGAAATCAATGGAGGCCTGGTTACAAGGATCTAAGAAG > chr1 47820 47920 AGTGTCACTACTGCACACCCTGGAACAGAACAGGTAGGTCAGAAAAACGCTCCCAAAGTTTAGCAATGTCAAGGCAATCTCTCTCTTCTTACATTTCCCT > chr1 48088 48193 ATAAGGATCTGTTATCTCTTGTCACCTTCCTTATGTCATATGATATGTCACATTTCCCACTGCGGAGACCAAACATGTTCACATCGTGTGCGTTCCATTT,GATCTGTTATCTCTTGTCACCTTCCTTATGTCATATGATATGTCACATTTCCCACTGCGGAGACCAAACATGTTCACATCGTGTGCGTTCCATCTTCCTA > chr1 48445 48677 AACGGGCAAAGATTTCATGACAAAGACACGGAAACCAATCACAACAAAAGCAAAAATTGAGAAGTGGAATCTAATAAAACAATAGCTTCTGCACAGCAAA,ACCAATCACAACAAAAGCAAAAATTGAGAAGTGGAATCTAATAAAACAATAGCTTCTGCACAGCAAAAGAAGCTACCAACAAAGTAAACAGACAACCTAC,CAGAATGGGAGAAAATATTTGCCAACTGTAAGTCTGACAAAAATCTAATATCTGGCAGCTATAAGGAACTTAAATTTACAAGACAAAAACAACCCCATTA > chr1 48681 48781 GTGGGCAAAGAACATGAATAGACACTCTCAAAAAAAGATATACATATGGTTAACAAGCATATGAAAAAAAAGCTCAATATACTGAGCATTAGAGAAATGC > chr1 48832 48932 TTAAAAAGTCAAAAATAACAGATATCGGTGAGGTTACAGAGAAAAGGGAACACTTATACACTGTTGGTGGGACTGTAAATTATTTCAACCATTGTGGAAA > chr1 48967 49067 ACAGAACTATCATTCAACCCAGCAATTCCATTACTGGGTATATACCCAGAAGAATATAAATCGTTCTACCATAAAGACGCATGCATGAGAATGTTCATTG > chr1 49092 49192 ATGGAATCAACTTAAATGCCCATCAGTAACAGACTGGATAAAGAAAGTGTGGTACAGATACACCGTGGATTACTATGCAGCCATAAAAAAGAACAAGATC fail merge.t34...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 421: 16057 Aborted $BT merge -i fullFields.bam -c 11 -o collapse > obs 0a1,112 > chr1 10003 10143 CCCFFFFFHHHHHJJIJJJJIGIIIJIGIGJJJJIJJJJIJIIJJDIIIJJIJEHEE@GAHHGE@CEFB;A>AB=??5?B?2? chr1 10358 10428 <@@DDDDEDHGHHIGII9;?GGGGBDFGIIIJIHGHJGI>?;DBBFBCFGGDCFGGGGEFAHA@BEFE>AA############################# > chr1 11780 11921 @@@DDABB?FBHDF82FGIGHEHBFE*:@BBFG??@AHI>GCHGGIEI<=B,3;6.>CD@>C:>>@;@:@@CC5=CCC@,CCCFFFFFHHHHHJJJJJJJJJJJDGHJIJIJJJJIIJJJJJJJJJJJIIJJJJJHIIJHHFFFFFEDEEEEDDCCDDDDDDDDDDDDDDDDDDDDCDDD > chr1 11996 12101 CCCFFFFFHHHHHJEHHIJJJJIJIJJJIJJJJJJJFGIIGHHIIJIIIJDFHIJJJJIJJJJIJJJEI7?EEH@CDFFEEEEEEDDCDDDDDBDDDDDD,@@CFFFFFHHHHFIIJJJJJIIJIJIJEIJJJIGIIIGEHIJJIJBGE>FFGHGIIIIIIJJGH@DEHHAEHHFFDFCFECCCDD?BDDDCCDDCCDCD4 > chr1 12136 12347 :@@:;>>;;5;>;C>3>6=53=;.=??::IJHHF@FDEGEAGE;GGFFFADDBDD?<@B,BCCFDDDDHHHHHJJIJJJJJJJJIJIJJJIGHIJIFIGJJJJJIIJIIJJDGGIHHGGHDFFFCEDBDD=BC>CB?B@BDDDDDDBDDDDD?@B@BDCBDDDDDBDBBDDDBDDB?DDDCCACDCBBBFFHHEEHJIJJJJIGIGJIJJIIIJIJIJJJJJIFJHHHGGFFFFFBCC,?@@DDDDADABFDFGHAEDH;BB8? > chr1 12400 12503 8>3CCCDCA<@:BA?@A9;/;897@CAFEBFFFFHHIGJJIJIGGHFIJJJIJJIJJIIGIIJJIHFC4HHGJJJJJIJIJIJIHHHHHFFFFF@C@,BA>CDCECDDDDBDBCC??=ADDDDEDEEFFFDBEHHHGJJJJIJIJJIGIGIHCJJJIJIJJIJIJGIIIJJJJJJJJJJJJJJJJHHHHHFFFFFCCC > chr1 12635 12779 BBB@DDDCCCAACCDDDDDCDDDDDCC@ACCCCCCCDBAHE>IIHFJJIIHGHFD@>JJJJJJIJJHEGGJJJIJJJJJJIIJJJIJHHHHHFFFFF@CC,##############################################HGD@AF<7??))*:***1?**91**3F?:29<+<+:@:)++2<22+:D8DA:+?,C@@DDFFFHHHHHJJJDGFEHEFB chr1 12819 12919 @@@FFDDEHFFHHGIIIIII@EHIAEHGIHG9HFGIIIIDEEHG>DGHEB?AHIGIIIIIIIEHHIFHHGFFFFFFDECE>>@BBC@?B??BBCCCECCC > chr1 13039 13139 C>?AAC>:>@>CC?DC?DDDDDDDDDBBAACEDDFFEE?EIGIIG@GFABACHBIJJIJIH@JIGGIGHFFDGG@BHCECGHGBGDFHAGHHFDFDD@C@ > chr1 13165 13287 CCCFFFFEHHHHH=GHEGIIIIHHIGGGHGJ@AHEHEHEIDGIIFHGJJGH@GGIIHHHFFBCBEEEDDD?BBDAACDD,:3C?@>>A>?;29EEHEG@GG@=/56BIJJIJGHIGIHFGEGGIIJGHGGGF=IIGHFE@JIGHFDFCHFFFFD@@@ > chr1 13561 13731 DCCCADBDDDDDEDDDDDDDEDBB>DEEFFFFFHHHHJIHIJJJIIIIGDJIGGIJJJIGJJJIHJJIJJJJJIJJJJIIJJJJJJJHHHHHFDFFFCCC,CC@FFFFFHHHHHJJJHIJJJJJJJJHIJIGHJJJHIJJJHGIIIIGHIIIHIIEHHHFFFFC?CCBC@CEDDDDDCDDBDDDDDDDDCDCCCD?CD@CA > chr1 14025 14125 CC@:3597BBBCDDDDDDDD@CCAADFFFDE??HJIIGGHIIHFHGGHCJHGJIIJJJJJHEHGJJJJJJJJIJJJGGHHHFFFDD?@B > chr1 14221 14340 @C@FFFFFGHHGHIIGHGGHGHDHGIJJIJICHIHJJJJGIJJEGEIJIIIHJIIGIEIIIIG=CGHEHHHBED>;>CECD@??@=BDCDDDCDCADDBD,@CCDFFEFDBF?HIGIBHGCHGGGEGGGEGIIIIIIIGHIIIIIFHIIIIIIIIIFGIIIEEEGHEBDDEFFEECECCCCBBBCABBBCBB>BBB chr1 14440 14715 C@CFFFFFHGHHHJJIJIIIJJJJJHIFGHIIBGHECHJBFHHIIIIIJHEHFDBDDDDDDDDCCDBBBBBBC?CCC@CDDDDDDDB@D@C@C:A@+8>?,@CCFDFFDDHFDHBGBHGIGGIEIIIGHIIIIGIIIIFHGBGCFDDGGIGIIIIIIIIEGHHHFFFEA?A??B;>>A@CCDACDCDBAACACCCCDA??A,@@@FFFFFFBFHHDHGHGDHECHIJGHIBFFGIGGIJFHGHGBFHHIIJFGHHGI>@EHHEB@@?A@CE>C>@AC>CCCCC9A>@??CC@>9ACB#####,CCCFFFFFHHHHHJJIIIFHIIHGEIIJJJJIJJJIIIGHIIFIIJHIIJJJJJJIIJIIJJEGHFDA?A;@CDDD;@@A,B9B@ACCBDDCDDCACCDB@CDDDDBBBBCDCAAA@ACB>BFEDEEBIGHGGJJGIIGDBHEGFDFFGIIHDFFJHEHHFD?DDDB?@<@,######B?AA82+(2?<443:DC@:>4CC8(00@<CC8<9(991==99EGCGF@CIGC=9 chr1 14805 15172 BDBCCDDDDDDDBDCDDCCCCDDDCCDDDDDCCACDDDDDDDDDDDDDDDDDB@DDDDEDCB>FFFHHHGGJJFIJJIGHGJIJJJJHHFHHFFDDFC@B,CCCFFFFFHHHHHJIIJCFHGGIJFEHIIIGJJJJJJGIJJJJJFIJJJHHFDC@9@CCDDDEEDDDDD?DDDDDDDDDDDDBBC?CDCDCACDDD(>AC,>44CA9<8A<<8829.BB>>?B@988(->:<89+B?BDDDDDEECFEC@@HEEHHHDDC7JIIGGIGGIGIHGDDIGJIIGHF chr1 15250 15350 DBBDDDDDDDDCDCCC@EDDDDDDEEEEEFFFDEBHHGJIIJJJJIHCGCJGIGGIIIIIIIJIHGIJIIJJJIJJIJJJJJJIIGIHHHHGFFFFDCC@ > chr1 15470 15603 EDCC>ACDDCDDCDDCADDDDBDCACA;EEEFFEFHEGHIHJIIJJJJJIJJJJJIGJJJJJJIGIJIJJIIGJIJJJJJJJJIJJIHHHHHFFFFFCCC,DBC@CBD>DDDBDDCCDDDDDDBCFFFFFHBHHHJIJJJIJJJJJJIIHFGIGGJJJJIJJJJJJIJIFJIIJIJIHJIIFJJJHJJHFHHHFFFFFC@C > chr1 15924 16065 CCCFFFFFHHHHHJJJJJJIIJIJJJJJJJJJJJHIJ chr1 16155 16255 C@@FFFFFHHGGHJJJJIGGHIIJIJJIIIIJGIJDEIIGAGGIIIJJJJHIIDGIJJJJJHHHGEEEDFFFFEDEDDEDCCDDDDDBD@@DDAB?A?C@ > chr1 16314 16438 EEDDDEEDCDDDDDDDCDDDDDCEEECFFFFFD>HHJJIHIJJHJJJJJJJJIJJJJJIJIJJIJIJJJIJJJJJJJJJJJIJJJJJHHHHHFFFFFCCC,CDDDDCDC<;BDDDDDDDDDDDDDDECFDFFFFEHECEAGEGHEG@JIIIJJIGJJHGJJJJJGIJIJJIJJJIIJJIJJJJIJIJIHHHHHFFFFFB@@ > chr1 16561 16661 CCDCCA8(?CCDEDEDCADDDBBDBDDCDDDDDDDDBDDBDDDCDDCDDDDDDDFFGGIHCJJIJJIIJIJIJIJIJJJJIJJIGGEHHHHDFEDDF@@B > chr1 16945 17038 ?@=DD?BDBFDFEGIAF2BB;D@DAB.8=53=D?CCAEEC3@;@EC:63;=?B35;29?8AB,5>9(:+4 chr1 17372 17472 CDBDDDDDCCBBBB>C?CA?DDDDCC>:';8?@GEHCHCIHFGHEIGGGHGFBD chr1 17525 17625 @@@DDDDFHHHDHIJIDB?;ECFHIJJJJJIGIIJGHGHIGGEGJJGIIHHFFFDDD?BBD?BD9ABDDDDD>CCBDACDDDDCDCDDD<<<@0<2 chr1 17634 17734 @@@FFFDDHFHHDIIIIGGHIHGGGGHBGCBDHIBHECHIGIJEA?FGJEIIJFHIIJ@EHHGGBDF>>B:@BD:5>CC>>ACDB<<8:CCCDC > chr1 17908 18008 CA@:(89??<25&59&50059A?A83BDDB>BBCBFHB@1HHIIGCIIHHDHDFEEHF@@HEGGAAD:AHEDDFD@@@ > chr1 18033 18133 >CB?A@A>5,9AC@@DDCCCC>>5.6.=@@ECFHCFHAIGHGGGJIHGEHGGIEIGHHF>FDEHHEFC;GIHHDHFDFFDD<@@ > chr1 18152 18252 B@CFFFFFHHHHHIJJJGHIHIJCHIJDFI?GGHGGIGGIJJJJJJIGGGIFGIJGHEBFDFFDD?B?>AC:ADB@BBBCDB:A44::>@CCCC:83< chr1 18264 18364 CCCFFFFFHHFHHIGIGGGIJGJIIGIEHHBGIIIJJIIJGGGEGGFF@FFF=DGIFIGHGGJJJIJJEIEEHHHFDDBDDEECB@ACBDD@;@CDCC@C > chr1 18577 18742 >:ACAC?IJJGGHBHGGCIIJHGHJJIIHGIJHHIGGAHEHIIHHGHHFFFFFCCC,@>9?BBBBAA?AC@@?;6;>CC@B?BFFHEEHHEAD@D>@C@7@=FGGFCCC8B@CBDHHF? chr1 19658 19758 ???DFFABFDDB?;ABA;CFED@F9AD>@D;3(;=;AB?@?>?1(42<8:A:>AC > chr1 19819 19966 CCCFFFFFHHGGHHHIJJJJGHJIJJIIEHHJIIJJJGGIIIIIJIFGIHHHIHIJJJIIJIJIGIEGIGHGHFFFFFDEED;3=>@>CCDDDB@9:?A@,CCCFFFFFHHHHHJJJJJJJJJJGJIJJJJJJJJJDHGJJJJIHHHIJJJHGJ@DHHEHEFFFFFEEEEEEEDEDEEDD?DDDDDDDDDDBDACDD?@DD > chr1 20059 20320 CA:4(?<53:::5CCC>C?C@>C@BCCCCCCCA>>CC>CC@B;@DCCEHACE>D=AD>DCECC;A:EEGHF@EEHGCHEG=GGGFA:BHFDFDDDDD@@@,@CCFFFFFHGHHGIIEGHHAHHGJIIGIIGGEEFHHFGGDCGGGIICHGGG;?DGIJII=EBD?CF>CCC>BBDD?BCDCDDDD?@CD?C(:@@CA?CCC,@?@AD?BDF:C8F:CGF8?CDGFI@GFEDD;B2?BB@FB>F@FFFIFC77?CCB>B>3;>;A@C6;;>ABBB(:@@@BDAABABB>A@AA>><>B@59<@,C@CFFDEFHHHFDFHIGIIEHGHGJJJJJGGGIIJJIIJJFIG?FHGFGFGE@DCHHJGAEHFHHHFFFF>CCCDEDDDDCDDADDBBBDBCCADCDCDD,DDDCCBBDBDDDDDDDEECEEFFDFFGHJJJIJJIJIJJJIJIIIFJJJJJJIJJJJIJJJJJJJIJJJJJJJJJJJJJJJJJJJJJHGHHHFFEDFCCC,:CCACDDDDDDDDDDEEECEDFFEFFE=EHHEFIIGIIJJIJJIJJIIIIHEJJIGEIJJJJJJJJJJJJJJJJJJJJJJJJJJJIIGGHHHFFFDFCCC > chr1 20457 20627 CDCCAAIHHF4JIIGGJJIGJIIGHGHHFF>DDFFFC@@,############CB??>@CEEA?.3@A?GGC8)78/)=4=8>B?D?94?<>F@HGHF9?:4F9? chr1 20641 20741 B@?DA;DAB?DHFIE<AA;CHHHA?2;?C>C>3>>ADCDBCBB?A??BDC>BB > chr1 20754 20854 CCCFFFFFHHGGHIIJJJIGIIGIIJIGGGJEHBHIIJJJJJIJJJFFHGBCFFDFHIJIIJIHH=ACDDFDFEEDCCDDBACDCDDDCCCA9A9ABBAB > chr1 21047 21139 ########@>>9B chr1 21177 21277 CDDDDDC?DCDDDB?DDDDDDDDBBB?BDDA@DCECCDFFFHHHJJIHGCHGHDGGHGJJJIGJJIIGHGFIHEJJJJJIJJJJJIIFHFHHDDDDF@@B > chr1 21449 21549 @?@FDDFDFHHHHGIIJIIJIGJJGHHGIGIIJJIJJJJJJIIJJJHJIIIIJIJJJIIAHIIHGIGHHGEHHDDBDDFFECECCCDCC?B@B: chr1 21834 22029 ##########?@@90989AC><>@DD@8@CC@>3CA9+9DDBAAABA@>2CABA83838338<<296(?883(B@507:GAAAA:DB>DFD@@@,B@@FFFFFHHGGHGGIIJGIIIJGIGIGIGGIJJIGIIGIGIGIHEFGGGEHGIABHFFFFEEEEDDD=CDCDDBC?>ACACCDCACCCC?>28<8??@C,BCCFFFFFHHHHHJJJJJJJJJIIIJJJJJGIIJIJFIJFHBFHEIIJIGIGGHIDH==CHFHFF?BD;?BBDDDCDCCCCCACDDDDEEDEDDDDDACD,@@@FFFFDHFHHHJJGGGGHGIIHGGGIIIIIIIIII<@FDHIJJJIJGIEFFHIJGICHH@FHIHIIIIHGHHHFFFFB?CDDDD3>CCCC:ACCBBBD > chr1 22061 22149 +=1++=?:+=C??E??:AABA+G411:1:1:)::B2??DDB<*9=..).8@:98=3@7='-;;B@32;6.6;5?A############ > chr1 22242 22448 #DBDB>:;3CCCACC?EBFDFFHHHFFHGDAE@EG@5GIIGIGJJHGHHGGB4D?9CGG@GHHFDIHFGGHDGGDBHFFDDAAFD@@@,BB@FFFDFDDHGHJIBHIJIIIIIIGIIJJJCHIFGGIIGIJJGIIJJJJIIIIJJIGIJEHHHHFFE@DFACEEECDDDDEDEDDBCCDCDDDDDD>CD,DDCCDDDDDDDDCCDDB@@BDDEECDFFFFFECBHDGHJJJIHC;A=IGHFCIIGJIIJGHHIIGAD@BCEIEIJJJGGBIGIJIGHF?GHHFFFFFCCC,DDCBBDA:ABDBDDDDDDCEEEEEEEFFEFEDFHHHGD;JIJJJIIJIHEFJJGGGJJJJJIJJIJJJJIJJJJJJJJJIJJJJIJJHHGHHFFFFFCBC,DDDCDBDCCCCC@CDDDDDDCADC@EBCCEFFFFEHGFHGHGIIHGHEHHCIGGCHAHGFBHDHGHDFJIJJJIGJIGJJJIIHFGGHHHD?FFFFFC@@ > chr1 22512 22566 ##############################################D?)1B90*:*?*:**?13BE?81;CA24@FAFFACDAE<+? chr1 22748 22848 @@@DDB?DBDHIEGCF@=)8=;DHGGF;CCBDDD>AA>>A?@>BBDCDB chr1 22870 22970 @@@DFDDFDBFHHAHDGBCGCGFCHEHDF@EDG@GIGI>>8AB<(4::?3:CCC > chr1 23130 23228 ##A;(DECDDE??@;DHCE?A;@D=4CC@7@CDFB3CF9D9EF?B*@DCEDIHEHGIGDEGG>CEGIGJIIIHE>HBDGHCAFGHEGDDFAFDFFFD@@@ > chr1 23250 23350 B<85BCCC>ADCC=@@9,;=;>A=B@DFEEHGHIE@=ADC@F=;=GHB@B@BAFB?B?AIIGC>IHGG?A?<0?=FDD??= > chr1 23557 23615 =+?DF+++2+2)<))))1*1*)1):BF?8*)?0('(.8@=FG)7=@C?;?>CC@6;=B########################################## > chr1 24000 24120 ########################################A9?.@((3=;;=2FB;F?=?;990*B9?1)?;G?A:BGGEC@FFAFIFBB@>BDDDA@AC@@=AA;>;>5>>>??A9A5>ABBB:3<>@? > chr1 24248 24612 CC@FFFFDFFHFHJIJGJIHJJIJJJJJJJJJIJJJJJIHIJHEIIJJIIIJJJGHIJJIIJJJJIEGGGIGIIIIIIJIJIGHHEEFD>?@CCB?BBCC,@@@FFFFFHFHHHJDHBGHHGIEHHBHICEDHIIGHEGIHBGEHHIJDFIIGHJJIGGGEGIJDHIIIGJIIIIIFHJICHIHFEEFE:A>@@5=?@B5>,?C@EH9<:):C?FGCC)7?D@?@=FGHI@D@FA@EHE;A(.?C@>((;;3;>>@5>??B9:(:@3:(5::<5<>BBB#,DDDDDDDDDDDDDDDDDDDDDEFFFFHHHGHHHJIJJIHHF@IHGFFCGFIJIFJIHFIIIGIIIIHEHIIGIJJIJJIIJJIJJJIGHHGHFFDFFB@C,DC@@D@@CCCB??=DDDEEEECFFCFDE=EAHIJGGD>@GGHHEBIF@FDHGJIJJJIJJJJHFBJIIJJJIGDIHGEIHIIIHGFGFHFHHFFFDF@CB,?<@DDDDDH?+C@GHHGG:CGCEFGGEECDD87(?DBBHBDDHGIGIFEHHDDEE@CACCC=CCCCC@:5@A(39 chr1 24683 24850 #########################C?=;;;>>>@@;2DHHEC*FC:@:<+CGE?GHEFDHFFDFA+DBF@@@,@B@FFDFFDH>FDHHGIJGJGHIJIE?FGDBH(;;@@9FEHG=?AEEEFF@CAEC(>;>CCC@@@C::@<:C@CB?@CCAA@CD9<89ACD@8,############CCCB@:A>+(33?<:?:(&&555(CCC?BDCC888'9519((,?:5'4@)F@B9EDDB@; chr1 24921 25011 ##########@9505:050)<>?9005?@DBB;)=77?=@D@AHEFHCAIECJBF chr1 25055 25291 BDDDDDDCDDCCCCCDA?BC;ADDCDCCEDFFFFHHHHHHHJIIGIJJJJJGIIIIJIGGJJIJJIJJIGJJIJIJJJJJIIIJJJJHGHHHFFFDD=4+,C@@FDFFFFHHHGIIHHHIJJADEHIGHE?CC@5>>@ADDCDFEDCDDDBBDDDDDDD<:@@CDDDDEDCC,:==D;DDAHHHHHI2A@>HIBGHIGHIG@HGE=FGGHGHIGIIIIGHEICCFHEHIIGGHE:@@@DGHEEEDFFF@DCAEEDC?C=C@CCC:,9?BCCCB,CCCFFFFFHHHGHJIIJJJJJJIJIJIJFHHIIHIIIIJGGIDIJIJCHIBGGIJIJJJJJJJIIHHEEEFFDDDEEDCDDDDDDDDDDDDDDDD?CCDC > chr1 25403 25740 <@@FBDDFHFHGHIHI@=DEBGGHIIIIIIIIIEEBGGGHGBHEBD*?D>DH=FFGCDHEC:?B,909B>AA>DCCCDCCDCCCA>?A;(6B?=/FIGE@=CF@GGCGHD?CGIIIGGIGB:IIGGEIIHG:EDCCDDBDDEDCEFFFFEFHEGHHEEAEEG@GIIIHGFEGFCIIIIHBIIIIIIIGHC4GIIIHCFFIIFIHHFDEGGGHEFCDAFF8FFFFC@@,DCBDDDDDEEDEEEFFFFFFHHHHEHGGGIIIJIGJJJJJIJJJIJJJJIGIJJIGGHDIGHJJJJJJIJJJJJJJJJIJJIJJJJJHHHHHFFFFFCCC,@@CFFFFFGHDHHIIJIEIJIGICEGIJIGHGIJIIGGIJIIDEGIIIIJGGHIJJGG;@FHHIIGGHHHFEFFDFDCDEEDDDCC9A@BBDDBDC?C>C > chr1 25767 25867 CA>+<<0?A;@EB?.)?)?EEE@EIG@5IHECEHGGF?9)00D@EEGGBHFCCGGDF>IGGHJIJIIJIEGFDHFFDAFFF@@@ > chr1 26053 26153 CBBDBBDDDDDCDDDDDBBDDBDB?DCDFFFFHGHHJJIIGGGIIIJJIIIHG?JIJGJIJJJJJJJIJIGIJJJJJIHFAIIJIIJGHHGHFFFFFCC@ > chr1 26406 26506 CC@FFFFFHHHGHIJJIJJIIJIJIJGJIHIHFHIJJJJJJJJIJJIIFGFGGEHIGHIJGJEGGIJJIJJIJJJEHHHHHFFFFE@6;@AC@CDDCDCC > chr1 26680 26883 BCCFFF:DFHHHHJJJJJIIIJJJJIJIJJJJGHIJJIIIJJIJJIIDGIFHHGGJJJJJJIJJGIGGIHIIIGH?DEED@CEEEBBDCDDCDDCCDCCC,CCCFFFFFHHHHHICDHHIIIJJIIGGIJJJEHHIIIJJJGHDGIIJIIIJJJIJIIIJJJGIGIHDEHCHFEFEDCCDDDDDD@9@DDDDB@BB>CDDD,B@CFFFDEHHGHHJJFGCGEGGGIIIIJJJJIJJIJJIHHJIGIIIHIIJJJJJJJI>:=BBBB/;@BDBCCBDDB@>ADEA@@CCBCBCCC39<229@<,########DDB>@@90<=@@CDDBB@C?EEEC>D@6HHHFCGEIGF>GHHIGEGFGHHGDJIGHIHHFFDJHGJIGGCHGIGEGHHHFFHDHDEFDA@@B > chr1 27102 27252 DDDDDDDDCDDEEDDDDDDDDDDCDEEDEFFFFEAHIGJIJJIIJJJJJJJJJJJJJJJJIJIJJJJJJJJJJJJJJJJJJIHJJJJHHHHHFFFFFCCC,CDCBDDDDBCCA>@;9DDCA?CA?=A;;6EEBC>CB@=2CEE@3GIJJIJIGGJJIGGJJIGHHIGIGHIGHHDEJJJIGHEJIJJJJFIHFCHCGGGJIJJJJIIHHFFHFDFFFCCB > chr1 27582 27785 @B+ADADDDDFHDDG9A@HCHIC4FHGGIJGIJIFIBCGGGGEGIGBDBFGGHB@FGC<@CGI@AD;CEHHHHF@C;BCDEDE>ACCCDDDDD@3>@@C3,@CCFFFFFHHFFHJJIGHGIJGHIJJJJJJJIJIJIJJJJIHIJIJIHJJGIJJJJJJIFIJIGIJJJIJIICEGFHFGHCHFFDFFFEDEEDEEC@CCC,@@@DDDDDFFHFHIBAFEEHEEHHDFB?>BGHHHGEEHIIFEHCDH>DG9DFHGGIGAE>BC>BF@=AEHCACDEEDEDACCC@CC,CCCFFFFFHHHHGIJJJJJJHHJJJJJJJJJJJJJJJJJJIJIIJIJJJJJJJJJJIJJJJJJJJJJJJIJJJJJHIEHHHHHHHFFFFFFFEEEEEFED > chr1 27995 28187 ECCDCDCCCBCCEEEEHHFCEIHIHIGIIEIGGIHGEE>GIIFIIIIIIIIIIGGIGGGIIIGGE?IHF?IIIGIHG@GEIIIFGEIHFHFAADDDD@@@,CCCFFFFFHHHHHJJJJJJJJJJJJIJJJJJIJJJJHIJGIIJJJJJJIJHHGHHIJJJJIJJJJJJJJJJHIHIIIJGHICGHHHHHHFFFFFECCEEE,EDDDDDDDDDECEDFFFEHHHHHJIJJJIIGIGHFHIIJJJIGIJGGGDJJIJIIJJJJIHFJJJJJJJJJJIIHHIIHJJJJJJJJHHHHHFFFFFCCC,CBCFFFFFHHHHHJHIJIIJIJJJJJJJJJIJJJJJJIJJJJJJIJJJJJJIIJIIJJJIJJJIJJJJJJIJJJJHGHFHIIJHHGHHHFFFFDDEDDDD,DEDDCDDECEEEFCEFEBA=HHJJJGJJJIHG@JGGJJJJJJIJHHGIIHJIHJJJJIJJIHJJIJIJIJJJIIJJJIIJJJJJJIJHHHHHFFFFFCCC,###?:9:@CAEDC>>C>5CC@AA>>>FFDDC?@GCDBDDD@@< > chr1 28198 28298 CBCFFFFFHHHHHJIJJJJJJJJIIJJJJJJJJJJJJJJJIJFHFHIJJEHHIJJFIIJJJJJJJJJJIJJJJHHHHHFFFFDDDDDDCAADD9ACDDDC > chr1 28439 28545 #####C@CDDDDCDDCDDCEEEEEDDCFFHHFHIIJJJJJJJIIHFIGIIIIIIHFHAGIJIJJIHJJJJIJJIIGGGJHGCIIJJJHGHHHFFFFFBC@,DDCCDDCAEDACCB?5DEEECCBCDDGHHHFGJGEGHIGJGGIHCIIGIIGIHGGHBIHFHGGDGIIIGGBJIIJJIIJIJJJJJJJGGHHHFDDFFCC@ > chr1 28577 28674 >>>@>8??2<<2A<8DDDDBBDDDFHGHHHHJIJJJIJJJIGJJJJJIHGJIGIJJIJJJJJJJJJJJJJJJJIIIIIJIJJJJJJJHHHHHFFFFFCCC > chr1 28679 28808 CCCFFFFFHHHHHJJJJJJJJJJJJJJIIJJJJJJJIJJJIJJIJJJJIJIJIJGJJJJIJGHHHHFFFFDDDDD=@BDDEDDDECDDDDDDDDCDBB>@,CCCFFFFFHHGGHJIJFIJJJJFIIJJGIJJGIEIJIIDGGGIIIGHIFHHHHHFFFFFCDDEDDDD>@@;@BCC3?ACCCCCBDD5?C?CCCDBB chr1 29089 29191 A?9@BBBDDDDDDDDDDB>DBDDDDBBDDDDDDBDDDDDDDDDDDDDDDDDDDBDDDEEDDDFFHEJIHGGJJJJJJJJJJJJJJJHHHHHDFFFFCCB > chr1 29331 29431 CCCFFFFFHHHHHJJJJIIJJJJIJJIJJIIJIJHHHFFDDDDBDDDD?CACDDDDDDDDDDDDDDBBBCCDBDDB@B@BBBDDD>B9BBAACB@7>@>B > chr1 29686 29786 BB7DDCDC?9B@ chr1 30409 30509 C@@FFFFFHHHHHIJHGHHIIJIJJJJFHIJGGGIIHGHIIJGGIJGJIGGHIEHGHHJJIEEGGIIGHFHHFHDEFFFFCEEEECCECCAAACDCDEDE > chr1 30809 30909 DBBBB>9@BB>C>>>CEEDEDDDCDCDCCA:EDFFDFFFEHGHEGJJJJJJIHGHEIGIHIGIHGIJHHGJJJJJGIIJIJJJJIJJHHGHHDDFFD@@@ > chr1 31781 31881 @@@DBDFDBH;FDEBFDGEFFEFHD@FFE?E?EBDDFHICADHIIFIGBHDEGGGGBAHIEE;EG@GCHHEEHB;>?BCEECCEEBCCB@BB?BBDB?4: > chr1 32173 32273 BB>@9CCBAAC=553@;>CCCC>>CBD?FEAAHCCED=E=CIHFBFAEACGAGGHDGAD99HCGIHGGF=IJFJJHGEIHF@BFHHFF;?DDB@B@ > chr1 32519 32619 @CCFFDDFHHHHHJDHIIIJJJJJJJJIJJIIIEFHIJIJJJJJIJJGFEGIHGJJJJIGIFFIFHI chr1 32732 32832 @?@DD?DDBHHBF@E?FHG;FHIDGEF@HIGI@GGFHG>HCHBGBGHH;;;A2,8@C@CCCC:5<85@BCA > chr1 32926 33120 DCCADCEEEC@@DBB@;DHHGHGIJGHJJIIIHFDIIIJGIJJJJJJIIGJIIGJIIIJIJIHJJJJJIGIIHEIIIGJJJIJIJJIHGHHHFFFFFCCC,@@CDDEFFHHHFHJJIGHI9FFCGHBCC2A@FGGI@?BGGDG4?FHAABFD>@4;;=@@E;DEC@EC=E=>@;;B;?6@>CEDEBD;; > chr1 33143 33289 6C@;(36;.)@;CEA;?)=DC3@@EF@:EGFA=4@B?EHE9*CC4@EH@D?I chr1 33449 33669 ##############BDDDDDB@9BCCCDDC@5CC>C@=BDCA9CCDC?BEC;:FFDFFGHIIIIHIIIGIGGHD;?HBE9BHGIHHFBD9FE chr1 33842 33931 BB@AA2AD3:+:CHC;)??E*::*?BF?BGBG**090**/*0?F*9(8=CBC.8778@C;@.).)7?=AA73;@########### > chr1 33933 34044 ###@:9?;99=(EA?;>?>FFFE>>:=74=B;8.))88.)(3B;? chr1 34070 34162 <=?DDFEFHGGHFGGIFGGIFGIIIBEB<<CC;>6;5;ACCC######## > chr1 34268 34451 C>9,9A;89=::@>A;;@CB;;=:AA7@=D=A;FEHFB@IF@B?@D:A:>DDDCAA92DBBDB????66>@A;;;DDEHHDE=.2F@@@B=====;ECAIHFBDB9??B??:1HD:@@HFACDB?CEHBHHFBDEADD@ chr1 34511 34606 #####BCAA;CECCA@EBEFFECADC=3=)HC@=( chr1 35413 35513 ;B chr1 35792 35892 >8<8.??8?CCBCCCCCCCCC>6;A@@D>B@:FHHHFGEHIHIHBHIIHFF??F chr1 36101 36201 CCCFFFFFHHHHGIJJJICHIJJIJJI;FHGGHJJIJJIIJIIJIJGIIJJJJIJI@GG>CHEFHFFDFFDAB@6@>CCCCDDD9>>?B8AB### > chr1 36528 36625 5+8CC@DDDDDDCBC?B???DCDEDBFFHFFHCC;GIGIHGA@;GIJJJJJIGEJIGICG@IIJJJIJIHFIJJIIIEIJJGHHHHAFFFF@@@,################DDDDC?3?:(>A>98;82BB?+?ACC?5770IFIGIGGIIJGIGGGHEJJJJIGGGGCJIHHHHHFFFDFCCC > chr1 37129 37229 CCCFFFFFHHHHFHIIIGIJIJIJJJJJJJIJJIJJIJIGFHIHIIGIHHGJJIJJHJIIGIIJJIII@GGGGHGIEGIJJHHGHFFFFFFFCCCEE>C> > chr1 37516 37616 DBADBABCCCCC chr1 37904 37996 @@@DFFFFFFDDFIGCDHIHGICHEIDGGHCDBDGCHHGGGAGGBEEBBD?CD@C@AC@A=>AB=BACCAADA>9<9?BBC?9?:@C@CC?B######## > chr1 38283 38380 ###BB>:>55,;@@BA>>ECDFCCB>DHEEA=:@:GHCAGGGEFF?DB?BHIGHED@HD?CHFC3EGG=F?EHGGGDFBIIIHDHEJHHBFFFEDDA<@@ > chr1 38609 38709 CCCFFFFFHHHHHJJJJHGHHGGIGGADDHIHFBFHIJIGGCECDFGHGGIIIGIEHFGIIIGGHJIJJEIFIIGCHH>A;CFFFFFFFADBCB?CCCAC > chr1 38980 39088 555553A;AC@@AFA;ECC@;F@DC?773AEA?ABA5()HEC=)9??99?9 chr1 39099 39199 @@@DADDDHF=FFDGGIGCHEIG@CCGG;CGGCCGIEGGBFGHIJIIIJJIIGEHIIJGHIDAEEEEC>;DFD@CCCDDDCADD<>@@@:ACDD@CCDDC > chr1 39418 39585 BCDC>>C>@@DDDCCADDDDDDDDCDDDCDDDDCCCDDCCDDCBBDDDB?DCDCEEDDC>DDDCCAA73DGIDGHFHHFIJHGC+IGFGHDHFEEDD@@@,####BDB?<90&B>B?9,<9GHGGFAFDHHDDFDDD@@@,@@@FFDDFDFHBBFHEIBHIBE@EGHIIIGGIGIIE3?F?99?99B9BA=;A-:;>C########################################### > chr1 39920 40020 >@:>CDCC@::C>:(:>:8IHFAGCHCIIGIEIIHGHDFHHFDFFDFC@@ > chr1 43646 43746 C@CFFFFFHHHHHJJJJJIJIHGIJIJJJJEHIJJJJJIJJIJJJIJJJIIJJJJJIJJJIIJJJJJJIJIIHHHEHFFFF@AECCCEDDDCC;?CDDCC > chr1 43974 44074 CCCFFFFFHHHGFIIIJJIJJJJJJJJJJJJJJJJJIJJIIIGIIJGGEGIIIIGHIJJIIIIIHHGICHIGFCECEFCDDCDEEEDEDEDEDCCCDDDD > chr1 44085 44185 DDCCCBAA>(C@C>;CCCCA>DDDDCAB;;DCECACEDEDFEFEB>E?A?C=3=;CE;AIHF=8IHDIHAHF>DJJIHFFBB>GIHGDHHHHFFFFFB@@ > chr1 44304 44504 CCCFFFFFHHHHHIIJJJGIJJIJJIJJGJJJIJIJIIIJJJJJIJJIIJJIGIJJJJJJJIIJJJJJJJJIEHCCHHFFDFFEEEEEEDEEEDDDDEDE,CCAFFFFFFFFHHHGHJGIJJJIIIJIJIGJJIEIJJJIIGJCGIJJJJIJJJIIJJJJJJIHJJIJIIIHJHEJIHJIJJJJIJJJHHGHHFFFFFCCC > chr1 44688 44788 DDDEECDDDEEDEFCDDDAECHHJJJJIEIGGHJJJIJJIGJJJJIJIIHJJIICF?HHIJJIJJJFJGJJJIIJJJIJIJJJHHGHFHBFF>FFDDCBB > chr1 45372 45472 @@BDDEDDHHHHDHGIEHHIJJJIGGEFAHGIGIGGHIIJIIJEICEFHGGEHHIIJGHGHGGGHIIJJIIIGGHGFHHFDFFF;@CEAEEADDDDCDDD > chr1 45738 45867 CCDDDBDDDDDEDCDDDCEDEDEFFEFFFEC?GGIIIIIIGHFAGHEDEGIJICJJIGGGIIGCGJIHJIGGIIIHCCHGECIIIJJHHHHHFFEDF@C@,CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJGGJJJJJJJHHHHHHFFFFFFEEEEEEEDDDDDDDDDDD?BDDDDDDDD,CCCFFFFFHHHHHJJJIJJJJJIJIJIJJJJJJJJJIJJJJJJJJJIJJJJJIJJJJJJIJHHHGHHHFFFFE@CCDDDDDDDDCDDDDDDDEDDEDEED > chr1 46111 46212 DDEDEEEDFFFFGHFGHHJIGIJIGJJJJIIGJIIIJIIJJJIJJJIJIJJIIHJJJJHHGHFJJJIJJJJJIJJJJJIJIJJJJJJHHHHHFFFFFCCC,DDEECEDFFFFHHHHFGHGIIDJIIJIJJJJJIJJJIJIJJJJJIJJIJJIHHJJIHFFCGEJJJJJJIJJJJJJIJJJIIIIHJJJHHHHHFFFFFCCC > chr1 47250 47346 @@@DDDD?AFDDFGADGBEACHCF@?FGH@9CCFGE::CDH;CDDGCG)8CFHIBHABBB:@A@@C:,5>?CCBBCC#### > chr1 47593 47693 C@5BCACAC>EEECAE@=A=?;GGIGEAD@EEGFCFFBFFFDHEGFHBHEEGIEGGBBFCGIGAGCHBEGEHFCFBGJGCADD?BD? chr1 47820 47920 @@?DFFFFHHHGHGJJJJJIJJIIEIFIIJGJJJGHIJBGHIJIJGIJJJJJJJJIGIIIIJGHFHFHAEFFFFFDBCCEDDDDDDDDDCDCCDEDDECC > chr1 48088 48193 >@@>CDCCCC>:A>CDDDDDCC@@CEAFDFFFFHHHGGHHIGIIJIHDFCIIHIHIGHDIHGIJJIHDJJJJJJJJJGIIGJJJJJGHGHHHFDFFF@CC,CCCFFFFFHHHHHJIIIJJJJJJJJJJJIJIIIJJJJJIJJJIJJJIJJJJJJJJJJJIIIIJJJIJGJJGGHFHHHFFFFDDAACDDDDDEB(5@AC>5 > chr1 48445 48677 @?@DFDFFBHFHHBGBHIGGGGHHEIJEHGGGGHHGGHIJGGGAGGGIJIGFHIGGIJEFHHAB;;@B?;AEACECCDDDD@CCCDDDCCCCD(5?ACCD,@@DEDACCEFEFFFFHFEGGIIIIJJJJJJJIJIGEGIIJIHJJIHIIGGJIGIGJIIGJJJJJJJIJIIIIGHHJIIIFJJJJIJHFGHHHFFDFFB@@,@CCFDEFFHHHHHIIGHGIIGIEC?FGHHHFG9EGGIGIIIIIGIIIIGIHIIIIIIGIIGGIIIIIIIIIIIHIIHFHHFHFFFFFDCCAADDD??CCC > chr1 48681 48781 @@@FDFFFGDHHHIIIIGJCBFDHIGIIIJIJG):@GFECFIAHGIIIEFHHGDGGFGCAGEAEHHEEFC@B=CCCDCDCDDEAACCDDCCCCACC?ACC > chr1 48832 48932 >A>>CCCC=BCDDDEEEEEEEDBEHJIGHH@CIGGFGGIJJIIICGJIGG? chr1 48967 49067 C@;@@@;(>3CCCCCA?FDCEEA>EEHIIGIHFHCJIIHHEGC=GHGFCGJIIHHDCIGGBIIGGHFHIIGIIIHFAHEFCHGE>FGDFFHADBDBD@@@ > chr1 49092 49192 CCB;CC@CB>>CDEECCA?3;;37C?;?=CGGEIGIGCAIHDBIHGIIGFDDFAIIHCD?GDGDADC?DFFEIIGJJJGIGIIJIIJHHFFDDDADDB<@ fail merge.t35...\c 1c1 < ***** ERROR: Requested column 12, but database file fullFields.bam only has fields 1 - 11. --- > what(): BgzfStream::ReadBlock: invalid block header contents fail merge.t36...\c terminate called after throwing an instance of 'BamTools::Internal::BamException' what(): BgzfStream::ReadBlock: invalid block header contents test-merge.sh: line 447: 16065 Aborted $BT merge -i a.full.bam -c 7 -o collapse > obs 1,5d0 < chr1 10 20 . < chr1 30 100 .,.,. < chr2 10 20 . < chr2 30 40 . < chr2 42 100 .,. fail merge.t37...\c ok merge.t38...\c ok merge.t39...\c ok merge.t40...\c ok merge.t41...\c ok merge.t42...\c ok merge.t43...\c ok merge.t44...\c ok merge.t45...\c ok merge.t46...\c ok merge.t47...\c ok merge.t48...\c ok merge.t49...\c ok Testing bedtools multicov: multicov.t1...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 1 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 1 > chr1 15 27 a4 4 - 1 fail multicov.t2...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 0 > chr1 15 20 a3 3 - 1 > chr1 15 27 a4 4 - 1 fail multicov.t3...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 1 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 0 fail multicov.t4...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 1 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 1 > chr1 15 27 a4 4 - 1 fail multicov.t5...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 1 fail multicov.t6...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 0 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 1 fail multicov.t7...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 0 fail multicov.t8...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 1 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 1 fail multicov.t9...\c Could not open input BAM files. 0a1,4 > chr1 15 20 a1 1 + 0 > chr1 15 27 a2 2 + 0 > chr1 15 20 a3 3 - 0 > chr1 15 27 a4 4 - 0 fail Testing bedtools reldist: reldist.t01...\c 2c2 < 0.00 43423 43423 1.000 --- > 0.00 43424 43424 1.000 fail reldist.t02...\c ok reldist.t03...\c ok Testing bedtools slop: slop.t1...\c ok slop.t2...\c ok slop.t3...\c ok slop.t4...\c ok slop.t5...\c ok slop.t6...\c ok slop.t7...\c ok slop.t8...\c ok slop.t9...\c ok slop.t10...\c ok slop.t11...\c ok slop.t12...\c ok slop.t13...\c ok slop.t14...\c ok slop.t15...\c ok Testing bedtools sort: bash: test-sort.sh: No such file or directory Testing bedtools shuffle: shuffle.t1...\c 1,10c1,10 < chr4 18120316 18120784 trf 789 < chr21 7219372 7219545 trf 346 < chr3 44696764 44697004 trf 434 < chr4 174464900 174465122 trf 273 < chr12 94822425 94822602 trf 187 < chr8 95576893 95577058 trf 199 < chr14 83751413 83751551 trf 242 < chr8 85463512 85463547 trf 70 < chr6 120627488 120627585 trf 79 < chr8 48095009 48095050 trf 73 --- > chr9 108600879 108601347 trf 789 > chr12 9186177 9186350 trf 346 > chr8 89726287 89726527 trf 434 > chr8 40323278 40323500 trf 273 > chr8 69904335 69904512 trf 187 > chr5 138240459 138240624 trf 199 > chr11 96382483 96382621 trf 242 > chr8 105834146 105834181 trf 70 > chrX 105921488 105921585 trf 79 > chrX 125331456 125331497 trf 73 fail shuffle.t2...\c 1,20c1,20 < chr3 592740 593208 trf 789 < chr5 283241 283414 trf 346 < chr1 1146758 1146998 trf 434 < chr1 1614940 1615162 trf 273 < chr1 2523743 2523920 trf 187 < chr3 643143 643308 trf 199 < chr1 474504 474642 trf 242 < chr3 529762 529797 trf 70 < chr4 169448 169545 trf 79 < chr3 161259 161300 trf 73 < chr1 3976352 3976384 trf 64 < chr5 801033 801138 trf 149 < chr3 349579 349617 trf 58 < chr3 496504 496974 trf 278 < chr1 2520176 2520646 trf 339 < chr5 548307 548735 trf 202 < chr1 2185314 2185357 trf 59 < chr3 580280 580320 trf 62 < chr3 346921 346956 trf 52 < chr5 648960 649137 trf 302 --- > chr3 542223 542691 trf 789 > chr5 444343 444516 trf 346 > chr1 2520601 2520841 trf 434 > chr5 194760 194982 trf 273 > chr1 2121545 2121722 trf 187 > chr1 2246343 2246508 trf 199 > chr1 2724117 2724255 trf 242 > chr4 304892 304927 trf 70 > chr2 332618 332715 trf 79 > chr5 822410 822451 trf 73 > chr1 1450982 1451014 trf 64 > chr1 3218361 3218466 trf 149 > chr4 338952 338990 trf 58 > chr3 713207 713677 trf 278 > chr1 4378307 4378777 trf 339 > chr1 4451988 4452416 trf 202 > chr1 1545567 1545610 trf 59 > chr1 573175 573215 trf 62 > chr4 931201 931236 trf 52 > chr1 4215777 4215954 trf 302 fail shuffle.t3...\c 1,20c1,20 < chr2 128881 129349 trf 789 < chr2 146758 146931 trf 346 < chr2 800535 800775 trf 434 < chr4 643143 643365 trf 273 < chr3 233696 233873 trf 187 < chr3 169448 169613 trf 199 < chr4 313867 314005 trf 242 < chr3 801033 801068 trf 70 < chr3 541169 541266 trf 79 < chr5 520176 520217 trf 73 < chr4 112916 112948 trf 64 < chr5 580280 580385 trf 149 < chr5 195221 195259 trf 58 < chr1 527447 527917 trf 278 < chr1 4001951 4002421 trf 339 < chr2 391843 392271 trf 202 < chr1 2069454 2069497 trf 59 < chr5 877263 877303 trf 62 < chr5 743195 743230 trf 52 < chr1 3931688 3931865 trf 302 --- > chr5 310009 310477 trf 789 > chr4 520601 520774 trf 346 > chr2 130650 130890 trf 434 > chr1 3246343 3246565 trf 273 > chr2 968160 968337 trf 187 > chr3 332618 332783 trf 199 > chr4 638727 638865 trf 242 > chr3 218361 218396 trf 70 > chr1 2259217 2259314 trf 79 > chr3 378307 378348 trf 73 > chr4 447387 447419 trf 64 > chr3 573175 573280 trf 149 > chr2 106791 106829 trf 58 > chr3 618697 619167 trf 278 > chr2 211901 212371 trf 339 > chr5 656883 657311 trf 202 > chr2 993338 993381 trf 59 > chr2 713531 713571 trf 62 > chr2 428268 428303 trf 52 > chr4 590632 590809 trf 302 fail shuffle.t4...\c ok shuffle.t5...\c 1,10c1,10 < chr4 18120316 18120784 trf 789 < chr3 44696764 44697004 trf 434 < chr1 124123417 124123522 trf 149 < chr1 124123417 124123522 trf 149 < chr1 202671963 202672001 trf 58 < chr1 202671963 202672001 trf 58 < chr2 14591939 14592409 trf 339 < chr2 8329659 8329699 trf 62 < chr1 120971344 120971521 trf 302 < chr1 120971344 120971521 trf 302 --- > chr1 150415830 150415862 trf 64 > chr1 150415830 150415862 trf 64 > chr5 78078743 78079213 trf 339 > chr4 84711820 84712248 trf 202 > chr4 61777751 61777794 trf 59 > chr3 28583223 28583400 trf 302 > chr1 55933709 55934092 trf 712 > chr1 55933709 55934092 trf 712 > chr1 39686691 39686725 trf 68 > chr2 2555287 2555330 trf 86 fail Testing bedtools subtract: subtract.t1...\c ok subtract.t2...\c ok subtract.t3...\c ok subtract.t4...\c ok subtract.t5...\c ok subtract.t6...\c ok subtract.t7...\c ok subtract.t8...\c ok subtract.t9...\c ok subtract.t10...\c ok subtract.t11...\c ok subtract.t12...\c ok subtract.t13...\c ok subtract.t14...\c ok subtract.t15...\c ok subtract.t16...\c ok subtract.t17...\c ok subtract.t18...\c ok subtract.t19...\c ok subtract.t20...\c ok subtract.t21...\c ok Testing bedtools sample: sample.t01...\c ok sample.new.t02...\c ok sample.new.t03...\c ok sample.new.t04...\c ok sample.new.t05...\c ok sample.new.t06...\c ok sample.new.t07...\c ok sample.new.t08...\c ok sample.new.t09...\c ok Testing bedtools split: split.01.size...\c 1,10c1,10 < _tmp.00001.bed 9943540 200 < _tmp.00002.bed 9943482 201 < _tmp.00003.bed 9943541 200 < _tmp.00004.bed 9943561 200 < _tmp.00005.bed 9943471 200 < _tmp.00006.bed 9943475 200 < _tmp.00007.bed 9943468 200 < _tmp.00008.bed 9943487 200 < _tmp.00009.bed 9943539 200 < _tmp.00010.bed 9943531 200 --- > _tmp.00001.bed 9881076 200 > _tmp.00002.bed 9881080 200 > _tmp.00003.bed 9881064 201 > _tmp.00004.bed 9881078 200 > _tmp.00005.bed 9881090 200 > _tmp.00006.bed 9881060 200 > _tmp.00007.bed 9881077 200 > _tmp.00008.bed 9881064 201 > _tmp.00009.bed 9881066 200 > _tmp.00010.bed 9881055 200 fail split.02.simple...\c 1,10c1,10 < _tmp.00001.bed 9952674 200 < _tmp.00002.bed 9751661 200 < _tmp.00003.bed 9649058 200 < _tmp.00004.bed 9929508 200 < _tmp.00005.bed 9556713 200 < _tmp.00006.bed 10298876 200 < _tmp.00007.bed 10043102 200 < _tmp.00008.bed 9781861 200 < _tmp.00009.bed 9502188 200 < _tmp.00010.bed 9991229 200 --- > _tmp.00001.bed 9900975 200 > _tmp.00002.bed 9194638 200 > _tmp.00003.bed 8962895 200 > _tmp.00004.bed 9512317 200 > _tmp.00005.bed 10419434 200 > _tmp.00006.bed 9831418 200 > _tmp.00007.bed 9612513 200 > _tmp.00008.bed 9443989 200 > _tmp.00009.bed 9863751 200 > _tmp.00010.bed 10491634 200 fail spliit.03.simple...\c 1,10c1,10 < _tmp.00001.bed 414150 10 < _tmp.00002.bed 586843 10 < _tmp.00003.bed 503604 10 < _tmp.00004.bed 410044 10 < _tmp.00005.bed 499400 10 < _tmp.00006.bed 537341 10 < _tmp.00007.bed 698581 10 < _tmp.00008.bed 555258 10 < _tmp.00009.bed 474511 10 < _tmp.00010.bed 633012 10 --- > _tmp.00001.bed 578253 10 > _tmp.00002.bed 435450 10 > _tmp.00003.bed 490286 10 > _tmp.00004.bed 457017 10 > _tmp.00005.bed 542067 10 > _tmp.00006.bed 482978 10 > _tmp.00007.bed 433942 10 > _tmp.00008.bed 675493 10 > _tmp.00009.bed 425811 10 > _tmp.00010.bed 524622 10 fail Testing bedtools spacing: spacing.t01...\c ok make[1]: Leaving directory '/«PKGBUILDDIR»' fakeroot debian/rules binary-arch dh binary-arch dh_testroot -a dh_prep -a rm -f debian/bedtools.substvars rm -f debian/bedtools.*.debhelper rm -rf debian/bedtools/ dh_auto_install -a install -d debian/bedtools make -j1 install DESTDIR=/«PKGBUILDDIR»/debian/tmp AM_UPDATE_INFO_DIR=no make[1]: Entering directory '/«PKGBUILDDIR»' Building BEDTools: ========================================================= DETECTED_VERSION = v2.25.0 CURRENT_VERSION = v2.25.0 * Creating BamTools API - Building in src/utils/bedFile make[2]: '../../../obj//bedFile.o' is up to date. - Building in src/utils/BinTree make[2]: '../../../obj//BinTree.o' is up to date. - Building in src/utils/version make[2]: Nothing to be done for 'all'. - Building in src/utils/bedGraphFile make[2]: '../../../obj//bedGraphFile.o' is up to date. - Building in src/utils/chromsweep make[2]: '../../../obj//chromsweep.o' is up to date. - Building in src/utils/Contexts make[2]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools - Building in FileReaders make[3]: Nothing to be done for 'all'. - Building in Records make[3]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools/FileReaders make[2]: Nothing to be done for 'all'. - Building in src/utils/FileRecordTools/Records make[2]: Nothing to be done for 'all'. - Building in src/utils/general make[2]: Nothing to be done for 'all'. - Building in src/utils/gzstream make[2]: '../../../obj//gzstream.o' is up to date. - Building in src/utils/fileType make[2]: Nothing to be done for 'all'. - Building in src/utils/bedFilePE make[2]: '../../../obj//bedFilePE.o' is up to date. - Building in src/utils/KeyListOps make[2]: Nothing to be done for 'all'. - Building in src/utils/NewChromsweep make[2]: Nothing to be done for 'all'. - Building in src/utils/sequenceUtilities make[2]: '../../../obj//sequenceUtils.o' is up to date. - Building in src/utils/tabFile make[2]: '../../../obj//tabFile.o' is up to date. - Building in src/utils/BamTools make[2]: Nothing to be done for 'all'. - Building in src/utils/BamTools-Ancillary make[2]: Nothing to be done for 'all'. - Building in src/utils/BlockedIntervals make[2]: Nothing to be done for 'all'. - Building in src/utils/Fasta make[2]: Nothing to be done for 'all'. - Building in src/utils/VectorOps make[2]: '../../../obj//VectorOps.o' is up to date. - Building in src/utils/GenomeFile make[2]: '../../../obj//NewGenomeFile.o' is up to date. - Building in src/utils/RecordOutputMgr make[2]: '../../../obj//RecordOutputMgr.o' is up to date. - Building in src/utils/ToolBase make[2]: '../../../obj//ToolBase.o' is up to date. - Building in src/utils/driver make[2]: Nothing to be done for 'all'. - Building in src/annotateBed make[2]: Nothing to be done for 'all'. - Building in src/bamToBed make[2]: Nothing to be done for 'all'. - Building in src/bamToFastq make[2]: Nothing to be done for 'all'. - Building in src/bedToBam make[2]: Nothing to be done for 'all'. - Building in src/bedpeToBam make[2]: Nothing to be done for 'all'. - Building in src/bedToIgv make[2]: Nothing to be done for 'all'. - Building in src/bed12ToBed6 make[2]: Nothing to be done for 'all'. - Building in src/closestFile make[2]: Nothing to be done for 'all'. - Building in src/clusterBed make[2]: Nothing to be done for 'all'. - Building in src/complementFile make[2]: Nothing to be done for 'all'. - Building in src/coverageFile make[2]: Nothing to be done for 'all'. - Building in src/expand make[2]: Nothing to be done for 'all'. - Building in src/fastaFromBed make[2]: Nothing to be done for 'all'. - Building in src/flankBed make[2]: Nothing to be done for 'all'. - Building in src/genomeCoverageBed make[2]: Nothing to be done for 'all'. - Building in src/getOverlap make[2]: Nothing to be done for 'all'. - Building in src/groupBy make[2]: Nothing to be done for 'all'. - Building in src/intersectFile make[2]: Nothing to be done for 'all'. - Building in src/fisher make[2]: Nothing to be done for 'all'. - Building in src/jaccard make[2]: Nothing to be done for 'all'. - Building in src/linksBed make[2]: Nothing to be done for 'all'. - Building in src/maskFastaFromBed make[2]: Nothing to be done for 'all'. - Building in src/mapFile make[2]: Nothing to be done for 'all'. - Building in src/mergeFile make[2]: Nothing to be done for 'all'. - Building in src/multiBamCov make[2]: Nothing to be done for 'all'. - Building in src/multiIntersectBed make[2]: Nothing to be done for 'all'. - Building in src/nekSandbox1 make[2]: Nothing to be done for 'all'. - Building in src/nucBed make[2]: Nothing to be done for 'all'. - Building in src/pairToBed make[2]: Nothing to be done for 'all'. - Building in src/pairToPair make[2]: Nothing to be done for 'all'. - Building in src/randomBed make[2]: Nothing to be done for 'all'. - Building in src/regressTest compiling RegressTest.cpp RegressTest.cpp: In member function 'bool RegressTest::executeAndCompareCorrectness(const fileListType&)': RegressTest.cpp:431:25: warning: ignoring return value of 'int system(const char*)', declared with attribute warn_unused_result [-Wunused-result] system(diffCmd.c_str()); ^ RegressTest.cpp: In member function 'bool RegressTest::startMemoryProfile(bool)': RegressTest.cpp:573:24: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ RegressTest.cpp: In member function 'bool RegressTest::calcMemoryStats()': RegressTest.cpp:622:25: warning: ignoring return value of 'char* fgets(char*, int, FILE*)', declared with attribute warn_unused_result [-Wunused-result] fgets(sLine, 4192, fp); ^ compiling regressTestMain.cpp - Building in src/reldist make[2]: Nothing to be done for 'all'. - Building in src/sampleFile make[2]: Nothing to be done for 'all'. - Building in src/shuffleBed make[2]: Nothing to be done for 'all'. - Building in src/slopBed make[2]: Nothing to be done for 'all'. - Building in src/sortBed make[2]: Nothing to be done for 'all'. - Building in src/spacingFile make[2]: Nothing to be done for 'all'. - Building in src/split make[2]: Nothing to be done for 'all'. - Building in src/subtractFile make[2]: Nothing to be done for 'all'. - Building in src/tagBam make[2]: Nothing to be done for 'all'. - Building in src/unionBedGraphs make[2]: Nothing to be done for 'all'. - Building in src/windowBed make[2]: Nothing to be done for 'all'. - Building in src/windowMaker make[2]: Nothing to be done for 'all'. - Building main bedtools binary. done. - Creating executables for old CLI. done. mkdir -p /«PKGBUILDDIR»/debian/tmp/usr/local/bin for file in bin/* ; do \ cp -f $file /«PKGBUILDDIR»/debian/tmp/usr/local/bin; \ done make[1]: Leaving directory '/«PKGBUILDDIR»' debian/rules override_dh_install make[1]: Entering directory '/«PKGBUILDDIR»' dh_install install -d debian/bedtools/usr/bin cp --reflink=auto -a ./bin/annotateBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bamToBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bamToFastq debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bed12ToBed6 debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bedpeToBam debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bedToBam debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bedToIgv debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/bedtools debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/closestBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/clusterBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/complementBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/coverageBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/expandCols debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/fastaFromBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/flankBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/genomeCoverageBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/getOverlap debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/groupBy debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/intersectBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/linksBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/mapBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/maskFastaFromBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/mergeBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/multiBamCov debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/multiIntersectBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/nucBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/pairToBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/pairToPair debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/randomBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/shuffleBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/slopBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/sortBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/subtractBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/tagBam debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/unionBedGraphs debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/windowBed debian/bedtools/usr/bin/ cp --reflink=auto -a ./bin/windowMaker debian/bedtools/usr/bin/ install -d debian/bedtools/usr/share/bedtools cp --reflink=auto -a ./genomes debian/bedtools/usr/share/bedtools/ install -d debian/bedtools//usr/share/bash-completion/completions cp --reflink=auto -a ./debian/bash_completion/bedtools debian/bedtools//usr/share/bash-completion/completions/ rm -f /«PKGBUILDDIR»/debian/bedtools/usr/bin/groupBy # distributed in the filo package. # make sure all *.sh files are featuring a '#!/bin/bash' as first line # since there are at least two files (test/intersect/{new_test-intersect.sh,performanceTest.sh} # requiring bash this is taken for all scripts instead of checking first via /bin/sh -n for sh in `find /«PKGBUILDDIR»/debian -name "*.sh"` ; do \ if ! head -n1 ${sh} | grep -q '^#! */bin/[ba]*sh' ; then \ sed -i '1 i #!/bin/bash' ${sh} ; \ fi ; \ done make[1]: Leaving directory '/«PKGBUILDDIR»' dh_installdocs -a install -d debian/bedtools/usr/share/doc/bedtools cp --reflink=auto -a README.md debian/bedtools/usr/share/doc/bedtools chown -R 0:0 debian/bedtools/usr/share/doc chmod -R go=rX debian/bedtools/usr/share/doc chmod -R u\+rw debian/bedtools/usr/share/doc install -p -m0644 debian/copyright debian/bedtools/usr/share/doc/bedtools/copyright debian/rules override_dh_installchangelogs make[1]: Entering directory '/«PKGBUILDDIR»' dh_installchangelogs RELEASE_HISTORY install -p -m0644 debian/changelog debian/bedtools/usr/share/doc/bedtools/changelog.Debian install -p -m0644 RELEASE_HISTORY debian/bedtools/usr/share/doc/bedtools/changelog make[1]: Leaving directory '/«PKGBUILDDIR»' dh_perl -a dh_link -a dh_compress -a cd debian/bedtools chmod a-x usr/share/doc/bedtools/changelog usr/share/doc/bedtools/changelog.Debian gzip -9nf usr/share/doc/bedtools/changelog usr/share/doc/bedtools/changelog.Debian cd '/«PKGBUILDDIR»' debian/rules override_dh_fixperms make[1]: Entering directory '/«PKGBUILDDIR»' dh_fixperms find debian/bedtools -print0 2>/dev/null | xargs -0r chown --no-dereference 0:0 find debian/bedtools ! -type l -print0 2>/dev/null | xargs -0r chmod go=rX,u+rw,a-s find debian/bedtools/usr/share/doc -type f ! -regex 'debian/bedtools/usr/share/doc/[^/]*/examples/.*' -print0 2>/dev/null | xargs -0r chmod 0644 find debian/bedtools/usr/share/doc -type d -print0 2>/dev/null | xargs -0r chmod 0755 find debian/bedtools/usr/share/man debian/bedtools/usr/man/ debian/bedtools/usr/X11*/man/ -type f -print0 2>/dev/null | xargs -0r chmod 0644 find debian/bedtools/usr/include -type f -print0 2>/dev/null | xargs -0r chmod 0644 find debian/bedtools/usr/share/applications -type f -print0 2>/dev/null | xargs -0r chmod 0644 find debian/bedtools/usr/lib/powerpc-linux-gnu/perl5/5.20 debian/bedtools/usr/share/perl5 -type f -perm -5 -name '*.pm' -print0 2>/dev/null | xargs -0r chmod a-X find debian/bedtools -perm -5 -type f \( -name '*.so.*' -o -name '*.so' -o -name '*.la' -o -name '*.a' -o -name '*.js' -o -name '*.css' -o -name '*.jpeg' -o -name '*.jpg' -o -name '*.png' -o -name '*.gif' -o -name '*.cmxs' \) -print0 2>/dev/null | xargs -0r chmod 0644 find debian/bedtools/usr/bin -type f -print0 2>/dev/null | xargs -0r chmod a+x find debian/bedtools/usr/lib -type f -name '*.ali' -print0 2>/dev/null | xargs -0r chmod uga-w chmod -x /«PKGBUILDDIR»/debian/bedtools/usr/share/bedtools/genomes/*.genome find /«PKGBUILDDIR»/debian -name "*.bed" -executable -exec chmod -x \{\} \; find /«PKGBUILDDIR»/debian -name "*.sh" -not -executable -exec chmod +x \{\} \; make[1]: Leaving directory '/«PKGBUILDDIR»' dh_strip -a dh_strip debug symbol extraction: enabling -a due to Build-Debug-Symbols: yes in /CurrentlyBuilding dh_strip debug symbol extraction: all non-arch-all packages for this build platform powerpc: bedtools dh_strip debug symbol extraction: packages to act on: bedtools dh_strip debug symbol extraction: ignored packages: Using buildid for compat level >= 9 bedtools has no unstripped objects, ignoring find: `/«PKGBUILDDIR»/debian/bedtools-dbgsym': No such file or directory /usr/bin/pkg_create_dbgsym: nothing in /«PKGBUILDDIR»/debian/bedtools-dbgsym and no dbgdepends, ignoring strip --remove-section=.comment --remove-section=.note debian/bedtools/usr/bin/bedtools dh_makeshlibs -a rm -f debian/bedtools/DEBIAN/shlibs dh_shlibdeps -a install -d debian/bedtools/DEBIAN dpkg-shlibdeps -Tdebian/bedtools.substvars debian/bedtools/usr/bin/bedtools dh_installdeb -a dh_gencontrol -a echo misc:Depends= >> debian/bedtools.substvars echo misc:Pre-Depends= >> debian/bedtools.substvars dpkg-gencontrol -pbedtools -ldebian/changelog -Tdebian/bedtools.substvars -Pdebian/bedtools dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe chmod 0644 debian/bedtools/DEBIAN/control chown 0:0 debian/bedtools/DEBIAN/control dh_gencontrol debug symbol wrapper: all non-arch-all packages for this build platform powerpc: bedtools dh_gencontrol debug symbol wrapper: packages to act on: bedtools dh_gencontrol debug symbol wrapper: ignored packages: dh_gencontrol debug symbol wrapper: no debian/bedtools-dbgsym, skipping package bedtools dh_md5sums -a (cd debian/bedtools >/dev/null ; find . -type f ! -regex './DEBIAN/.*' -printf '%P\0' | LC_ALL=C sort -z | xargs -r0 md5sum > DEBIAN/md5sums) >/dev/null chmod 0644 debian/bedtools/DEBIAN/md5sums chown 0:0 debian/bedtools/DEBIAN/md5sums dh_builddeb -a dpkg-deb --build debian/bedtools .. INFO: pkgstriptranslations version 122 pkgstriptranslations: processing bedtools (in debian/bedtools); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/bedtools/DEBIAN/control, package bedtools, directory debian/bedtools .. removing usr/share/doc/bedtools/changelog.gz pkgstripfiles: Truncating usr/share/doc/bedtools/changelog.Debian.gz to topmost ten records pkgstripfiles: PNG optimization for package bedtools took 0 s dpkg-deb: building package 'bedtools' in '../bedtools_2.25.0-1_powerpc.deb'. dpkg-genchanges -B -mLaunchpad Build Daemon >../bedtools_2.25.0-1_powerpc.changes dpkg-genchanges: binary-only arch-specific upload (source code and arch-indep packages not included) dpkg-source --after-build bedtools-2.25.0 dpkg-source: info: using options from bedtools-2.25.0/debian/source/options: --single-debian-patch dpkg-buildpackage: binary-only upload (no source included) ──────────────────────────────────────────────────────────────────────────────── Build finished at 20151023-1859 Finished ──────── I: Built successfully ┌──────────────────────────────────────────────────────────────────────────────┐ │ Post Build Chroot │ └──────────────────────────────────────────────────────────────────────────────┘ ┌──────────────────────────────────────────────────────────────────────────────┐ │ Changes │ └──────────────────────────────────────────────────────────────────────────────┘ bedtools_2.25.0-1_powerpc.changes: ────────────────────────────────── Format: 1.8 Date: Fri, 04 Sep 2015 16:55:21 +0200 Source: bedtools Binary: bedtools bedtools-test Architecture: powerpc Version: 2.25.0-1 Distribution: xenial-proposed Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Charles Plessy Description: bedtools - suite of utilities for comparing genomic features bedtools-test - test data for the bedtools package Changes: bedtools (2.25.0-1) unstable; urgency=medium . e37865 Merge tag 'v2.25.0' into debian/unstable Checksums-Sha1: 7f929ad295caf54fa5eb0cf26cb1e46f0c6dcd73 518356 bedtools_2.25.0-1_powerpc.deb Checksums-Sha256: 3865357560e65e99b3ad8d4c51b5bfe27039f3b2e1c8214e78bcf98ceaeff0f8 518356 bedtools_2.25.0-1_powerpc.deb Files: db187dc1f4cddeb4b5a28b19b1ff0a4a 518356 science optional bedtools_2.25.0-1_powerpc.deb ┌──────────────────────────────────────────────────────────────────────────────┐ │ Package contents │ └──────────────────────────────────────────────────────────────────────────────┘ bedtools_2.25.0-1_powerpc.deb ───────────────────────────── new debian package, version 2.0. size 518356 bytes: control archive=2071 bytes. 918 bytes, 19 lines control 2678 bytes, 46 lines md5sums Package: bedtools Version: 2.25.0-1 Architecture: powerpc Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 2018 Depends: libc6 (>= 2.15), libgcc1 (>= 1:4.1.1), libstdc++6 (>= 5.2), zlib1g (>= 1:1.2.3.3) Suggests: filo Section: science Priority: optional Homepage: http://code.google.com/p/bedtools/ Description: suite of utilities for comparing genomic features The BEDTools utilities allow one to address common genomics tasks such as finding feature overlaps and computing coverage. The utilities are largely based on four widely-used file formats: BED, GFF/GTF, VCF, and SAM/BAM. Using BEDTools, one can develop sophisticated pipelines that answer complicated research questions by streaming several BEDTools together. . The groupBy utility is distributed in the filo package. drwxr-xr-x root/root 0 2015-10-23 18:58 ./ drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/ drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/bin/ -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/annotateBed -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/bamToBed -rwxr-xr-x root/root 43 2015-10-23 18:58 ./usr/bin/bamToFastq -rwxr-xr-x root/root 44 2015-10-23 18:58 ./usr/bin/bed12ToBed6 -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/bedToBam -rwxr-xr-x root/root 36 2015-10-23 18:58 ./usr/bin/bedToIgv -rwxr-xr-x root/root 43 2015-10-23 18:58 ./usr/bin/bedpeToBam -rwxr-xr-x root/root 1968852 2015-10-23 18:58 ./usr/bin/bedtools -rwxr-xr-x root/root 40 2015-10-23 18:58 ./usr/bin/closestBed -rwxr-xr-x root/root 40 2015-10-23 18:58 ./usr/bin/clusterBed -rwxr-xr-x root/root 43 2015-10-23 18:58 ./usr/bin/complementBed -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/coverageBed -rwxr-xr-x root/root 39 2015-10-23 18:58 ./usr/bin/expandCols -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/fastaFromBed -rwxr-xr-x root/root 38 2015-10-23 18:58 ./usr/bin/flankBed -rwxr-xr-x root/root 42 2015-10-23 18:58 ./usr/bin/genomeCoverageBed -rwxr-xr-x root/root 40 2015-10-23 18:58 ./usr/bin/getOverlap -rwxr-xr-x root/root 42 2015-10-23 18:58 ./usr/bin/intersectBed -rwxr-xr-x root/root 38 2015-10-23 18:58 ./usr/bin/linksBed -rwxr-xr-x root/root 36 2015-10-23 18:58 ./usr/bin/mapBed -rwxr-xr-x root/root 42 2015-10-23 18:58 ./usr/bin/maskFastaFromBed -rwxr-xr-x root/root 38 2015-10-23 18:58 ./usr/bin/mergeBed -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/multiBamCov -rwxr-xr-x root/root 43 2015-10-23 18:58 ./usr/bin/multiIntersectBed -rwxr-xr-x root/root 36 2015-10-23 18:58 ./usr/bin/nucBed -rwxr-xr-x root/root 42 2015-10-23 18:58 ./usr/bin/pairToBed -rwxr-xr-x root/root 43 2015-10-23 18:58 ./usr/bin/pairToPair -rwxr-xr-x root/root 39 2015-10-23 18:58 ./usr/bin/randomBed -rwxr-xr-x root/root 40 2015-10-23 18:58 ./usr/bin/shuffleBed -rwxr-xr-x root/root 37 2015-10-23 18:58 ./usr/bin/slopBed -rwxr-xr-x root/root 37 2015-10-23 18:58 ./usr/bin/sortBed -rwxr-xr-x root/root 41 2015-10-23 18:58 ./usr/bin/subtractBed -rwxr-xr-x root/root 36 2015-10-23 18:58 ./usr/bin/tagBam -rwxr-xr-x root/root 42 2015-10-23 18:58 ./usr/bin/unionBedGraphs -rwxr-xr-x root/root 39 2015-10-23 18:58 ./usr/bin/windowBed -rwxr-xr-x root/root 44 2015-10-23 18:58 ./usr/bin/windowMaker drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/share/ drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/share/bash-completion/ drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/share/bash-completion/completions/ -rw-r--r-- root/root 638 2015-09-04 10:58 ./usr/share/bash-completion/completions/bedtools drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/share/bedtools/ drwxr-xr-x root/root 0 2015-09-03 00:36 ./usr/share/bedtools/genomes/ -rw-r--r-- root/root 856 2015-09-03 00:36 ./usr/share/bedtools/genomes/human.hg18.genome -rw-r--r-- root/root 1972 2015-09-03 00:36 ./usr/share/bedtools/genomes/human.hg19.genome -rw-r--r-- root/root 11672 2015-09-03 00:36 ./usr/share/bedtools/genomes/human.hg38.genome -rw-r--r-- root/root 1607 2015-09-03 00:36 ./usr/share/bedtools/genomes/mouse.mm10.genome.txt -rw-r--r-- root/root 565 2015-09-03 00:36 ./usr/share/bedtools/genomes/mouse.mm8.genome -rw-r--r-- root/root 585 2015-09-03 00:36 ./usr/share/bedtools/genomes/mouse.mm9.genome drwxr-xr-x root/root 0 2015-10-23 18:58 ./usr/share/doc/ drwxr-xr-x root/root 0 2015-10-23 18:59 ./usr/share/doc/bedtools/ -rw-r--r-- root/root 3397 2015-09-03 00:36 ./usr/share/doc/bedtools/README.md -rw-r--r-- root/root 1736 2015-10-23 18:59 ./usr/share/doc/bedtools/changelog.Debian.gz -rw-r--r-- root/root 5352 2015-09-04 11:08 ./usr/share/doc/bedtools/copyright ┌──────────────────────────────────────────────────────────────────────────────┐ │ Post Build │ └──────────────────────────────────────────────────────────────────────────────┘ ┌──────────────────────────────────────────────────────────────────────────────┐ │ Cleanup │ └──────────────────────────────────────────────────────────────────────────────┘ Not removing build depends: as requested Keeping session: ┌──────────────────────────────────────────────────────────────────────────────┐ │ Summary │ └──────────────────────────────────────────────────────────────────────────────┘ Build Architecture: powerpc Build-Space: 67684 Build-Time: 163 Distribution: xenial-proposed Host Architecture: powerpc Install-Time: 26 Job: bedtools_2.25.0-1.dsc Machine Architecture: powerpc Package: bedtools Package-Time: 191 Source-Version: 2.25.0-1 Space: 67684 Status: successful Version: 2.25.0-1 ──────────────────────────────────────────────────────────────────────────────── Finished at 20151023-1859 Build needed 00:03:11, 67684k disc space RUN: /usr/share/launchpad-buildd/slavebin/scan-for-processes ['scan-for-processes', 'PACKAGEBUILD-8175951'] Scanning for processes to kill in build /home/buildd/build-PACKAGEBUILD-8175951/chroot-autobuild... RUN: /usr/share/launchpad-buildd/slavebin/umount-chroot ['umount-chroot', 'PACKAGEBUILD-8175951'] Unmounting chroot for build PACKAGEBUILD-8175951... RUN: /usr/share/launchpad-buildd/slavebin/remove-build ['remove-build', 'PACKAGEBUILD-8175951'] Removing build PACKAGEBUILD-8175951